Structure of crude polysaccharides from Atractylodes lancea rhizome and treatment of diarrhea owing to spleen deficiency through intestinal flora.

To optimize the extraction process of crude polysaccharides from Atractylodes and elaborate the mechanism of Atractylodes polysaccharides in treating diarrhea owing to spleen deficiency, so as to lay a foundation for further development and utilization of Atractylodes lancea, we used an orthogonal test to optimize the extraction process and established a model of spleen deficiency. It was further combined with histopathology and intestinal flora to elaborate the mechanism of Atractylodes polysaccharides in the treatment of spleen-deficiency diarrhea. The optimized extraction conditions were as follows: the ratio of material to liquid was 1:25; the rotational speed was 150 rpm; the extraction temperature was 60°C; the extraction time was 2 h; and the extraction rate was about 23%. The therapeutic effect of Atractylodes polysaccharides on a spleen-deficiency diarrhea model in mice showed that the water content of stools and diarrhea grade in the treatment group were alleviated, and the levels of gastrin, motilin and d-xylose were improved. The analysis results based on gut microbiota showed that the model group had a higher diversity of gut microbiota than the normal group and treatment group, and the treatment group could correct the diversity of gut microbiota in model mice. Analysis based on the level of phylum and genus showed that the treatment group could inhibit the abundance of Helicobacter pylori genus and increase beneficial bacteria genera. The conclusion was that the optimized extraction process of Atractylodes polysaccharides was reasonable and feasible, and had a good therapeutic effect on spleen deficiency diarrhea.

First Detection of Atractylodes Mild Mottle Virus in Atractylodes lancea (Thunb.) DC. in Hubei Province of China.

The cultivated aromatic medicinal herb Atractylodes lancea (Thunb.) DC. is widely used in the pharmaceuticals, nutraceuticals, and cosmetics industries (Na-Bangchang et al. 2014; Zhan et al. 2023). Huanggang in Hubei Province is a major production area for A. lancea (Huang et al. 2022; Wang et al. 2023). In April 2023, more than two-thirds of the surveyed plant leaves in this region exhibited virus-like symptoms, such as curling and mosaic patterns. To identify the underlying cause, 80 symptomatic plant leaf samples were collected from four fields (20 leaves per field) in this region and pooled for virome analysis. Total RNA, including ribosomal RNA, was extracted from the pooled samples using the Plant RNA Extraction Mini Kit (Onrew Biotech, Guangdong, China), for sequencing library construction. The Illumina NovaSeq 6000 platform was used to sequence the library and generate 150 bp paired-end reads. After processing the raw data with Trimmomatic software, a total of 44,354,650 high-quality clean reads were obtained. The clean reads were aligned against ribosomal RNA using BWA software (v0.7.17) to avoid interference and eliminate corresponding sequences. After removing potential contamination, contig assembly of the clean reads was performed using Megahit software (v1.2.9). The resulting contigs were compared with the virus NT database using the BLASTn program. Sequence pairwise comparison revealed 8 contigs (574 nt to 2243 nt) with identities ranging from 81.88% to 90.77% with Atractylodes mild mottle virus (AMMV, NC_027924.1, Lim et al., 2015). Additionally, contigs mapped to Carlavirus, Pelarspovirus, and other plant viruses in our virome dataset had low coverage and pairwise identity (less than 70%), which need to be further investigated. The presence of AMMV was confirmed by aligning the clean reads to the reference sequence (NC_027924.1) using BWA and SAMtools software, resulting in a consensus sequence (8024 nt) with gaps. DNA extraction from the pooled samples was performed using the Rapid Universal Genomic DNA Extraction Kit (Simgen, Zhejiang, China). Two pairs of specific primers, 3399F (5'-AAAGAAGAACCTCCTGATACGG-3')/5924R (5'-TGAACCTGATTCTCTTGGC-3') and 1830F (5'- CTCAGGAAATCCCAATGC -3')/3640R(5'-TTTCCCAATGTTCTTCGGG-3'), were designed to amplify the complete gene sequences of polymerase and coat protein (CP), based on the consensus sequence. The PCR products with the lengths of 2521 bp and 1814 bp were cloned into the pMD18-T vector (Takara Biotech, Dalian, China) for sequencing. The BLASTn analysis showed that the polymerase and CP gene sequences shared an identity of 94.51% (1929/2041 nt) and 88.41% (1419/1605 nt) with the AMMV isolate (NC_027924.1), respectively. The sequences have been deposited in GenBank under the accession numbers OR544810 and OR544811. We collected leaves from 32 A. lancea plants (16 symptomatic and 16 asymptomatic) in the fields. RT-PCR was conducted using CPF (5'-CTGCGAATATGAAAGTGC-3') and CPR (5'-GGTGAGCTTGTCTGTTAGG-3') primers, which were designed targeting a 527bp fragment of the CP gene (OR544811). Amplicons of the expected size (527bp) were detected in 24 plants (11 symptomatic and 13 asymptomatic), three of which were sequenced by Sanger sequencing, showing a 100% match to OR544811. These findings indicate that AMMV is prevalent in the major production area of A. lancea. Further research is needed to better characterize the potential risks of AMMV to A. lancea cultivation in China as well as other countries.

[Research progress on biological characteristics and propagation technology of Atractylodes lancea].

Atractylodes lancea is a perennial herb of the Asteraceae family and is one of the well-known traditional Chinese medicine(TCM). Several studies have documented polyene alkyne and sesquiterpenoid compounds as the main bioactive compounds of A. lancea, especially atractylodin, atractylon, ß-eudesmol, and hinesol in its rhizomes, which possess anti-virus, anti-inflammation, hypoglycemic, anti-hypoxia, liver protection, and diuresis activities. In parallel with the recent advancements in biotechnology, important achievements have been made in the study of biological characteristics and propagation technology of A. lancea. This study reviews the research progress on morphological features, cytogenetics, ecological planting, effective ingredients, and tissue culture techniques of A. lancea from the biology perspective, so as to provide a theoretical basis for reasonable development of A. lancea resources.

Effects of Atractylodes lancea extracts on intestinal flora and serum metabolites in mice with intestinal dysbacteriosis.

OBJECTIVE: This study aims to explore the effect of an extract of Atractylodes lancea (A. lancea) on antibiotics-induced intestinal tract disorder and the probable therapeutic mechanisms employed by this extract to ameliorate these disorders. METHODS: Three days after acclimatization, nine male and nine female specific-pathogen-free (SPF) mice were randomly assigned into three groups: Group C (normal saline), Group M (antibiotic: cefradine + gentamicin), and Group T (antibiotic + A. lancea extract). Each mouse in Groups M and T received intragastric (i.g.) gavage antibiotics containing cefradine and gentamicin sulfate (0.02 ml/g-1/D-1) for 7 days. A. lancea extract (0.02 ml/g-1/D-1) was administered by i.g. gavage to Group T mice for 7 days following the cessation of antibiotic therapy. Group M received an equivalent volume of normal saline for 7 days, while Group C received an equivalent volume of normal saline for 14 days. Afterwards, we collected mouse feces to assess changes in intestinal microbiota by 16S ribosomal ribonucleic acid (rRNA) sequencing and metabolomics. In addition, serum samples were gathered and analyzed using liquid chromatography-mass spectrometry (LS-MS). Finally, we performed a correlation analysis between intestinal microbiota and metabolites. RESULTS: After treatment with antibiotic, the richness and diversity of the flora, numbers of wall-breaking bacteria and Bacteroidetes, and the numbers of beneficial bacteria decreased, while the numbers of harmful bacteria increased. After i.g. administration of A. lancea extract, the imbalance of microbial flora began to recover. Antibiotics primarily influence the metabolism of lipids, steroids, peptides, organic acids, and carbohydrates, with lipid compounds ranking first. Arachidonic acid (AA), arginine, and proline have relatively strong effects on the metabolisms of antibiotic-stressed mice. Our findings revealed that A. lancea extract might restore the metabolism of AA and L-methionine. The content of differential metabolites detected in the serum of Group T mice was comparable to that in the serum of Group C mice, but significantly different from that of Group M mice. Compared to putative biomarkers in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, it was found that altered metabolites, such as amino acids, glycerol, and phospholipids, were primarily associated with the metabolism. CONCLUSIONS: The effective mechanisms of A. lancea extract in regulating the disorder of intestinal flora in mice are related to the mechanisms of A. lancea. It could relate to lipid metabolism, bile acid metabolism, and amino acid metabolism. These results will provide a basis for further explaining the mechanism by which A. lancea regulats intestinal flora.

Isolation, characterisation, and expression profiling of DXS and DXR genes in Atractylodes lancea.

1-Deoxy-d-xylulose-5-phosphate synthase and 1-deoxy-d-xylulose-5-phosphate reductoismerase are considered two key enzymes in the 2-C-methyl-d-erythritol-4-phosphate pathway of terpenoid biosynthesis and are related to the synthesis and accumulation of sesquiterpenoids. We cloned two DXS and DXR genes from Atractylodes lancea and analysed their expression in different tissues and in response to methyl jasmonate (MeJA). Subcellular localisation analysis revealed that the AlDXS and AlDXR1 proteins are located in the chloroplasts and cytoplasm, whereas AlDXR2 is only located in the chloroplasts. pET-AlDXS-28a and pGEX-AlDXR-4T-1 were expressed in Escherichia coli BL21(DE3) and BL21, respectively. Based on the abiotic stress analysis, the growth rate of the recombinant pGEX-AlDXR-4T-1 was higher than that of the control in HCl and NaOH. AlDXS exhibited the highest expression level in rhizomes of A. lancea from Hubei but was highest in leaves from Henan. In contrast, AlDXR showed maximum expression in the leaves of A. lancea from Hubei and Henan. Moreover, DXS and DXR gene expression, enzyme activities, and antioxidant enzyme activities oscillated in response to MeJA, with expression peaks appearing at different time points. Our findings indicated that the characterisation and function of AlDXS and AlDXR could be useful for further elucidating the functions of DXR and DXR genes in A. lancea.

Induction and metabolomic analysis of hairy roots of Atractylodes lancea.

Atractylodes lancea is an important source of traditional Chinese medicines. Sesquiterpenoids are the key active compounds in A. lancea, and their presence determines the quality of the material. Hairy hoot (HR) culture is a potential method to produce medicinally active compounds industrially; however, the induction and metabolic profiling of A. lancea HR have not been reported. We found that optimal induction of A. lancea HR was achieved by Agrobacterium rhizogenes strain C58C1 using the young leaves of tissue culture seedlings in the rooting stage as explants. Ultra-performance liquid chromatography-tandem mass spectrometric analyses of the chemical compositions of HR and normal root (NR) led to the annotation of 1046 metabolites. Over 200 differentially accumulated metabolites were identified, with 41 found to be up-regulated in HR relative to NR and 179 down-regulated in HR. Specifically, atractylodin levels were higher in HR, while the levels of ß-eudesmol and hinesol were higher in NR. Metabolic pathway analyses showed a significant difference in metabolites of the shikimate acid pathway between HR and NR. Five A. lancea compounds are potential biomarkers for evaluation of HR and NR quality. This study provides an important reference for the application of HR for the production of medicinally active compounds. KEY POINTS: • We established an efficient protocol for the induction of HR in A. lancea • HR was found to have a significantly higher amount of atractylodin than did NRs • Metabolic pathway analyses showed a significant difference in metabolites of the shikimate acid pathway between HR and NR.

Atractylodin Ameliorates Colitis via PPARα Agonism.

Atractylodin is a major compound in the rhizome of Atractylodes lancea, an oriental herbal medicine used for the treatment of gastrointestinal diseases, including dyspepsia, nausea, and diarrhea. Recent studies have shown that atractylodin exerts anti-inflammatory effects in various inflammatory diseases. Herein, we investigated the anti-colitis effects of atractylodin and its molecular targets. We determined the non-cytotoxic concentration of atractylodin (50 µM) using a cell proliferation assay in colonic epithelial cells. We found that pretreatment with atractylodin significantly inhibits tumor necrosis factor-α-induced phosphorylation of nuclear factor-κ-light-chain-enhancer of activated B in HCT116 cells. Through docking simulation analysis, luciferase assays, and in vitro binding assays, we found that atractylodin has an affinity for peroxisome proliferator-activated receptor alpha (PPARα). Daily administration of atractylodin (40 mg/kg) increased the survival rate of mice in a dextran sodium sulfate-induced colitis mouse model. Thus, atractylodin can be a good strategy for colitis therapy through inducing PPARα-dependent pathways.

Geographic Differentiation of Essential Oil from Rhizome of Cultivated Atractylodes lancea by Using GC-MS and Chemical Pattern Recognition Analysis.

The rhizome of Atractylodes lancea (RAL) is a well-known Chinese herbal medicine (CHM) that has been applied in clinical settings for thousands of years. In the past two decades, cultivated RAL has gradually replaced wild RAL and become mainstream in clinical practice. The quality of CHM is significantly influenced by its geographical origin. To date, limited studies have compared the composition of cultivated RAL from different geographical origins. As essential oil is the primary active component of RAL, a strategy combining gas chromatography-mass spectrometry (GC-MS) and chemical pattern recognition was first applied to compare the essential oil of RAL (RALO) from different regions in China. Total ion chromatography (TIC) revealed that RALO from different origins had a similar composition; however, the relative content of the main compounds varied significantly. In addition, 26 samples obtained from various regions were divided into three categories by hierarchical cluster analysis (HCA) and principal component analysis (PCA). Combined with the geographical location and chemical composition analysis, the producing regions of RAL were classified into three areas. The main compounds of RALO vary depending on the production areas. Furthermore, a one-way analysis of variance (ANOVA) revealed that there were significant differences in six compounds, including modephene, caryophyllene, γ-elemene, atractylon, hinesol, and atractylodin, between the three areas. Hinesol, atractylon, and ß-eudesmol were selected as the potential markers for distinguishing different areas by orthogonal partial least squares discriminant analysis (OPLS-DA). In conclusion, by combining GC-MS with chemical pattern recognition analysis, this research has identified the chemical variations across various producing areas and developed an effective method for geographic origin tracking of cultivated RAL based on essential oils.

Geoherbalism Metabolomic Analysis of Atractylodes lancea (Thunb.) DC. by LC-Triple TOF-MS/MS and GC-MS.

The rhizome of Atractylodes lancea (Thunb.) DC. (AL), called Maocangzhu in Chinese, is a geoherbalism medical herb in Jiangsu Province that is often used in the prescription of traditional Chinese medicine (TCM), such as for the treatment of COVID-19. The landform and climatic environment of each province varies greatly from south to north, which has an important influence on the chemical constituents in AL. However, there is a lack of research on the significance of its geoherbalism, especially in water-soluble parts other than volatile oil. In this study, eight known compounds were isolated and obtained as reference substances from AL. In addition, liquid chromatography coupled with triple-quadrupole time-of-flight tandem mass spectrometry (LC-triple TOF-MS/MS) and gas chromatography-mass spectrometry (GC-MS) were used to analyze and characterize chemical constituents from different habitats. Moreover, orthogonal partial least-squares discriminant analysis (OPLS-DA) was applied to reveal the differential metabolomics in AL from different habitats based on the qualitative information of the chemical constituents. Results showed that a total of 33 constituents from GC-MS and 106 constituents from LC-triple TOF-MS/MS were identified or inferred, including terpenoids, polyacetylenes, and others; meanwhile, the fragmentation pathways of different types of compounds were preliminarily deduced from the fragmentation behavior of the major constituents. According to the variable importance in projection (VIP) and p-values, only one volatile differential metabolite was identified by GC-MS screening: ß-eudesmol. Overall, five differential metabolites were identified by LC-triple TOF-MS/MS screening: sucrose, 4(15),11-eudesmadiene; atractylenolide I, 3,5,11-tridecatriene-7,9-diyne-1,2-diacetate, and (3Z,5E,11E)-tridecatriene-7,9-diynyl-1-O-(E)-ferulate. This study provides metabolomic information for the establishment of a comprehensive quality evaluation system for AL.

[Correlation between active component content and color of Atractylodes Lancea and A. chinensis based on color difference principle].

We explored the correlations between the color difference values [ΔL~*(lightness), Δa~*(red-green), Δb~*(yellow-blue)] and the content of four active components(including sesquiterpenoids and polyacetylenes) in the powder of Atractylodes lancea and A. chinensis, aiming to provide reference for the quality evaluation of Atractylodis Rhizoma and establish a qualitative model that can distinguish between A. lancea and A. chinensis based on the chromatic values. The tristimulus values(L~*, a~*, and b~*) of 23 batches of A. lancea and A. chinensis were measured by a color difference meter. The content of atractylenolide Ⅱ, ß-eudesmol, atractylodin, and atractylone in the 23 batches of samples were measured by high performance liquid chromatography(HPLC). Principal component analysis(PCA) and partial least squares-discriminant analysis(PLS-DA) were performed to establish the qualitative models for distinguishing between A. lancea and A. chinensis. SPSS was employed to analyze the correlations between the tristimulus values and the content of the four index components. The results showed that the established PCA and PLS-DA models can divide the A. lancea and A. chinensis samples into two regions, and the tristimulus values of A. lancea and A. chinensis were positively correlated with the content of ß-eudesmol and atractylodin. Therefore, the PCA and PLS-DA models can successfully identify A. lancea and A. chinensis, and the appearance color can be used to quickly predict the internal quality of Atractylodis Rhizoma. This study provides a reference for the quality evaluation of Atractylodis Rhizoma and the modern research on the color of Chinese medicinal materials.

[Complete chloroplast genome sequencing and phylogeny of wild Atractylodes lancea from Yuexi, Anhui province].

This study investigated the choroplast genome sequence of wild Atractylodes lancea from Yuexi in Anhui province by high-throughput sequencing, followed by characterization of the genome structure, which laid a foundation for the species identification, analysis of genetic diversity, and resource conservation of A. lancea. To be specific, the total genomic DNA was extracted from the leaves of A. lancea with the improved CTAB method. The chloroplast genome of A. lancea was sequenced by the high-throughput sequencing technology, followed by assembling by metaSPAdes and annotation by CPGAVAS2. Bioiformatics methods were employed for the analysis of simple sequence repeats(SSRs), inverted repeat(IR) border, codon bias, and phylogeny. The results showed that the whole chloroplast genome of A. lancea was 153 178 bp, with an 84 226 bp large single copy(LSC) and a 18 658 bp small single copy(SSC) separated by a pair of IRs(25 147 bp). The genome had the GC content of 37.7% and 124 genes: 87 protein-coding genes, 8 rRNA genes, and 29 tRNA genes. It had 26 287 codons and encoded 20 amino acids. Phylogenetic analysis showed that Atractylodes species clustered into one clade and that A. lancea had close genetic relationship with A. koreana. This study established a method for sequencing the chloroplast genome of A. lancea and enriched the genetic resources of Compositae. The findings are expected to lay a foundation for species identification, analysis of genetic diversity, and resource conservation of A. lancea.

Comparative analysis in different organs and tissue-specific metabolite profiling of Atractylodes lancea from four regions by GC-MS and laser microdissection.

Traditional Chinese medicine is made from the rhizome of Atractylodes lancea (Thunb.) DC. (Compositae), known as Cangzhu. In this study, gas chromatography-mass spectrometry was used to identify and quantify the volatile oils of different organs of A. lancea from four regions of China: Jiangsu, Anhui, Henan, and Hubei provinces. The volatile oils of A. lancea were qualitatively and quantitatively characterized using gas chromatography-mass spectrometry combined with laser microdissection. The results identified 21 components in A. lancea, the majority of the components were found in the rhizomes, followed by the fibrous roots, flowers, leaves, and stems. According to the contents of volatile oils in A. lancea, it was divided into Dabieshan (mainly includes hinesol and ß-eudesmol) and Maoshan types (mainly includes atractylon and atractylodin), and the ratios of hinesol:ß-eudesmol:atractylon:atractylodin were 17.06:4.55:0:1, 12.66:11.71:0.99:1, 7.43:6.23:0:1, and 0.13:0.16:1.52:1 in A. lancea from AH, HN, HB, and JS, respectively. Tissue-specific study indicated that Dabieshan type mainly includes elemol, hinesol, and ß-eudesmol in the periderm and secretory cavities of A. lancea, whereas Maoshan type mainly includes atractylon, atractylodin, little hinesol, and ß-eudesmol in the secretory cavities. Conversely, no volatile oils were detected in the cortex, phloem, xylem, vascular ray, or pith. This study provides a foundation for further evaluation and utilization of A. lancea.

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Atractylodes lancea in Hubei Province, China.

Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 µm (578.75 - 902.65 µm), maximum body width (W) = 471.97 ± 70.95 µm (318.7 - 586.3 µm), stylet length = 15.18 ± 0.96 µm (13.52 - 17.04 µm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 µm (2.60 - 3.80µm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 µm (375.3 - 552.5 µm), stylet length =12.59 ± 1.39 µm (10.5 - 16.8 µm), tail length= 53.35 ± 1.55 µm (51.8 - 54.9 µm), hyaline tail terminus =11.45 ± 0.65 µm (10.2 - 12.1 µm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.

First report of Atractylodes lancea leaf spot caused by Fusarium acuminatum in China.

Atractylodes lancea Thunb. DC (cangzhu) is a traditional Chinese medicinal plant (Cai et al., 2020). In June 2020, leaf spots were observed in A. lancea plants at the Chongqing Institute of Medicinal Plant Cultivation located in Nanchuan District, Chongqing, China (29°8'26.46″ N, 107°13'23'21″ E). Approximately 75% of the plants displayed leaf spot, partial leaf wilting, and stunted growth, and some plants died. To determine the cause of this disease, five typical leaf spots were cut into small pieces. The pieces were successively surface-disinfected with 0.5% NaClO for 1 min and 75% ethanol for 30 s, washed thrice with sterile water, and placed on potato dextrose agar (PDA) to incubate at 25 ℃. These isolates initially formed abundant white aerial mycelium, then gradually developed a rose pigmentation with a brownish color in the center and grayish rose at the periphery of the colony (Li et al. 2019). Mycelial tips were picked and placed on carnation leaf agar (CLA) and inoculated for 7 days. The macroconidia of the isolates were slender, distinctively curved in the bottom half of the apical cell, and sickle-shaped, with 3-4 septa. They ranged in size from 16.68-26.49 × 1.48-2.34 µm (n=50). The microconidia were fusiform with or without one septum. Their size ranged from 6.19-11.02 × 1.25-1.43 µm (n=50) (Li et al. 2019). The morphological characteristics of the isolates were consistent with those of Fusarium spp. PCR amplification and DNA sequencing of the internal transcribed spacer (ITS) region and ß-tubulin (TUB2) gene were performed using the primers ITS1/ITS4 (White et al. 1990) and Bt-2a/Bt-2b (Robideau et al. 2011), respectively. BLASTn analysis revealed that the ITS sequences of the isolates were 100% identical to those of the F. acuminatum isolates from the Fusarium MLST database (http://isolate.fusariumdb.org/guide.php). Further analysis revealed that the TUB2 sequences were 99.14% identical to those of the F. acuminatum strain S16 isolates (MF662644) from the GeneBank database of the NCBI server. Based on the morphology and sequence analyses, the isolates were identified as F. acuminatum. Pathogenicity tests were conducted on 1.5-year-old A. lancea plants by inoculating spore suspensions under greenhouse conditions (25°C). For this, wound were made on leaves by piercing with sterilized toothpicks. 30 µl of spore suspension containing 2 × 106 conidia/ml was placed on each wound. Wounds on the leaves of control plants were inoculated with 10 µl of sterile distilled water. There were three plants for each treatment. After incubation at 25 °C for 5 days in a greenhouse, the leaves of the treated plants all showed partial wilting, consistent with the field observations. No symptoms were observed in controlled plants. The fungi were again isolated from the symptomatic tissues and were identical to the original isolate. The experiment was repeated twice with similar results. Pathogenicity symptoms were similar to what was first observed in the field and the isolated fungi were verified based on morphological characteristics, thus fulfilling Koch's postulate. To the best of our knowledge, this is the first time that A. lancea leaf spot caused by F. acuminatum has been discovered in China. The leaf spot caused by F. acuminatum on A. lancea has serious yield loss, and proper control measures should be applied.

Two Novel Sesquiterpenoid Glycosides from the Rhizomes of Atractylodes lancea.

Secoatractylohexone A (1), an unprecedented secoguaiane lactone glycoside featuring 6/7 cores and dihydroxy-9-guaine-3-one 11-O-ß-d-glucopyranoside (2), a 9,10-unsaturated guaiene-type glycoside possessing an uncommon scaffold, were isolated from the water-soluble portion of the ethanolic extract of Atractylodes lancea rhizomes together with five known compounds (3-7). The structures of 1 and 2 were elucidated on the basis of extensive spectroscopic data and application of the CD technique. The potential biological activities of secoatractylohexone A were predicted by network pharmacology in silico, the result of which indicated that secoatractylohexone A may be used to treat type II diabetes.

[Comparison of transcriptome of Atractylodes lancea rhizome and exploration of genes for sesquiterpenoid biosynthesis].

This study compared the transcriptome of Atractylodes lancea rhizome at different development stages and explored genes encoding the key enzymes of the sesquiterpenoid biosynthesis pathway. Specifically, Illumina NovaSeq 6000 was employed for sequencing the cDNA libraries of A. lancea rhizome samples at the growth stage(SZ), flowering stage(KH), and harvesting stage(CS), respectively. Finally, a total of 388 201 748 clean reads were obtained, and 16 925, 8 616, and 13 702 differentially expressed genes(DEGs) were identified between SZ and KH, KH and CS, and SZ and CS, separately. Among them, 53 genes were involved in the sesquiterpenoid biosynthesis pathways: 9 encoding 6 enzymes of the mevalonic acid(MVA) pathway, 15 encoding 7 enzymes of the 2-C-methyl-D-erythritol-4-phosphate(MEP) pathway, and 29 of sesquiterpenoid and triterpenoid biosynthesis pathway. Weighted gene co-expression network analysis(WGCNA) yielded 12 genes related to sesquiterpenoid biosynthesis for the SZ, 1 gene for the KH, and 1 gene for CS, and several candidate genes for sesquiterpenoid biosynthesis were discovered based on the co-expression network. This study laid a solid foundation for further research on the sesquiterpenoid biosynthesis pathway, analysis of the regulation mechanism, and mechanism for the accumulation of sesquiterpenoids in A. lancea.

Effect of drought on photosynthesis, total antioxidant capacity, bioactive component accumulation, and the transcriptome of Atractylodes lancea.

BACKGROUND: Atractylodes lancea (Thunb.) DC, a medicinal herb belonging to the Asteraceae family, often faces severe drought stress during its growth. Until now, there has been no research on the effect of drought stress on the quality formation of A. lancea. Therefore, the present study aimed to study the effects of drought stress on A. lancea through physical and chemical analysis, and to reveal the related molecular mechanisms via transcriptome analysis. RESULTS: The photosynthesis was markedly inhibited under drought stress. There were alterations to photosynthetic parameters (Pn, Gs, Ci) and chlorophyll fluorescence (Fv/Fm, NPQ), and the chlorophyll content decreased. Twenty genes encoding important regulatory enzymes in light and dark reactions, including the Rubisco gene of the Calvin cycle, were significantly downregulated. After exposure to drought stress for more than 4 days, the activities of four antioxidative enzymes (SOD, POD CAT and APX) began to decrease and continued to decrease with longer stress exposure. Meanwhile, most of the genes encoding antioxidative enzymes were downregulated significantly. The downregulation of 21 genes related to the respiratory electron transport chain indicated that the blocked electron transfer accelerated excessive ROS. The MDA content was significantly elevated. The above data showed that 15 days of drought stress caused serious oxidative damage to A. lancea. Drought stress not only reduced the size and dry weight of A. lancea, but also lowered the amount of total volatile oil and the content of the main bioactive components. The total volatile oil and atractylodin content decreased slightly, whereas the content of atractylon and ß-eudesmol decreased significantly. Moreover, ten significantly downregulated genes encoding sesquiterpene synthase were mainly expressed in rhizomes. CONCLUSIONS: After exposed to drought stress, the process of assimilation was affected by the destruction of photosynthesis; stress tolerance was impaired because of the inhibition of the antioxidative enzyme system; and bioactive component biosynthesis was hindered by the downregulation of sesquiterpene synthase-related gene expression. All these had negative impacts on the quality formation of A. lancea under drought stress.

Molecular cloning and functional characterization of two squalene synthase genes in Atractylodes lancea.

MAIN CONCLUSION: Two squalene synthase genes AlSQS1 and AlSQS2 were isolated from Atractylodes lancea and functionally characterized using in vitro enzymatic reactions. Atractylodes lancea is a traditional herb used for the treatment of rheumatic diseases, gastric disorders, and influenza. Its major active ingredients include sesquiterpenoids and triterpenes. Squalene synthase (SQS; EC 2.5.1.21) catalyzes the first enzymatic step in the central isoprenoid pathway towards sterol and triterpenoid biosynthesis. In this study, we aimed to investigate two SQSs from A. lancea using cloning and in vitro enzymatic characterization. Bioinformatics and phylogenetic analyses revealed that the AlSQSs exhibited high homology with other plant SQSs. Furthermore, AlSQS1 was observed to be localized in both the nucleus and cytoplasm, whereas AlSQS2 was localized in the cytoplasm and endoplasmic reticulum. To obtain soluble recombinant enzymes, AlSQS1 and AlSQS2 were successfully expressed as glutathione S-transferase (GST)-tagged fusion proteins in Escherichia coli Transetta (DE3). Approximately 68 kDa recombinant proteins were obtained using GST-tag affinity chromatography and Western blot analysis. Results of the in vitro enzymatic reactions established that both AlSQS1 and AlSQS2 were functional, which verifies their catalytic ability in converting two farnesyl pyrophosphates to squalene. The expression patterns of AlSQS and selected terpenoid genes were also investigated in two A. lancea chemotypes using available RNA sequencing data. AlSQS1 and AlSQS2, which showed relatively similar expression in the three tissues, were more highly expressed in the stems than in the leaves and rhizomes. Methyl jasmonate (MeJA) was used as an elicitor to analyze the expression profiles of AlSQSs. The results of qRT-PCR analysis revealed that the gene expression of AlSQS1 and AlSQS2 plummeted at lowest value at 12 h and reached its peak at 24 h. This study is the first report on the cloning, characterization, and expression of SQSs in A. lancea. Therefore, our findings contribute novel insights that may be useful for future studies regarding terpenoid biosynthesis in A. lancea.

Enhanced oral bioavailability and biodistribution of atractylodin encapsulated in PLGA nanoparticle in cholangiocarcinoma.

Atractylodes lancea (Thunb) DC. and its bioactive compound atractylodin (ATD), have been shown to exert promising anticancer activity against cholangiocarcinoma (CCA) both in vitro and in vivo. However, the clinical development of ATD could be hindered due to hydrophobicity and poor pharmacokinetic properties, and thus, the requirement of high dose administration and the risk of toxicity. In the present study, ATD-loaded in PLGA nanoparticles (ATD-PLGA) and that coated with chitosan (ATD-PLGA-CS) were developed using nanoprecipitation and single emulsification methods, respectively. The optimized ATD-PLGA formulation provided superior physical and pharmaceutical properties over ATD-PLGA-CS. The antiproliferative activity of ATD-PLGA against the two CCA cell lines, HuCCT1 and CL6, and the normal cell line (OUMS-36T-1F) was evaluated using MTT assay. Results showed that normal epithelial cell was less sensitive to ATD-PLGA compared to both CCA cell lines. In mice, the radiolabelled 99m Tc-ATD-PLGA showed superior pharmacokinetic profile over free 99m Tc-ATD, as evidenced by a 2.7-fold increase of area under plasma concentration-time curve (AUC0-∞ ), maximum plasma concentration (Cmax ), time to Cmax (tmax ), and mean residence time (MRT). Higher accumulation of 99m Tc-ATD-PLGA was observed in vital organs/tissues such as blood, liver, heart, and kidney, compared with free 99m Tc-ATD-PLGA. Altogether, the results suggest that PLGA NPs could be a suitable drug delivery carrier for ATD in CCA.

[Research progress and prospect of endophytes from medicinal plant Atractylodes lancea].

The endophytes of medicinal plants play an important role in promoting the quality formation of the host. Therefore, this paper made a review of endophytes of medicinal plant Atractylodes lancea. According to previous studies, A. lancea boasts endophytes, such as fungi, bacteria, and actinomycetes, among which the beneficial microorganisms help the growth and development of A. lancea. There is a close interaction between the volatile oil of A. lancea and endophytes. Different endophytes vary in regulating the composition and content of the volatile oil of A. lancea, which might contribute to the quality formation of A. lancea. However, the information of the endophytic flora of A. lancea obtained by traditional culture and isolation is not enough to reflect the real situation of the endophytes of A. lancea. Little is known about the endophytes of A. lancea from different chemical types and different habitats, which is not conducive to the study of the ecological relationship between A. lancea and endophytes and limits the development and utilization of the endophytes. Therefore, at the end of this paper, the authors put forward suggestions for future research on endophytes in A. lancea, including:(1)mining the core endophyte resources of A. lancea by combining high-throughput sequencing with traditional culture and isolation;(2)exploring the relationship between the diversity of endophytes and chemical types of A. lancea;(3)strengthening the application of endophytes in A. lancea cultivation, in order to facilitate the cultivation efficiency and quality of A. lancea.