A rare cause of syndromic short stature: 3M syndrome in three families.

3M syndrome is a rare autosomal recessive genetic disorder characterized by severe growth retardation, dysmorphic facial features, skeletal dysplasia, and normal intelligence. Variants in CUL7, OBSL1, and CCDC8 genes have been reported to be responsible for this syndrome. In this study, the clinical and molecular findings of four 3M syndrome cases from three families are presented. All cases had growth retardation, relative macrocephaly, and typical dysmorphic facial features. Their neurological developments were normal. Sequencing of CUL7, OBSL1, and CCDC8 genes revealed two different novel homozygous variants in CUL7 in Families 1 and 3 and a previously reported homozygous pathogenic variant in OBSL1 in Family 2. In conclusion, a comprehensive dysmorphological evaluation should be obtained in individuals presenting with short stature and in such individuals with typical facial and skeletal findings, 3M syndrome should be considered. Our report expands the genotype of 3M syndrome and emphasizes the importance of thorough physical and dysmorphological examination.

CRL7SMU1 E3 ligase complex-driven H2B ubiquitylation functions in sister chromatid cohesion by regulating SMC1 expression.

Cullin-RING-type E3 ligases (CRLs) control a broad range of biological processes by ubiquitylating numerous cellular substrates. However, the role of CRL E3 ligases in chromatid cohesion is unknown. In this study, we identified a new CRL-type E3 ligase (designated as CRL7SMU1 complex) that has an essential role in the maintenance of chromatid cohesion. We demonstrate that SMU1, DDB1, CUL7 and RNF40 are integral components of this complex. SMU1, by acting as a substrate recognition module, binds to H2B and mediates monoubiquitylation at the lysine (K) residue K120 through CRL7SMU1 E3 ligase complex. Depletion of CRL7SMU1 leads to loss of H2B ubiquitylation at the SMC1a locus and, thus, subsequently compromised SMC1a expression in cells. Knockdown of CRL7SMU1 components or loss of H2B ubiquitylation leads to defective sister chromatid cohesion, which is rescued by restoration of SMC1a expression. Together, our results unveil an important role of CRL7SMU1 E3 ligase in promoting H2B ubiquitylation for maintenance of sister chromatid cohesion during mitosis.This article has an associated First Person interview with the first author of the paper.

Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

BACKGROUND: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.

Ubiquitinated CD36 sustains insulin-stimulated Akt activation by stabilizing insulin receptor substrate 1 in myotubes.

Both the magnitude and duration of insulin signaling are important in executing its cellular functions. Insulin-induced degradation of insulin receptor substrate 1 (IRS1) represents a key negative feedback loop that restricts insulin signaling. Moreover, high concentrations of fatty acids (FAs) and glucose involved in the etiology of obesity-associated insulin resistance also contribute to the regulation of IRS1 degradation. The scavenger receptor CD36 binds many lipid ligands, and its contribution to insulin resistance has been extensively studied, but the exact regulation of insulin sensitivity by CD36 is highly controversial. Herein, we found that CD36 knockdown in C2C12 myotubes accelerated insulin-stimulated Akt activation, but the activated signaling was sustained for a much shorter period of time as compared with WT cells, leading to exacerbated insulin-induced insulin resistance. This was likely due to enhanced insulin-induced IRS1 degradation after CD36 knockdown. Overexpression of WT CD36, but not a ubiquitination-defective CD36 mutant, delayed IRS1 degradation. We also found that CD36 functioned through ubiquitination-dependent binding to IRS1 and inhibiting its interaction with cullin 7, a key component of the multisubunit cullin-RING E3 ubiquitin ligase complex. Moreover, dissociation of the Src family kinase Fyn from CD36 by free FAs or Fyn knockdown/inhibition accelerated insulin-induced IRS1 degradation, likely due to disrupted IRS1 interaction with CD36 and thus enhanced binding to cullin 7. In summary, we identified a CD36-dependent FA-sensing pathway that plays an important role in negative feedback regulation of insulin activation and may open up strategies for preventing or managing type 2 diabetes mellitus.

CUL7 promotes cancer cell survival through promoting Caspase-8 ubiquitination.

The Cullin 7 (CUL7) gene encodes a member of the cullin family of E3 ubiquitin ligases. Accumulated evidence suggests that CUL7 is oncogenic. However, the mechanism by which CUL7 improves cancer cell survival has not been fully elucidated. Here, we reported that CUL7 confers anti-apoptotic functions by interacting with Caspase-8. CUL7 prevents Caspase-8 activation by promoting Caspase-8 modification with non-degradative polyubiquitin chains at K215. CUL7 knockdown sensitized cancer cells to TRAIL-induced apoptosis in vitro and in nude mice. These results suggest that CUL7 limits extrinsic apoptotic signaling by promoting Caspase-8 ubiquitination.

Further expanding the mutational spectrum and investigation of genotype-phenotype correlation in 3M syndrome.

3M syndrome is characterized by severe pre- and postnatal growth retardation, typical facial features, and normal intelligence. Homozygous or compound heterozygous mutations in either CUL7, OBSL1, or CCDC8 have been identified in the etiology so far. Clinical and molecular features of 24 patients (23 patients and a fetus) from 19 unrelated families with a clinical diagnosis of 3M syndrome were evaluated and genotype-phenotype correlations were investigated with the use of DNA sequencing, chromosomal microarray, and whole exome sequencing accordingly. A genetic etiology could be established in 20 patients (n = 20/24, 83%). Eleven distinct CUL7 or OBSL1 mutations, among which eight was novel, were identified in 18 patients (n = 18/24, 75%). Ten patients had CUL7 (n = 10/18, 56%) while eight had OBSL1 (n = 8/18, 44%) mutations. Birth weight and height standard deviation scores at admission were significantly (p < 0.05) lower in patients with CUL7 mutation compared to that of patients with OBSL1 mutation. Two patients with a similar phenotype had a de novo 20p13p deletion involving BMP2. No genetic etiology could be established in four patients (n = 4/28, 17%). This study yet represents the largest cohort of 3M syndrome patients from a single center in Turkey. Microdeletions involving BMP2 may cause a phenotype similar to 3M syndrome with some distinctive features. Larger cohort of patients are required to establish genotype-phenotype correlations in 3M syndrome.

The CUL7/F-box and WD repeat domain containing 8 (CUL7/Fbxw8) ubiquitin ligase promotes degradation of hematopoietic progenitor kinase 1.

HPK1, a member of mammalian Ste20-like serine/threonine kinases, is lost in >95% pancreatic cancer through proteasome-mediated degradation. However, the mechanism of HPK1 loss has not been defined. The aims of this study are to identify the ubiquitin ligase and to examine the mechanisms that targets HPK1 degradation. We found that the CUL7/Fbxw8 ubiquitin ligase targeted HPK1 for degradation via the 26 S proteasome. The ubiquitination of HPK1 required its kinase activity and autophosphorylation. Wild-type protein phosphatase 4 (PP4), but not the phosphatase-dead PP4 mutant, PP4-RL, inhibits the interaction of Fbxw8 with HPK1 and Fbxw8-mediated ubiquitination of HPK1. In addition, we showed that Thr-355 of HPK1 is a key PP4 dephosphorylation site, through which CUL7/Fbxw8 ubiquitin ligase and PP4 regulates HPK1 stability. Knockdown of Fbxw8 restores endogenous HPK1 protein expression and inhibits cell proliferation of pancreatic cancer cells. Our study demonstrated that targeted degradation of HPK1 by the CUL7/Fbxw8 ubiquitin ligase constitutes a negative-feedback loop to restrain the activity of HPK1 and that CUL7/Fbxw8 ubiquitin ligase promotes pancreatic cancer cell proliferation. CUL7/Fbxw8 ubiquitin ligase-mediated HPK1 degradation revealed a direct link and novel role of CUL7/Fbxw8 ubiquitin ligase in the MAPK pathway, which plays a critical role in cell proliferation and differentiation.

Photoreceptor-targeted extracellular vesicles-mediated delivery of Cul7 siRNA for retinal degeneration therapy.

Rationale: Photoreceptor loss is a primary pathological feature of retinal degeneration (RD) with limited treatment strategies. RNA interference (RNAi) has emerged as a promising method of gene therapy in regenerative medicine. However, the transfer of RNAi therapeutics to photoreceptors and the deficiency of effective therapeutic targets are still major challenges in the treatment of RD. Methods: In this study, photoreceptor-derived extracellular vesicles (PEVs) conjugated with photoreceptor-binding peptide MH42 (PEVsMH42) were prepared using the anchoring peptide CP05. Transcriptome sequencing was applied to investigate the potential therapeutic target of RD. We then engineered PEVsMH42 with specific small-interfering RNAs (siRNAs) through electroporation and evaluated their therapeutic efficacy in N-methyl-N-nitrosourea (MNU)-induced RD mice and Pde6ßrd1/rd1 mutant mice. Results: PEVsMH42 were selectively accumulated in photoreceptors after intravitreal injection. Cullin-7 (Cul7) was identified as a novel therapeutic target of RD. Taking advantage of the established PEVsMH42, siRNAs targeting Cul7 (siCul7) were efficiently delivered to photoreceptors and consequently blocked the expression of Cul7. Moreover, suppression of Cul7 effectively protected photoreceptors to alleviate RD both in MNU-induced mouse model and Pde6ßrd1/rd1 mutant mouse model. Mechanistically, PEVsMH42 loaded with siCul7 (PEVsMH42-siCul7)-induced Cul7 downregulation was responsible for preventing Cul7-mediated glutathione peroxidase 4 (Gpx4) ubiquitination and degradation, resulting in the inhibition of photoreceptor ferroptosis. Conclusions: In summary, PEVsMH42-siCul7 attenuate photoreceptor ferroptosis to treat RD by inhibiting Cul7-induced ubiquitination of Gpx4. Our study develops a PEVs-based platform for photoreceptor-targeted delivery and highlights the potential of PEVsMH42-siCul7 as effective therapeutics for RD.

Longitudinal skeletal growth and growth plate morphological characteristics of chondro-tissue specific CUL7 knockout mice.

BACKGROUND: 3 M syndrome is first reported in 1975，which characterized by severe pre- and postnatal growth retardation, skeletal malformation and facial dysmorphism. These three genes (CUL7, OBSL1 and CCDC8) have been identified to be respond for 3 M syndrome, of which CUL7 is accounting for approximately 70%. To date, the molecular mechanism underlying the pathogenesis of 3 M syndrome remains poorly understood. Previous studies showed that no Cul7-/- mice could survive after birth, because of growth retardation at late gestational stage and respiratory distress after birth. The establishment of the animal model of cartilage specific Cul7 knockout mice (Cul7fl/fl;Col2a1-CreERT2 mice) has confirmed that Cul7fl/fl;Col2a1-CreERT2 mice can be selective in a time- and tissue-dependent manner, which can provide an experimental basis for further research on severe genetic diseases related to growth plates. OBJECTIVE: To establish a model of Cul7fl/fl;Col2a1-CreERT2 mice based on Cre/LoxP system, and to further observe its phenotype and morphological changes in growth plate. METHODS: The Cul7fl/fl;Col2a1-CreERT2 mice were taken as the experimental group, while the genotype of Cul7fl/+;Col2a1-CreERT2 mice were used as the control group. The gross morphological features and X-ray films of limbs in the two groups were observed every week for 3-6 consecutive weeks, and the length of the mice from nose to the tail, the length of femur and tibia were recorded. In the meantime, The histological morphology of tibial growth plates was compared between the two groups. RESULTS: A preliminary model of Cul7fl/fl;Col2a1-CreERT2 mice was established. The Cul7fl/fl;Col2a1-CreERT2 mice had abnormally short and deformed limbs (P<0.05), increased thickness of growth plate, the disorderly arranged chondrocyte columns, decreased number of cells in the proliferation zone, changes in the shape from flat to round, obviously expanded extracellular matrix, and disordered arrangement, thickening and loosening of bone trabecula at the proximal metaphysis of the femur. CONCLUSIONS: The knockout of Cul7 gene may affect both the proliferation of chondrocytes and the endochondral osteogenesis, confirming that Cul7 is essential for the normal development of bone in the body.

3M syndrome patient with a novel mutation: A case report.

BACKGROUND: A rare autosomal recessive genetic disorder, 3M syndrome, is characterized by severe intrauterine and postnatal growth retardation. Children with 3M syndrome typically exhibit short stature, facial deformities, long tubular bones, and high vertebral bodies but generally lack mental abnormalities or other organ damage. Pathogenic genes associated with 3M syndrome include CUL7, OBSL1 and CCDC8. The clinical and molecular characteristics of patient with 3M syndrome are unique and serve as important diagnostic indicators. CASE SUMMARY: In this case, the patient displayed square shoulders, scoliosis, long slender tubular bones, and normal neurological development. Notably, the patient did not exhibit the typical dysmorphic facial features, relative macrocephaly, or growth retardation commonly observed in individuals with 3M syndrome. Whole exon sequencing revealed a novel heterozygous c.56681+1G>C (Splice-3) variant and a previously reported nonsense heterozygous c.3341G>A (p.Trp1114Ter) variant of OBSL1. Therefore, it is important to note that the clinical features of 3M syndrome may not always be observable, and genetic confirmation is often required. Additionally, the identification of the c.5683+1G>C variant in OBSL1 is noteworthy because it has not been previously reported in public databases. CONCLUSION: Our study identified a new variant (c.5683+1G>C) of OBSL1 that contributes to expanding the molecular profile of 3M syndrome.

Gonadal Failure in a Male With 3-M Syndrome.

OMIM 273750 (3-M) syndrome is a rare cause of severe short stature with variable dysmorphic features caused by pathogenic variants in several genes including cullin7 gene (CUL7). Hypogonadism and hypospadias have been described in only a few males. We report a patient with CUL7 pathogenic variant who had bifid scrotum and perineal hypospadias at birth. He entered puberty spontaneously at age 12 years and appropriately completed pubertal development by 15 years. Subsequently, a regression of testicular volumes, increased gonadotropin levels, and reduced (although normal) testosterone levels were observed. This case highlights the importance of careful pubertal monitoring as pubertal dysfunction may be associated with 3-M syndrome.

Typical Face, Developmental Delay, and Hearing Loss in a Patient with 3M Syndrome: The Co-Occurrence of Two Rare Conditions.

Introduction: 3M syndrome is an autosomal recessive disorder characterized by characteristic facial features, severe pre- and postnatal growth restriction (<-4 SDS), and normal mental development. 3M syndrome is genetically heterogeneous. Up to date, causative mutations have been demonstrated in 3 genes, cullin-7 (CUL7), obscurin-like 1 (OBSL1), and coiled coil domain containing protein 8 (CCDC8). Case presentation: Here, we report a patient who was referred to our clinic due to short stature and developmental delay. Physical examination revealed prenatal onset short stature, low birth weight, and normal head circumference. She displayed several dysmorphic facial features in addition to developmental delay and bilateral sensorineural hearing loss. The physical findings were suggestive of 3M syndrome. Genetic assessment revealed a novel homozygous frameshift c.418_419delAC (p.Thr140Cysfs*11) variant in the CUL7 gene and a previously reported pathogenic nonsense homozygous c.942C>A (p.Cys314Ter) variant in the ILDR1 gene. The parents were heterozygous for the same variant. Discussion: 3M syndrome should be considered in the differential diagnosis of patients with short stature and typical facial features even if in the presence of other inconsistent features such as developmental delay. In addition, it is important to take into account the co-occurrence of rare autosomal recessive genetic disorders especially in countries with a high consanguineous marriage rate.

Cullin7 induces docetaxel resistance by regulating the protein level of the antiapoptotic protein Survivin in lung adenocarcinoma cells.

Background: Lung adenocarcinoma (LUAD) is the most common subtype of non-small cell lung cancer (NSCLC). Chemotherapy resistance is the main cause of chemotherapy failure. Cullin7 (Cul7) is highly expressed in LUAD and is associated with poor prognosis. Moreover, Cul7 is abnormally overexpressed in docetaxel-resistant LUAD cells. Therefore, further exploration of the role and molecular mechanism of Cul7 in LUAD docetaxel resistance is necessary. Methods: We established docetaxel-resistant cell lines (A549DTX and H358DTX cell lines) by exposing cells to gradually increasing concentrations of docetaxel. Cell (A549, A549DTX, H358, and H358DTX cell lines) sensitivity to docetaxel was determined via a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymmethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay. And then quantitative polymerase chain reaction (qPCR) and Western blotting were performed to measure the expression of Cul7 and Survivin in A549, A549DTX, H358, and H358DTX cell lines. Subsequently, we knocked down Cul7 in docetaxel-resistant cells and overexpressed Cul7 in parental cells via lentiviral transduction to further validate the correlation between Cul7 and docetaxel resistance, while exploring the molecular mechanism of docetaxel resistance it caused. Immunofluorescence and immunohistochemical (IHC) staining were also used to evaluate the expression and cellular localization of Cul7. To confirm the effect of Cul7 expression on cell apoptosis, we used flow cytometry to detect the apoptosis rate of A549 and A549DTX cells with the same drug concentration. Results: Cul7 was highly expressed in A549DTX and H358DTX cells. However, when Cul7 expression was knocked down in A549DTX and H358DTX cells, cell sensitivity to docetaxel was significantly increased. In addition, we found that Cul7 was coexpressed with Survivin. Silencing Survivin reversed the docetaxel insensitivity caused by Cul7 overexpression. High expression of Cul7 and Survivin in docetaxel-resistant LUAD cells inhibited the intrinsic apoptosis pathway and promoted cell proliferation. Therefore, the Cul7/Survivin axis may play a role in inducing LUAD docetaxel chemoresistance. Conclusions: Cul7 and Survivin were both highly expressed in docetaxel-resistant LUAD cells. Our results suggest that Cul7 may inhibit apoptosis and promote the proliferation of LUAD cells by increasing the Survivin protein level, which in turn contributes to docetaxel chemoresistance in LUAD.

Chinese patients with 3M syndrome: clinical manifestations and two novel pathogenic variants.

Background: 3M syndrome is a rare autosomal recessive disease, characterized by intrauterine and postnatal growth retardation, facial dysmorphism, large head circumference, and skeletal changes, has rarely been reported in the Chinese population. Methods: We describe the clinical manifestations and gene variants in four sporadic cases of 3M syndrome in Chinese individuals from different families. Results: All cases had significant growth retardation, relative macrocephaly, and typical facial features. Exome sequencing revealed that two patients with 3M syndrome had homozygous variants of the CUL7 gene: one novel pathogenic variant and one previously reported pathogenic variant; the other two patients were heterozygous for variants in OBSL1, one of which had not been reported previously. Clinical evaluation indicated that these Chinese patients with 3M syndrome shared similar recognizable features with those reported in patients of other ethnic backgrounds, but not all patients with 3M syndrome in this study had normal development milestones. Two patients underwent recombinant human growth hormone (rhGH) therapy and showed accelerated growth in the first 2 years; however, the growth rate slowed in the third year in one case. There were no obvious adverse reactions during rhGH treatment. Conclusion: We report one novel CUL7 and one novel OBSL1 mutation in patients with 3M syndrome. Children with short stature, specific facial features, and physical symptoms should be referred for genetic testing to obtain precise diagnosis and appropriate treatment. The effects of rhGH treatment on adult height requires long-term observation and study in a large sample.

Structural and functional insights into a novel homozygous missense pathogenic variant in CUL7 identified in consanguineous Pakistani family.

3M syndrome is a rare genetic familial disorder characterized by short stature, growth retardation, facial dysmorphism, skeletal abnormalities, fleshy protruding heels, and normal intelligence, caused by mutations in the CUL7, OBSL1 and CCDC8 genes. In the present study, a novel homozygous missense variant of CUL7 (NP_001161842.1, c.4493T > C, p.L1498P) has been identified in a consanguineous Pakistani family by whole exome sequencing. In silico structural evaluation, molecular docking and simulation studies of mutant CUL7 provides substantial evidence about its crucial role in the progression of discussed ailment. The newly discovered variant significantly altered the protein's three dimensional structure, leading to abnormal interaction with binding proteins. This computational and experimental investigation provides useful information to drug developers for the synthesis of novel therapeutics against the discussed ailment.Communicated by Ramaswamy H. Sarma.

Identification and verification of the prognostic value of CUL7 in colon adenocarcinoma.

CUL7, a gene composed of 26 exons associated with cullin 7 protein, is also an E3 ligase that is closely related to cell senescence, apoptosis, and cell transformation and also plays an important role in human cancer. However, there is no systematic pan-cancer analysis has been performed to explore its role in prognosis and immune prediction. In this study, the expression of CUL7 in colon adenocarcinoma (COAD) was investigated to determine its prognosis value. First, based on the Cancer Genome Atlas (TCGA), Genotypic-Tissue Expression Project(GTEx), Cancer Cell Line Encyclopedias(CCLE), and TISIDB database, the potential role of CUL7 in different tumors was explored. Subsequently, the expression of CUL7 in COAD was explored and verified by Immunohistochemistry (IHC). Furthermore, the mutation frequency of CUL7 in COAD was analyzed, and the prognostic value of CUL7 in COAD was discussed. In addition, the nomogram was constructed, and its prognostic value was verified by follow-up data from Jiangmen Central Hospital. Finally, PPI network analysis explored the potential biological function of CUL7 in COAD. The results show that CUL7 is upregulated in most tumors, which is significantly associated with poor survival. At the same time, CUL7 is correlated with the clinical stage and immune landscape of various tumors. In colorectal cancer, CUL7 was overexpressed in tumor tissues by IHC with a mutation frequency of about 4%. CUL7 is an independent prognostic factor for colorectal cancer. The nomogram constructed has effective predictive performance, and external databases proved the prognostic value of CUL7. In addition, PPI network analysis showed that CUL7 was closely related to FBXW8, and further pathway enrichment analysis showed that CUL7 was mainly involved in ubiquitin-mediated proteolysis. Therefore, our study provides a comprehensive understanding of the potential role of CUL7 in different tumors, and CUL7 might be a prognostic marker for COAD.

3-M syndrome - a primordial short stature disorder with novel CUL7 mutation in two Indian patients.

OBJECTIVE: To evaluate the cause of short stature in children. CASE PRESENTATION: Two children with suspected skeletal dysplasia and short stature were evaluated. CONCLUSIONS: The 3-M syndrome is a primordial growth disorder manifesting severe postnatal growth restriction, skeletal anomalies and prominent fleshy heels. The 3-M syndrome is a genetically heterogeneous disorder and the phenotype is similar. This is a rare autosomal recessive disorder with normal intellect. Two affected children have been identified by whole-exome sequencing. One patient harboured a compound heterozygous variant and the other was a homozygous missense variant. The genetic diagnosis helped in counselling the families and facilitated prenatal diagnosis in one (case 1) family.

Natural history of facial and skeletal features from neonatal period to adulthood in a 3M syndrome cohort with biallelic CUL7 or OBSL1 variants.

3M syndrome is characterized by severe pre- and post-natal growth restriction, typical face, slender tubular bones, tall vertebral bodies, prominent heels and normal intelligence. It is caused by biallelic variants of CUL7, OBSL1 and, more rarely, CCDC8. The aim of this study is to evaluate facial and skeletal findings in 3M patients from neonatal period to adulthood. A total of 19 patients with a median age of diagnosis of 9.2 months were included in this study and were followed for two to 20 years. CUL7 and OBSL1 variants were found in 57.9% and 42.1% of patients, respectively, five of which are novel. Most of patients had triangular face, frontal bossing, short fleshy nose, full fleshy lower lip, transverse groove of rib cage, hyperlordosis and prominent heels. Three new early-diagnostic signs were observed in infants; two were infraorbital swelling of the lower lid and facial infantile hemangioma, both of which became less pronounced with aging. The third was the central tubercle of the upper lip that became more prominent with in time. While slender long bones did not change with aging, the tall vertebral bodies became more prominent radiologically. The mean birth length in patients was -4.3 SDS. Eight patients reached a mean final height of -4.9 SDS. Despite described growth hormone (GH) insensitivity in 3M syndrome, 12 patients either with GH deficiency or with normal GH levels were treated with GH; seven patients responded with an increase in height SDS. This study not only provided early diagnostic signs of the syndrome, but also presented important follow-up findings.

Cullin-7 (CUL7) is overexpressed in glioma cells and promotes tumorigenesis via NF-κB activation.

BACKGROUND: Cullin-7 (CUL7) is a member of the DOC domain-containing cullin family and is involved in the regulation of cell transformation. However, the clinical significance, potential mechanism and upstream regulators of CUL7 in malignant gliomas remain to be determined. METHODS: Expression level data and clinical information were obtained via the Cancer Genome Atlas (TCGA) database, the Chinese Glioma Genome Atlas (CGGA) database, immunohistochemistry (IHC) and western blot analysis. Gene set enrichment analysis (GSEA) was used to explore the potential molecular mechanisms of CUL7. RNA silencing was performed using siRNA or lentiviral constructs in U87MG and U251 glioma cell lines and GSC267 glioma stem cells. CUL7 overexpression was performed using the GV141-CUL7 plasmid construct. In addition, overexpression of miR-3940-5p was performed and validated by quantitative real-time PCR (qRT-PCR). Cells were characterized in vitro or in vivo to evaluate their molecular status, cell proliferation, invasion, and migration by Cell Counting Kit (CCK)-8, EdU, flow cytometry, colony formation, Transwell and 3D tumour spheroid invasion assays. Coimmunoprecipitation (co-IP) and western blotting were performed to test the mechanisms of activation of the NF-κB signalling pathway. RESULTS: High CUL7 expression was associated with a high tumour grade, a mesenchymal molecular glioma subtype and a poor prognosis in patients. Gene silencing of CUL7 in U87MG and U251 cells significantly inhibited tumour growth, invasion and migration in vitro and in vivo. Western blot analysis revealed that cyclin-dependent kinase inhibitors and epithelial-mesenchymal transition (EMT) molecular markers changed under CUL7 silencing conditions. In contrast, CUL7 overexpression promoted tumour growth, invasion and migration. Gene set enrichment analysis (GSEA) and western blot analysis revealed that CUL7 was positively associated with the NF-κB pathway. Moreover, with coimmunoprecipitation assays, we discovered that CUL7 physically associated with MST1, which further led to ubiquitin-mediated MST1 protein degradation, which promoted activation of the NF-κB signalling pathway. Finally, CUL7 was found to be downregulated by miR-3940-5p, which suppressed the development of gliomas. CONCLUSIONS: Our findings indicate that CUL7 plays a significant role in promoting tumorigenesis via NF-κB activation and that it can be negatively regulated by miR-3940-5p in human gliomas. Furthermore, CUL7 might be a candidate molecular target for the treatment of glioma.

A novel mutation within intron 17 of the CUL7 gene results in appearance of premature termination codon.

A couple with five adverse pregnancy history required prenatal diagnosis. The fetus of this study was their fifth pregnancy. The fetus was found NT thickening at 12 weeks and 4 days gestation and the average long bone of limbs retardation 4SD at 27 weeks and 4 days gestation. Karyotype was normal. The next-generation sequencing (NGS) and Sanger sequencing were conducted of this fetus. The compound heterozygous mutations c.3722_3749dup[p.V1252fs*23] and c.3355 + 5 G > A at CUL7 gene were detected. The mutation c.3355 + 5 G > A was a novel mutation within intron 17 of the CUL7 gene. Minigene array was used to verify whether the novel mutation c.3355 + 5 G > A really affected the splicing of CUL7gene. The results showed that the mutation could result in the appearance of premature termination codon. The fetus could be diagnosed as 3 M syndrome. We suggested that close attention needed to be paid to fetuses with intrauterine growth restriction only by ultrasonic and avoid misdiagnosis and missed diagnosis of 3 M syndrome. In addition, our study enriched gene mutations of 3 M syndrome.