The impact of increased hepatic glucose production caused by empagliflozin on plasma glucose concentration in individuals with type 2 diabetes and nondiabetic individuals.

AIM: To examine the impact of increased hepatic glucose production (HGP) on the decrease in plasma glucose concentration caused by empagliflozin in individuals living with diabetes and in nondiabetic individuals. METHODS: A total of 36 individuals living with diabetes and 34 nondiabetic individuals were randomized to receive, in double-blind fashion, empagliflozin or matching placebo in a 2:1 treatment ratio. Following an overnight fast, HGP was measured with 3-3 H-glucose infusion before, at the start of, and 3 months after therapy with empagliflozin. RESULTS: On Day 1 of empagliflozin administration, the increase in urinary glucose excretion (UGE) in individuals with normal glucose tolerance was smaller than in those with impaired glucose tolerance and those living with diabetes, and was accompanied by an increase in HGP in all three groups. The amount of glucose returned to the systemic circulation as a result of the increase in HGP was smaller than that excreted by the kidney during the first 3 h after empagliflozin administration, resulting in a decrease in fasting plasma glucose (FPG) concentration. After 3 h, the increase in HGP was in excess of UGE, leading to a small increase in plasma glucose concentration, which reached a new steady state. After 12 weeks, the amount of glucose returned to the circulation due to the empagliflozin-induced increase in HGP was comparable with that excreted by the kidney in all three groups. CONCLUSION: The balance between UGE and increase in HGP immediately after sodium-glucose cotransporter-2 (SGLT2) inhibition determined the magnitude of decrease in FPG and the new steady state which was achieved. After 12 weeks, the increase in HGP caused by empagliflozin closely matched the amount of glucose excreted by the kidneys; thus, FPG level remained stable despite the continuous urinary excretion of glucose caused by SGLT2 inhibition.

SGLT2 Inhibitors Correct Fluid Overload in Adult Kidney Transplant Recipients-A Prospective Observational Study.

In this longitudinal observational study, we measured urinary glucose concentration, body composition and volume status (bioimpedance spectroscopy) and plasma renin and aldosterone concentrations in n = 22 kidney transplant recipients (KTRs) initiating on SGLT2I at baseline (BL), and after 1 week and 1, 3, and 6 months. Estimated glomerular filtration rate (eGFR) decreased by -2 mL/min/1.73 m2 (IQR -10-0) after 1 week and remained stable thereafter. Urinary glucose concentration was 10 (3-24) g/g creatinine after 1 week and correlated with eGFR (r2 = 0.273; p = 0.057). SGLT2I did not affect HbA1c, fasting blood glucose, body weight, fat or lean mass. SGLT2I decreased fluid overload dependent on baseline overhydration (OH, r2 = 0.54, p = 0.0003) without occurrence of dehydration. Plasma aldosterone increased at day 7, while plasma renin did not change significantly. In conclusion, SGLT2I corrected fluid overload in patients with elevated overhydration at baseline, while in euvolemic KTRs fluid status remained stable without reduction of body water below the reference range, thus promoting the safety of SGLT2I therapy in patients following kidney transplantation. Glucosuria, together with effects of SGLT2I on blood glucose control and body weight, is attenuated in KTRs dependent on eGFR.

DNA Mutagenicity of Hydroxyhydroquinone in Roasted Coffee Products and Its Suppression by Chlorogenic Acid, a Coffee Polyphenol, in Oxidative-Damage-Sensitive SAMP8 Mice.

Hydroxyhydroquinone (HHQ) is an oxidative component produced by roasting coffee beans and has been reported to generate relatively large amounts of reactive oxygen species (ROS). In this study, we used senescence-accelerated mouse prone 8 (SAMP8) mice to determine whether HHQ consumption increases oxidative-stress-induced injury, because in SAMP8 mice, the activity of 8-oxoguanine DNA glycosylase 1, which repairs oxidative modifications in DNA, is decreased. The results showed that two out of twelve (16.7%) HHQ-treated mice presented polyuria and glucosuria around 2 months after the start of treatment, indicating that HHQ may act as a mutagen against SAMP8 mice, which is sensitive to oxidative damage. No abnormalities were observed in the chlorogenic acid (coffee polyphenol, CPP)-treated group. The concentration of hydrogen peroxide in the serum of SAMP8 mice was significantly higher than that in SAMR1 (senescence-resistant) control mice, and the concentration was further increased in the HHQ-treated group. CPP, when coexisting with HHQ at the rate contained in roasted coffee, decreased the amount of hydrogen peroxide in the serum of SAMP8 mice. Although CPP can act both oxidatively and antioxidatively as a polyphenol, CPP acts more antioxidatively when coexisting with HHQ. Thus, the oxidative effect of HHQ was shown to be counteracted by CPP.

Association of Familial Fanconi Syndrome with a Novel GATM Variant.

Fanconi syndrome is a disorder of the proximal renal tubule. Recently, advanced genetic analysis technology has revealed that several genes cause familial Fanconi syndrome. We identified a family with autosomal dominant Fanconi syndrome and chronic kidney disease with a novel glycine amidinotransferase (GATM) variant. Case 1 was a 57-year-old Japanese woman. Her father and two siblings had Fanconi syndrome or chronic kidney disease. She presented to our hospital at the age of 34 years with recurrent glucosuria. Her height and weight were 151 cm and 46.6 kg, respectively. Laboratory tests showed glucosuria, hypophosphatemia, hypouricemia, and normal renal function. Her serum creatinine level gradually increased over the following next two decades, and she developed end-stage renal disease. Case 2, the daughter of Case 1, was a 26-year-old woman. Her height and weight were 151 cm and 37.5 kg, respectively. Glucosuria was detected at the age of 13 years, which led to a referral to our hospital. Urinalysis showed low-molecular-weight proteinuria. She was diagnosed with Fanconi syndrome. At the age of 26 years, she had glucosuria, low-molecular-weight proteinuria, hypouricemia, and normal renal function. Genetic testing of both cases revealed a novel missense variant in GATM. The heterozygous missense variants in GATM have been reported to cause familial Fanconi syndrome, which manifests early in life and progresses to renal glomerular failure by mid-adulthood. The novel GATM variant detected in our cases was suspected to be associated with the development of Fanconi syndrome. GATM variants should be tested in patients with idiopathic Fanconi syndrome.

Mouse Models with SGLT2 Mutations: Toward Understanding the Role of SGLT2 beyond Glucose Reabsorption.

The sodium-glucose cotransporter 2 (SGLT2) mainly carries out glucose reabsorption in the kidney. Familial renal glycosuria, which is a mutation of SGLT2, is known to excrete glucose in the urine, but blood glucose levels are almost normal. Therefore, SGLT2 inhibitors are attracting attention as a new therapeutic drug for diabetes, which is increasing worldwide. In fact, SGLT2 inhibitors not only suppress hyperglycemia but also reduce renal, heart, and cardiovascular diseases. However, whether long-term SGLT2 inhibition is completely harmless requires further investigation. In this context, mice with mutations in SGLT2 have been generated and detailed studies are being conducted, e.g., the SGLT2-/- mouse, Sweet Pee mouse, Jimbee mouse, and SAMP10-ΔSglt2 mouse. Biological changes associated with SGLT2 mutations have been reported in these model mice, suggesting that SGLT2 is not only responsible for sugar reabsorption but is also related to other functions, such as bone metabolism, longevity, and cognitive functions. In this review, we present the characteristics of these mutant mice. Moreover, because the relationship between diabetes and Alzheimer's disease has been discussed, we examined the relationship between changes in glucose homeostasis and the amyloid precursor protein in SGLT2 mutant mice.

Clinicopathologic characteristics of pancreatic islet amyloidosis in the rhesus macaque (Macaca mulatta) and sooty mangabey (Cercocebus atys).

BACKGROUND: Diabetes mellitus type 2 has been linked to pancreatic islet amyloid deposition in humans and nonhuman primates. The authors hypothesized that diabetic primates would have significant differences in pathology than non-diabetic groups. METHODS: This retrospective study used histopathology and immunohistochemistry to characterize and compare pancreatic islet amyloidosis in 58 diabetic and non-diabetic rhesus macaque (RM) and sooty mangabeys (SM). RESULTS: The pancreatic tissues from diabetic RM and SM showed higher histopathology scores for islet amyloid deposit distribution, severity, and calcification deposits compared to their respective non-diabetic cohorts. Further, these tissues from RM and SM with amyloid deposits showed immunoreactivity to insulin, glucagon, islet amyloid polypeptide, serum amyloid P, and glucagon-like peptide 1. CONCLUSIONS: Histopathology results showed that the defined amyloid characteristics are associated with clinical diabetes in both species. The immunohistochemistry results collectively suggest differences in pancreatic hormones and islet amyloid components among both species and diabetic status.

[From the discovery of phlorizin (a Belgian story) to SGLT2 inhibitors]. / De la découverte de la phlorizine (une histoire belge) aux inhibiteurs des SGLT2.

Most physicians do not know, or do not remember, the name of phlorizin. Hence this molecule has a major historical importance because it was the precursor of gliflozins, a new class of oral antidiabetic drugs with recent therapeutic perspectives beyond diabetes. This article recalls the history of phlorizin: its discovery in the 19th century by De Koninck and Stas, the demonstration of its ability to induce glucosuria and reduce hyperglycaemia by von Mering, its use to demonstrate the concept of glucose toxicity by the team of DeFronzo and finally the development of selective (phlorizin being not selective) sodium-glucose cotransporter type 2 inhibitors (gliflozins) which block glucose reabsorption in renal tubules. Gliflozins have increasing therapeutic indications, not only in type 2 diabetes, but also in cardiology and nephrology among non-diabetic people with heart failure or renal insufficiency.

La plupart des médecins ne connaissent pas, ou ne se souviennent plus, de la phlorizine. Pourtant, cette molécule a une grande importance historique car elle a été le précurseur des gliflozines, une nouvelle classe d'antidiabétiques oraux ouvrant maintenant de nouvelles perspectives thérapeutiques au-delà du diabète. Cet article retrace l'histoire de la phlorizine : sa découverte au 19ème siècle par De Koninck et Stas, la démonstration de l'induction d'une glucosurie abaissant la glycémie par von Mering, son utilisation pour conceptualiser la notion de glucotoxicité par l'équipe de DeFronzo et, enfin, le développement d'inhibiteurs sélectifs (la phlorizine étant non sélective) des cotransporteurs sodium-glucose de type 2 (SGLT2, gliflozines),dans les tubules rénaux, bloquant la réabsorption du glucose. Les gliflozines ont, maintenant, des indications thérapeutiques de plus en plus larges, non seulement dans le diabète de type 2, mais aussi en cardiologie et en néphrologie chez des personnes non diabétiques avec insuffisance cardiaque ou insuffisance rénale.

[Kanefron N in the treatment of non-diabetic glucosuria in patients with recurrent upper urinary tract infection].

AIM: Purpose to analyze the effectiveness of the herbal preparation Canephron N in the relief of nondiabetic glucosuria in patients with recurrent upper urinary tract infection (UTI). MATERIALS AND METHODS: the study included 100 patients, 53 of them were women (median age of all patients 42 (35; 58) years) with recurrent UTI. Patients were referred to the urology department to exclude the obstructive component and concomitant chronic diseases. Upon further examination, all patients were found to have nondiabetic glucosuria. Fifty patients received standard etiotropic treatment, in 25 patients it was simultaneously supplemented with the herbal drug Canephron N, and 25 patients, after standard treatment, continued monotherapy with this phytopreparation. Clinical and laboratory dynamics was assessed in the course of various treatment regimens. RESULTS: The study found that the recurrent course of chronic UTI may be associated with nondiabetic glucosuria. In patients who received standard therapy in combination with the herbal preparation Kanephron N, a decrease in the intensity of nondiabetic glucosuria with more effective eradication of the bacterial pathogen was noted. At the same time, monotherapy of manifestations of IVMP, which are refractory to etiotropic therapy, with Kanefron N also proved to be quite effective. CONCLUSION: the combination of standard therapy for refractory manifestations of UTI with the herbal preparation Kanephron N is accompanied by the leveling of nondiabetic glucosuria (1.3+/-0.4 and 0.6+/-0.4 mmol/L, p<0.05), coinciding with a decrease in leukocyturia (25.5+/-4.5 and 9.5+/-1.5 in field of vision, p<0.05).

Increase in endogenous glucose production with SGLT2 inhibition is attenuated in individuals who underwent kidney transplantation and bilateral native nephrectomy.

AIMS/HYPOTHESIS: The glucosuria induced by sodium-glucose cotransporter 2 (SGLT2) inhibition stimulates endogenous (hepatic) glucose production (EGP), blunting the decline in HbA1c. We hypothesised that, in response to glucosuria, a renal signal is generated and stimulates EGP. To examine the effect of acute administration of SGLT2 inhibitors on EGP, we studied non-diabetic individuals who had undergone renal transplant with and without removal of native kidneys. METHODS: This was a parallel, randomised, double-blind, placebo-controlled, single-centre study, designed to evaluate the effect of a single dose of dapagliflozin or placebo on EGP determined by stable-tracer technique. We recruited non-diabetic individuals who were 30-65 years old, with a BMI of 25-35 kg/m2 and stable body weight (±2 kg) over the preceding 3 months, and HbA1c <42 mmol/mol (6.0%). Participants had undergone renal transplant with and without removal of native kidneys and were on a stable dose of immunosuppressive medications. Participants received a single dose of dapagliflozin 10 mg or placebo on two separate days, at a 5- to 14-day interval, according to randomisation performed by our hospital pharmacy, which provided dapagliflozin and matching placebo, packaged in bulk bottles that were sequentially numbered. Both participants and investigators were blinded to group assignment. RESULTS: Twenty non-diabetic renal transplant patients (ten with residual native kidneys, ten with bilateral nephrectomy) participated in the study. Dapagliflozin induced greater glucosuria in individuals with residual native kidneys vs nephrectomised individuals (8.6 ± 1.1 vs 5.5 ± 0.5 g/6 h; p = 0.02; data not shown). During the 6 h study period, plasma glucose decreased only slightly and similarly in both groups, with no difference compared with placebo (data not shown). Following administration of placebo, there was a progressive time-related decline in EGP that was similar in both nephrectomised individuals and individuals with residual native kidneys. Following dapagliflozin administration, EGP declined in both groups, but the differences between the decrement in EGP with dapagliflozin and placebo in the group with bilateral nephrectomy (Δ = 1.11 ± 0.72 µmol min-1 kg-1) was significantly lower (p = 0.03) than in the residual native kidney group (Δ = 2.56 ± 0.33 µmol min-1 kg-1). In the population treated with dapagliflozin, urinary glucose excretion was correlated with EGP (r = 0.34, p < 0.05). Plasma insulin, C-peptide, glucagon, prehepatic insulin:glucagon ratio, lactate, alanine and pyruvate concentrations were similar following placebo and dapagliflozin treatment. ß-Hydroxybutyrate increased with dapagliflozin treatment in the residual native kidney group, while a small increase was observed only at 360 min in the nephrectomy group. Plasma adrenaline (epinephrine) did not change after dapagliflozin and placebo treatment in either group. Following dapagliflozin administration, plasma noradrenaline (norepinephrine) increased slightly in the residual native kidney group and decreased in the nephrectomy group. CONCLUSIONS/INTERPRETATION: In nephrectomised individuals, the hepatic compensatory response to acute SGLT2 inhibitor-induced glucosuria was attenuated, as compared with individuals with residual native kidneys, suggesting that SGLT2 inhibitor-mediated stimulation of hepatic glucose production via efferent renal nerves occurs in an attempt to compensate for the urinary glucose loss (i.e. a renal-hepatic axis). TRIAL REGISTRATION: ClinicalTrials.gov NCT03168295 FUNDING: This protocol was supported by Qatar National Research Fund (QNRF) Award No. NPRP 8-311-3-062 and NIH grant DK024092-38. Graphical abstract.

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families.

BACKGROUND: Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS: Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS: A total of nine different mutations were identified: IVS1-16C > A, c.305C > T/p.(A102V), c.395G > A/p.(R132H), c.736C > T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G > T/p.(D408Y), c.1496G > A/p.(R499H) and c.1540C > T/p.(P514S); two novel mutations in SLC5A2, c.1222G > T/p.(D408Y) and c.1496G > A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6 g/d. CONCLUSION: We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C > A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Mutation in Sodium-Glucose Cotransporter 2 Results in Down-Regulation of Amyloid Beta (A4) Precursor-Like Protein 1 in Young Age, Which May Lead to Poor Memory Retention in Old Age.

Senescence-accelerated mouse prone 10 (SAMP10) exhibits cerebral atrophy and depression-like behavior. A line of SAMP10 with spontaneous mutation in the Slc5a2 gene encoding the sodium-glucose cotransporter (SGLT) 2 was named SAMP10/TaSlc-Slc5a2slc (SAMP10-ΔSglt2) and was identified as a renal diabetes model. In contrast, a line of SAMP10 with no mutation in SGLT2 (SAMP10/TaIdrSlc, SAMP10(+)) was recently established under a specific pathogen-free condition. Here, we examined the mutation effect in SGLT2 on brain function and longevity. No differences were found in the survival curve, depression-like behavior, and age-related brain atrophy between SAMP10-ΔSglt2 and SAMP10(+). However, memory retention was lower in SAMP10-ΔSglt2 mice than SAMP10(+). Amyloid beta (A4) precursor-like protein 1 (Aplp1) expression was significantly lower in the hippocampus of SAMP10-ΔSGLT2 than in SAMP10(+) at 2 months of age, but was similar at 12 months of age. CaM kinase-like vesicle association (Camkv) expression was remarkably lower in SAMP10(+). These genes have been reported to be involved in dendrite function. Amyloid precursor proteins have been reported to involve in maintaining homeostasis of glucose and insulin. These results suggest that mutation in SGLT2 results in down-regulation of Aplp1 in young age, which can lead to poor memory retention in old age.

Renal glucosuria is associated with lower body weight and lower rates of elevated systolic blood pressure: results of a nationwide cross-sectional study of 2.5 million adolescents.

BACKGROUND: Gene coding mutations found in sodium glucose co-transporters (SGLTs) are known to cause renal glucosuria. SGLT2 inhibitors have recently been shown to be effective hypoglycemic agents as well as possessing cardiovascular and renal protective properties. These beneficial effects have to some extent, been attributed to weight loss and reduced blood pressure. The aim of the current study was to evaluate the prevalence of renal glucosuria amongst a large cohort of Israeli adolescents and to investigate whether renal glucosuria is associated with lower body weight and lower blood pressure values. METHODS: Medical and socio-demographic data were collected from the Israeli Defense Force's conscription center's database. A cross-sectional study to evaluate the association between conscripts diagnosed as overweight [BMI percentiles of ≥ 85 and < 95 and obesity (≥ 95 BMI percentile)] and afflicted with renal glucosuria was conducted. In addition, we assessed the association of renal glucosuria with elevated diastolic and systolic blood pressure. Multinomial regression models were used. RESULTS: The final study cohort comprised 2,506,830 conscripts of whom 1108 (0.044%) were diagnosed with renal glucosuria, unrelated to diabetes mellitus, with males twice as affected compared to females. The adjusted odds ratio for overweight and obesity was 0.66 (95% CI 0.50-0.87) and 0.62 (95% CI 0.43-0.88), respectively. Adolescents afflicted with renal glucosuria were also less likely to have an elevated systolic blood pressure of 130-139 mmHg with an adjusted odds ratio of 0.74 (95% CI 0.60-0.90). CONCLUSIONS: Renal glucosuria is associated with lower body weight and obesity as well as with lower rates of elevated systolic blood pressure.

Glucosuria and all-cause mortality among general screening participants.

BACKGROUND: Dipstick urine tests are used for general health screening in Japan, but how the test results (e.g., glucosuria) relate to mortality is unknown. METHODS: Subjects participated in a nationwide screening in 2008 in six districts in Japan. We identified those who might have died using the national database of death certificates from 2008 to 2012 (total registered ~ 6 million) and verified candidates with the regional National Health Insurance Agency and public health nurses. Diabetes mellitus (DM) was defined as HbA1c ≥ 6.5%, fasting blood glucose ≥ 126 mg/dl, or medicated for DM. Hazard ratio (HR) and 95% confidence interval (CI) were calculated by Cox proportional hazard analysis. Glucosuria was defined as dipstick ≥ 1 +. RESULTS: Among 209,060 subjects, we identified 2714 fatalities (median follow-up 3.57 years). Crude mortality rates were 1.2% for those without glucosuria and 3.4% for those with glucosuria. After adjusting for sex, age, body mass index, comorbidity (DM, hypertension, and dyslipidemia), history (stroke, heart disease, and kidney disease), and lifestyle (smoking, drinking, walking, and exercise), the HR (95% CI) for dipstick glucosuria was 1.475 (1.166-1.849, P < 0.001). DM subjects with glucosuria (N = 4655) had a higher HR [1.302 (1.044-1.613, P = 0.020)] than DM subjects without glucosuria (N = 20,245), and non-DM subjects with glucosuria (N = 470) had a higher HR [2.511 (1.539-3.833, P < 0.001)] than non-DM subjects without glucosuria (N = 183,690). CONCLUSION: Dipstick glucosuria significantly affected mortality in Japanese community-based screening participants.

Renal glucosuria in schoolchildren: Clinical characteristics.

BACKGROUND: We conducted an annual urine glucose screening program at schools, and diagnosed schoolchildren with diabetes at an early stage of the disease. We also identified some cases of renal glucosuria (RG), based on positive urine glucose with normal glucose tolerance. METHODS: During 2000-2015, 3 309 631 schoolchildren participated in the screening program. The positive rate for glucosuria in the first test was approximately 0.1%, whereas on repeat urine test it was approximately 0.05%. In total 350 schoolchildren were positive for glucosuria on detailed examination. Oral glucose tolerance test (OGTT) was also used to evaluate glucose intolerance. RESULTS: One hundred and two schoolchildren (29.7%) were diagnosed with diabetes, whereas RG was identified in 246 (70.3%) with normal glucose metabolism. In regard to the characteristics of RG, the percentage of boys was 50.3%, and the mean age at diagnosis was 11.2 ± 2.4 years. Twenty-eight children (11.4%) were overweight (body mass index standard deviation score [BMI-SDS] > +2.0 SD), whereas five (2.0%) were underweight (BMI-SDS < -2.0 SD). First-degree family history was suspected in 176 cases (71.5%). All RG subjects had normal glucose tolerance in the absence of insulin resistance and decreased insulin secretion (homeostasis model assessment for ß-cell function, 78.8 ± 59.5%) on OGTT. CONCLUSIONS: RG is not rare in Japanese schoolchildren with glucosuria. This disorder seems to have a strong genetic background, and to involve less growth retardation and weight loss than expected despite continuous excretion of glucose in urine.

Distribution of glucose transporters in renal diseases.

Kidneys play an important role in glucose homeostasis. Renal gluconeogenesis prevents hypoglycemia by releasing glucose into the blood stream. Glucose homeostasis is also due, in part, to reabsorption and excretion of hexose in the kidney.Lipid bilayer of plasma membrane is impermeable for glucose, which is hydrophilic and soluble in water. Therefore, transport of glucose across the plasma membrane depends on carrier proteins expressed in the plasma membrane. In humans, there are three families of glucose transporters: GLUT proteins, sodium-dependent glucose transporters (SGLTs) and SWEET. In kidney, only GLUTs and SGLTs protein are expressed. Mutations within genes that code these proteins lead to different renal disorders and diseases. However, diseases, not only renal, such as diabetes, may damage expression and function of renal glucose transporters.

Urinary Glucose Screening for Early Detection of Asymptomatic Type 2 Diabetes in Jeonbuk Province Korean Schoolchildren.

This study aimed to investigate the prevalence of glucosuria and the characteristics of diabetes in schoolchildren as detected by a school urine glucose screening program implemented from 2010 to 2013 in the Jeonbuk province area of Korea. A total of 110 children without known diabetes were analyzed. They were checked with an oral glucose tolerance test (OGTT) with other laboratory tests and their clinical data were collected. A total of 707,238 schoolchildren from a school population of 1,064,999 were screened for glucosuria. In total, over a 4-year period, 545 schoolchildren (0.077%) were positive for glucosuria on the second urine test. The prevalence of glucosuria was more common among middle and high schoolchildren than among elementary schoolchildren. Among 110 students who completed the OGTT to confirm diabetes, 40 were diagnosed with diabetes mellitus (DM); 39 children, type 2 diabetes mellitus (T2DM) and 1 child, slowly progressive insulin dependent diabetes mellitus (SPIDDM). The mean annual incidence of diabetes was 5.6 per 100,000 schoolchildren and adolescents. The subjects with diabetes diagnosed through the urine screening test showed minimal or no symptoms of diabetes. The students with diabetes were more likely to be woman and obese, and they have a higher body mass index, higher cholesterol, triglyceride, insulin, C-peptide, and fasting glucosuria values than the students with normal glucose tolerance. We identified 40 new cases of diabetes in the Korean schoolchildren with asymptomatic glucosuria on urine glucose screening. This finding shows that school urine glucose screening is a feasible and simple method for early detection of asymptomatic T2DM.

[Influence of meat semiprepared foods produced with an addition of water having a reduced deuterium content on the indicators of the laboratory animals with the model of alloxan diabetes].

The paper presents the results of the study on the influence of water with a reduced deuterium content and the meat semi-prepared foods produced with its addition on the indicators of the laboratory animals with the model of alloxan diabetes. The effect of low concentrations of deuterium on the body weight dynamics was shown as well as the manifestation of glucosuria and ketonuria, and clinico-biological indicators of the animal's blood. The experiment was carried out during 42 days on male rats of Wistar stock, which were divided into 4 groups - 2 experimental, control (n=10) and intact (n=6), and consisted of three stages: adaptational, the stage of modeling of alloxan diabetes (a single intraperitoneal injection of alloxan monohydrate - 12 mg/100 g body weight) and dietic therapeutic. The animals of the experimental groups consumed water with a reduced deuterium content and standard vivarium diet or the meat minced semi-prepared products produced with its addition and cooked to culinary readiness. The control group consumed tap water and standard vivarium diet. In animals of the 1st group, which consumed the meat product, glucosuria persisted up to the 28th day (the 11th day after administration of alloxan), ketonuria up to the 34th day (the 17th day after modeling). In rats of the 2nd group, which consumed water with the decreased deuterium content, glucose in urea was not detected already on the 7th day after administration of alloxan, ketones on the 17th day after modeling of the disease, respectively. In animals of the control group, glucosuria and ketonuria persisted up to the end of the experiment. As a result of the investigations, the positive effect of water with a reduced deuterium content and the meat food produced with its use was established. It was manifested in a decrease of glucose level in the urea of the animals from the experimental groups compared to the control group on the 5th day of disease modeling and normalization on the 17th day of modeling. This experimentally demonstrated the possibility to use deuterium-depleted water in a meat product composition intended for nutrition of people with an impairment of carbohydrate metabolism for correction of metabolic processes.

Decreased expression and function of sodium-glucose co-transporter 2 from a novel C-terminal mutation: a case report.

BACKGROUND: Familial renal glucosuria (FRG) is characterized by persistent glucosuria in the presence of normal serum glucose concentrations, and the absence of other impairments of tubular function. Mutations in the sodium-glucose co-transporter 2 (SGLT2) gene (SLC5A2) are causative of FRG the long-term outcome of which is well know. In the search for potential new drug targets for SGLT2 inhibitors with which to treat the diabetes, expressional and functional studies of SGLT2 have been the focus of attention, but reports of these are rare. Furthermore, it is well known that the alleles in the C-terminal are very important for the expression and function in some genes. However, little is known about the effect of mutation in SLC5A2 C- terminal. CASE PRESENTATION: Here, we identified a FRG patient with urine glucose excretion 7.56 g/day and a novel SLC5A2 missense mutation, c.1891G > A/p.(E631K), by DNA sequencing. Expression and function of the mutant SGLT2 (631 K) fused to green fluorescent protein (GFP) were verified by western blotting, confocal laser microscopy, and transport activity assays in cultured HEK293 cells. Although wild-type SGLT2-GFP and 631 K mutant-GFP fusion proteins were properly expressed in a punctate pattern in the cell membrane, and co-localized with the cell membrane marker DiIC18(3), the expression of the mutant fusion protein was obviously decreased (24 %). Moreover, the uptake activity of the mutant SGLT2 631 K-GFP fusion protein was significantly decreased compared with wild-type (3629 ± 1082 vs. 7926 ± 1153, P < 0.001). CONCLUSION: These results suggest that the SLC5A2 C-terminal is very important for protein expression. We speculate that the observed reduced expression of the mutant transporter led to a decrease in transport of the glucose analog 2-(N-(7-nitrobenz-2-oxa-1,3- diazol-4-yl)amino)-2-deoxyglucose. The current study provides a starting point for further investigations of the SGLT2 molecular mechanism in FRG families, and offers functional insights into the development of anti-diabetes drugs.

[Dapagliflozin (forxiga®) : SGLT 2 cotransporter inhibitor as glucose-lowering agent in type 2 diabetes]. / Le médicament du mois : Dapagliflozine (Forxiga®) Inhibiteur des cotransporteurs rénaux SGLT2, nouvel agent anti-hyperglycémiant dans le diabète de type 2.

Dapagliflozin, a specific inhibitor of sodium-glu¬cose cotransporters type 2 (SGLT2, inhibits glucose reabsorp¬tion in renal tubules and thus promotes glucosuria. This effect results in a reduction in fasting and postprandial glycaemia and a decrease of glycated haemoglobin (HbA1c), with a minor risk of hypoglycaemia, a weight reduction and a reduction in arterial blood pressure. The efficacy of empagliflozin on HbA1c reduction increases according to the level of hyper¬glycaemia but decreases in patients with renal insufficiency. Mycotic genital infections occur more frequently, especially in women, while a negligible increase in mild urinary tract infections may be observed. Dapagliflozin (Forxiga®), 10 mg once daily, is indicated for the treatment of T2DM and reim¬bursed in Belgium with conditions as add-on to a background glucose-lowering therapy (either metformin or sulfonylurea/ repaglinide or metformin plus sulfonylurea/repaglinide or basal insulin plus at least one of these oral glucose-lowering agents). Preliminary results suggest some cardiovascular and renal protection. These results should be confirmed in an ongoing large prospective controlled trial (DECLARE) in type 2 diabetic patients at high cardiovascular risk.

Résumé : La dapagliflozine, un inhibiteur spécifique des cotransporteurs sodium-glucose de type 2 (SGLT2), inhibe la réabsorption tubulaire rénale du glucose et accroît la gluco¬surie. Il en résulte une diminution de la glycémie et du taux d'hémoglobine glyquée (HbA1c), avec un risque faible d'hypo¬glycémie, une perte pondérale et une diminution de la pression artérielle. L'efficacité sur la réduction du taux d'HbA1c est d'autant plus importante que l'hyperglycémie est élevée, mais elle diminue en cas d'insuffisance rénale. Les infections géni¬tales mycotiques sont plus fréquentes, surtout chez la femme, alors que l'augmentation des infections urinaires basses n'est que marginale. La dapagliflozine (Forxiga®), commercialisée à la dose de 10 mg une fois par jour, est indiquée pour le trai¬tement du diabète de type 2 et remboursée en Belgique, sous conditions, en ajout à la metformine, un sulfamide ou le répa-glinide, une association metformine-sulfamide/répaglinide ou une insuline basale avec au moins un antidiabétique oral. Des données préliminaires ne démontrent pas d'augmentation du risque cardiovasculaire par rapport au comparateur et suggèrent même une protection cardiovasculaire et rénale, à confirmer dans l'essai DECLARE, une grande étude prospec¬tive contrôlée actuellement en cours chez des patients diabé¬tiques de type 2 à haut risque cardiovasculaire.

Novel SLC5A2 variants contribute to renal glucosuria in Chinese families: abnormal expression and dysfunction of variant SLC5A2.

Familial renal glucosuria (FRG) is characterized by persistent glucosuria despite normal serum glucose and the absence of overt tubular dysfunction. Variants in solute carrier family 5 (sodium-glucose cotransporter), member 2 (SLC5A2) have been reported in FRG patients. However, the functional and expression-related consequences of such variants have been scarcely investigated. In the current study, we studied five FRG families and identified six missense mutations, including four novel variants (c.1051T>C/.(C351R), c.1400T>C/p.(V467A), c.1420G>C/p.(A474P), c.1691G>A/p.(R564Q); RNA not analyzed) and two variants that had been previously reported (c.294C>A/p.(F98L), c.736C>T/p.(P246S); RNA not analyzed). The probands were either heterozygous or compound heterozygous for SLC5A2 variants and had glucosuria of 5.9%-19.6 g/day. Human 293 cells were transfected with plasmid constructs to study the expression and function of SLC5A2 variants in vitro. Western blotting revealed that the expression levels of SLC5A2-351R-GFP, SLC5A2-467A-GFP, SLC5A2-474P-GFP, and SLC5A2-564Q-GFP were significantly decreased compared with wild-type SLC5A2-GFP (37%-55%). Confocal microscopy revealed that three variants (c.1400T>C, c.1420G>C, c.1691G>A) resulted in a loss of the punctate membrane pattern typical of wild-type SLC5A2. All variants had a significantly lower transport capacity in than the wild-type control. The current study provides a starting point to further investigate the molecular mechanism of SLC5A2 in FRG families and provides functional clues for antidiabetes drugs.