Genomic and biological characteristics of a novel leafhopper-transmitted marafivirus infecting Triticum aestivum.

Here, we report a novel wheat-infecting marafivirus, tentatively named "Triticum aestivum marafivirus" (TaMRV). The full-length genome sequence of TaMRV comprises 6,437 nucleotides, excluding the poly(A) tail. Pairwise sequence comparisons and phylogenetic analysis revealed that TaMRV may represent a novel species within the genus Marafivirus in the family Tymoviridae. We also observed a mass of isometric particles with a diameter of about 30 nm in ultrathin sections of infected wheat leaf tissue. In addition, the leafhopper Psammotettix alienus was identified as a vector for this virus. This is the first report of the occurrence of a wheat-infecting marafivirus.

First report of nectarine virus M in grapefruit (Citrus × paradisi Macfad.) in association with citrus chlorotic blotch disease in Texas, USA.

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

First report of grapevine rupestris vein feathering virus in grapevine in Australia.

Grapevine rupestris vein feathering virus (GRVFV; tentative genus Marafivirus; family Tymoviridae ) was first detected from a Greek grapevine (Vitis vinifera), with asteroid mosaic-like symptoms (El Beaino et al. 2001; Ghanem-Sabanadzovic et al. 2003) and was also infected with grapevine fleck virus. GRVFV has been detected in the United States, South Africa, Canada, Spain, China, New Zealand, Brazil, Germany, Korea, Slovakia, Hungary and Pakistan (Cho et al. 2018; Mahmood et al. 2019).Transmission vectors are currently unknown. In 2018, nine grapevine samples were collected between May to July in South Australia (SA) and Western Australia (WA) (Table S1), were analysed by high-throughput sequencing (HTS) to characterise grapevine viruses in Australian vineyards. Total RNA or double stranded RNA was extracted from grapevine canes using RNeasy 96 QIAcube HT kit (Qiagen) with MacKenzie buffer (MacKenzie et al. 1997) or using CF-11 (Balijja et al. 2008). Libraries were prepared using the NEBNext® Ultra II RNA library Prep Kit (NEB) or TruSeq® Stranded mRNA Prep kit (Illumina) with Ribo-Zero®gold plant kit for ribosomal depletion (Illumina, San Diego, CA). Libraries were sequenced using Illumina Miseq (SA) or Hiseq (WA) technology with 2x300 (SA) or 2x100 (WA) paired end reads which were trimmed using Trim Galore! (0.4.0) or BBmap (38.20), respectively. De novo assembly, using the SPAdes (version 3.12.0) genome assembler with default settings, resulted in twelve near full length GRVFV genomes (6713-6737nt), eight sequences from the WA samples and four from the SA samples. WA samples 171 and 178 and SA sample BV each had two distinct GRVFV molecular variants. Variants 171-1 and 171-2 (GenBank accessions MT084811, MT084812) from sample 171 shared 83.39% nucleotide (nt) identity. Variants 178-1 and 178-2 (MT084813, MT084814) from sample 178 shared 83.54% nt identity. Variants BV6799 and BV8822 (MN974274, MN974275) from sample BV shared 82.85% nt identity. Only one GRVFV sequence was obtained from all other samples. The genome of SA isolate LC1 (MN974273) was confirmed by RT-PCR amplification and Sanger sequencing of overlapping genome regions. Tissue from the infected LC1 isolate has been deposited into the Victorian plant pathogen reference collection (VPRI accession No. 43698). When the genomes of all Australian isolates were compared, they had 78.94% to 94.37 % nt identity with each other. The SA isolates LC1, BV8822, BV6799, and SEL-L (MN974276), and the WA isolates 172 (MT084807), 179 (MT084808), 180 (MT084809), and 182 (MT084810) were most closely related to the Swiss isolate CHASS (KY513702; 82.87% to 85.46% nt identity). The WA isolates 171-1, 171-2, 178-1 and 178-2 were most closely related to the New Zealand isolate Ch8021 (MF000325; 83.21% to 93.87%). Grapevine leafroll-associated virus 1 (GLRaV-1), GLRaV-3, GLRaV-4 (strain 6 and 9), grapevine virus A, grapevine rupestris stem pitting associated virus, grapevine yellow speckle viroid 1 and hop stunt viroid were also identified in the sequencing data. This is the first report of GRVFV in Australia. All WA samples were collected during dormancy and symptoms were not observed. Sample LC1 from SA had Shiraz disease, the other SA samples were asymptomatic, and none had asteroid mosaic-like symptoms. Further research is required to determine its distribution and association with disease in Australia.

ORF43 of maize rayado fino virus is dispensable for systemic infection of maize and transmission by leafhoppers.

Maize rayado fino virus (MRFV) possesses an open reading frame (ORF43) predicted to encode a 43 kDa protein (p43) that has been postulated to be a viral movement protein. Using a clone of MRFV (pMRFV-US) from which infectious RNA can be produced, point mutations were introduced to either prevent initiation from three potential AUG initiation codons near the 5'-end of ORF43 or prematurely terminate translation of ORF43. Inoculation of maize seed via vascular puncture inoculation (VPI) resulted in plants exhibiting symptoms typical of MRFV infection for all mutants tested. Furthermore, corn leafhoppers (Dalbulus maidis) transmitted the virus mutants to healthy plants at a frequency similar to that for wild-type MRFV-US. Viral RNA recovered from plants infected with mutants both prior to and after leafhopper transmission retained mutations blocking ORF43 expression. The results indicate that ORF43 of MRFV is dispensable for both systemic infection of maize and transmission by leafhoppers.

Identification and Full Genome Analysis of the First Putative Virus of Sea Buckthorn (Hippophae rhamnoides L.).

The agricultural importance of sea buckthorn (SBT; Hippophae rhamnoides L.) is rapidly increasing. Several bacterial and fungal pathogens infecting SBT have been identified and characterized; however, the viral pathogens are not yet known. In this study, we identified, isolated, and sequenced a virus from a wild plantation of SBT for the first time. Sequence analysis of the obtained viral genome revealed high similarity with several viruses belonging to the genus Marafivirus. The genome of the new virus is 6989 nucleotides (nt) in length according to 5', 3' RACE (without polyA-tail), with 5' and 3' 133 and 109 nt long untranslated regions, respectively. The viral genome encoded two open reading frames (ORFs). ORF1 encoded a polyprotein of 1954 amino acids with the characteristic marafivirus non-structural protein domains-methyltransferase, Salyut domain, papain-like cysteine protease, helicase, and RNA-dependent RNA polymerase. ORF1 was separated from ORF2 by 6 nt, encoding the coat protein (CP) with typical signatures of minor and major forms. Both CP forms were cloned and expressed in a bacterial expression system. Only the major CP was able to self-assemble into 30 nm virus-like particles that resembled the native virus, thus demonstrating that minor CP is not essential for virion assembly.

Coat protein expression strategy of maize rayado fino virus and evidence for requirement of CP1 for leafhopper transmission.

Marafiviruses, including maize rayado fino virus (MRFV) and oat blue dwarf virus (OBDV), encode two carboxy co-terminal coat proteins, CP1 and CP2, which encapsidate the genome to form icosahedral virions. While CP2 expression is expected to be solely driven from a second start codon of a subgenomic RNA under a marafibox promoter sequence, the larger CP1 with an in-frame N-terminal extension relative to CP2 could potentially be expressed either by proteolytic release from the MRFV polyprotein or from subgenomic RNA translation. We examined MRFV CP expression strategy with a series of mutations in the CP coding region and identified mutants viable and nonviable for systemic plant infection. Polyprotein expression of MRFV CP1 was minimal. Mutants blocking CP2 expression failed to establish systemic infection, while mutants depleted in CP1 exhibited systemic infection and formation of virus-like particles but lost leafhopper transmissibility, indicating that CP1 is required for leafhopper transmission.

High-Throughput Sequencing Indicates a Novel Marafivirus in Grapevine Showing Vein-Clearing Symptoms.

A putative new marafivirus was identified in a 'Jumeigui' grapevine exhibitting obvious vein-clearing symptoms by high-throughput sequencing, which tentatively named grapevine-associated marafivirus (GaMV). The nearly complete genomic sequence of GaMV was amplified by reverse transcription PCR, and the terminal sequences were determined using the rapid amplification of cDNA ends method. The nearly complete genome of GaMV is 6346 bp long, excluding the poly(A) tail, and shows 51.2-62.3% nucleotide identity with other members of the genera Marafivirus, Maculavirus and Tymovirus in the family Tymoviridae. Additionally, it includes five functional domains homologous to those found in members of these genera. A phylogenetic analysis showed that GaMV clustered with other species-related marafiviruses. These data support GaMV being a representative member of a novel species in the genus Marafivirus. Furthermore, GaMV was graft-transmissible and 26 of 516 (5.04%) grapevine samples from five provinces in China tested positive by reverse transcription PCR. The coat protein of GaMV isolates shared 91.7-100% and 96.7-100% identities at the nt and aa levels, respectively. The coat protein-based phylogenetic trees revealed three well-defined clusters.

Engineering Maize rayado fino virus for virus-induced gene silencing.

Maize rayado fino virus (MRFV) is the type species of the genus Marafivirus in the family Tymoviridae. It infects maize (Zea mays), its natural host, to which it is transmitted by leafhoppers including Dalbulus maidis and Graminella nigrifrons in a persistent-propagative manner. The MRFV monopartite RNA genome encodes a precursor polyprotein that is processed into replication-associated proteins. The genome is encapsidated by two carboxy co-terminal coat proteins, CP1 and CP2. Cloned MRFV can be readily transmitted to maize by vascular puncture inoculation (VPI), and such virus systems that can be used in maize are valuable to examine plant gene function by gene silencing. However, the efficacy of marafiviruses for virus-induced gene silencing (VIGS) has not been investigated to date. To this end, MRFV genomic loci were tested for their potential to host foreign insertions without attenuating virus viability. This was done using infectious MRFV clones engineered to carry maize phytoene desaturase (PDS) gene fragments (ZmPDS) at various genomic regions. Several MRFV-PDS constructs were generated and tested for infectivity and VIGS in maize. This culminated in identification of the helicase/polymerase (HEL/POL) junction as a viable insertion site that preserved virus infectivity, as well as several sites at which sequence insertion caused loss of virus infectivity. Transcripts of viable constructs, carrying PDS inserts in the HEL/POL junction, induced stable local and systemic MRFV symptoms similar to wild-type infections, and triggered PDS VIGS initiating in veins and spreading into both inoculated and noninoculated leaves. These constructs were remarkably stable, retaining inserted sequences for at least four VPI passages while maintaining transmissibility by D. maidis. Our data thus identify the MRFV HEL/POL junction as an insertion site useful for gene silencing in maize.

Rescue of Citrus sudden death-associated virus in Nicotiana benthamiana plants from cloned cDNA: insights into mechanisms of expression of the three capsid proteins.

Citrus sudden death-associated virus (CSDaV) is a member of the genus Marafivirus in the family Tymoviridae, and has been associated with citrus sudden death (CSD) disease in Brazil. Difficulties in the purification of CSDaV from infected citrus plants have prevented progress in the investigation of the role of this virus in CSD and an understanding of its molecular biology. In this work, we have constructed a full-length cDNA clone of CSDaV driven by the 35S promoter (35SRbz-CSDaV). Agrobacterium tumefaciens-mediated inoculation of 35SRbz-CSDaV in Nicotiana benthamiana plants enabled a fast recovery of large amounts of virions from the agroinfiltrated leaves, which allowed a better molecular characterization of CSDaV. In vivo analyses of mutant versions of 35SRbz-CSDaV revealed the expression strategies used by CSDaV for production of the capsid proteins (CPs). We showed that CSDaV virions contain three forms of CP, each of which is generated from the same coding sequence, but by different mechanisms. The major CPp21 is a product of direct translation by leaky scanning from the second start codon in the subgenomic RNA (sgRNA), whereas the minor CPs, p25 and p23, are produced by direct translation from the first start codon in the sgRNA and by trans-proteolytic cleavage processing derived from the p25 precursor, respectively. Together, these findings contribute to advance our understanding of CSDaV genome expression strategies. In addition, the construction and characterization of the CSDaV infectious clone represent important steps towards the investigation of the role of this virus in CSD and of its use as a tool for citrus biotechnology.

Identification of novel RNA viruses in alfalfa (Medicago sativa): an Alphapartitivirus, a Deltapartitivirus, and a Marafivirus.

Genomic RNA molecules of plant RNA viruses are often co-isolated with the host RNAs, and their sequences can be detected in plant transcriptome datasets. Here, an alfalfa (Medicago sativa) transcriptome dataset was analyzed and three new RNA viruses were identified, which were named Medicago sativa alphapartitivirus 1 (MsAPV1), Medicago sativa deltapartitivirus 1 (MsDPV1), and Medicago sativa marafivirus 1 (MsMV1). The RNA-dependent RNA polymerases of MsAPV1, MsDPV1, and MsMV1 showed about 68%, 58%, and 46% amino acid sequence identity, respectively, with their closest virus species. Sequence similarity and phylogenetic analyses indicated that MsAPV1, MsDPV1, and MsMV1 were novel RNA virus species that belong to the genus Alphapartitivirus of the family Partitiviridae, the genus Deltapartitivirus of the family Partitiviridae, and the genus Marafivirus of the family Tymoviridae, respectively. The bioinformatics procedure applied in this study may facilitate the identification of novel RNA viruses from plant transcriptome data.

The complete nucleotide sequence and genomic characterization of grapevine asteroid mosaic associated virus.

In analyzing grapevine clones infected with grapevine red blotch associated virus, we identified a small number of isometric particles of approximately 30nm in diameter from an enriched fraction of leaf extract. A dominant protein of 25kDa was isolated from this fraction using SDS-PAGE and was identified by mass spectrometry as belonging to grapevine asteroid mosaic associated virus (GAMaV). Using a combination of three methods RNA-Seq, sRNA-Seq, and Sanger sequencing of RT- and RACE-PCR products, we obtained a full-length genome sequence consisting of 6719 nucleotides without the poly(A) tail. The virus possesses all of the typical conserved functional domains concordant with the genus Marafivirus and lies evolutionarily between citrus sudden death associated virus and oat blue dwarf virus. A large shift in RNA-Seq coverage coincided with the predicted location of the subgenomic RNA involved in coat protein (CP) expression. Genus wide sequence alignments confirmed the cleavage motif LxG(G/A) to be dominant between the helicase and RNA dependent RNA polymerase (RdRp), and the RdRp and CP domains. A putative overlapping protein (OP) ORF lacking a canonical translational start codon was identified with a reading frame context more consistent with the putative OPs of tymoviruses and fig fleck associated virus than with those of marafiviruses. BLAST analysis of the predicted GAMaV OP showed a unique relatedness to the OPs of members of the genus Tymovirus.

Genetic Structure and Molecular Variability Analysis of Citrus sudden death-associated virus Isolates from Infected Plants Grown in Brazil.

Citrus sudden death-associated virus (CSDaV) is a monopartite positive-sense single-stranded RNA virus that was suggested to be associated with citrus sudden death (CSD) disease in Brazil. Here, we report the first study of the genetic structure and molecular variability among 31 CSDaV isolates collected from both symptomatic and asymptomatic trees in CSD-affected areas. Analyses of partial nucleotide sequences of five domains of the CSDaV genomic RNA, including those encoding for the methyltransferase, the multi-domain region (MDR), the helicase, the RNA-dependent RNA polymerase and the coat protein, showed that the MDR coding region was the most diverse region assessed here, and a possible association between this region and virus adaption to different host or plant tissues is considered. Overall, the nucleotide diversity (π) was low for CSDaV isolates, but the phylogenetic analyses revealed the predominance of two main groups, one of which showed a higher association with CSD-symptomatic plants. Isolates obtained from CSD-symptomatic plants, compared to those obtained from asymptomatic plants, showed higher nucleotide diversity, nonsynonymous and synonymous substitution rates and number of amino acid changes on the coding regions located closer to the 5' end region of the genomic RNA. This work provides new insights into the genetic diversity of the CSDaV, giving support for further epidemiological studies.

Molecular characterization of a novel mycovirus of the family Tymoviridae isolated from the plant pathogenic fungus Fusarium graminearum.

We isolated a novel mycovirus, Fusarium graminearum mycotymovirus 1 (FgMTV1/SX64), which is related to members of the family Tymoviridae, from the plant pathogenic fungus F. graminearum strain SX64. The complete 7863 nucleotide sequence of FgMTV1/SX64, excluding the poly (A) tail, was determined. The genome of FgMTV1/SX64 is predicted to contain four open reading frames (ORFs). The largest ORF1 is 6723 nucleotides (nt) in length and encodes a putative polyprotein of 2242 amino acids (aa), which contains four conserved domains, a methyltransferase (Mtr), tymovirus endopeptidase (Pro), viral RNA helicase (Hel), and RNA-dependent RNA polymerase (RdRp), of the replication-associated proteins (RPs) of the positive-strand RNA viruses. ORFs 2-4 putatively encode three putative small hypothetical proteins, but their functions are still unknown. Sequence alignments and phylogenetic analyses based on the putative RP protein and the three conserved domains (Mtr, Hel and RdRp) showed that FgMTV1/SX64 is most closely related to, but distinctly branched from, the viruses from the family Tymoviridae. Although FgMTV1/SX64 infection caused mild or no effect on conidia production, biomass and virulence of its host F. graminearum strain SX64, its infection had significant effects on the growth rate, colony diameter and deoxynivalenol (DON) production. This is the first molecular characterization of a tymo-like mycovirus isolated from a plant pathogenic fungus. It is proposed that the mycovirus FgMTV1/SX64 is a representative member of new proposed lineage Mycotymovirus in the family Tymoviridae.

Genome Characterization, Prevalence and Distribution of a Macula-Like Virus from Apis mellifera and Varroa destructor.

Around 14 distinct virus species-complexes have been detected in honeybees, each with one or more strains or sub-species. Here we present the initial characterization of an entirely new virus species-complex discovered in honeybee (Apis mellifera L.) and varroa mite (Varroa destructor) samples from Europe and the USA. The virus has a naturally poly-adenylated RNA genome of about 6500 nucleotides with a genome organization and sequence similar to the Tymoviridae (Tymovirales; Tymoviridae), a predominantly plant-infecting virus family. Literature and laboratory analyses indicated that the virus had not previously been described. The virus is very common in French apiaries, mirroring the results from an extensive Belgian survey, but could not be detected in equally-extensive Swedish and Norwegian bee disease surveys. The virus appears to be closely linked to varroa, with the highest prevalence found in varroa samples and a clear seasonal distribution peaking in autumn, coinciding with the natural varroa population development. Sub-genomic RNA analyses show that bees are definite hosts, while varroa is a possible host and likely vector. The tentative name of Bee Macula-like virus (BeeMLV) is therefore proposed. A second, distantly related Tymoviridae-like virus was also discovered in varroa transcriptomes, tentatively named Varroa Tymo-like virus (VTLV).

Coat protein expression strategy of oat blue dwarf virus.

Oat blue dwarf virus (OBDV) is a member of the genus Marafivirus whose genome encodes a 227 kDa polyprotein (p227) ostensibly processed post-translationally into its functional components. Encoded near the 3' terminus and coterminal with the p227 ORF are ORFs specifying major and minor capsid proteins (CP). Since the CP expression strategy of marafiviruses has not been thoroughly investigated, we produced a series of point mutants in the OBDV CP encoding gene and examined expression in protoplasts. Results support a model in which the 21 kDa major CP is the product of direct translation of a sgRNA, while the 24 kDa minor CP is a cleavage product derived from both the polyprotein and a larger ~26 kDa precursor translated directly from the sgRNA. Cleavage occurs at an LXG[G/A] motif conserved in many viruses that use papain-like proteases for polyprotein processing and protection against degradation via the ubiquitin-proteasome system.