C-terminal mini-PEGylation of a marine peptide N6 had potent antibacterial and anti-inflammatory properties against Escherichia coli and Salmonella strains in vitro and in vivo.

BACKGROUND: Enteropathogenic Escherichia coli and Salmonella pullorum are two important groups of zoonotic pathogens. At present, the treatment of intestinal pathogenic bacteria infection mainly relies on antibiotics, which directly inhibit or kill the pathogenic bacteria. However, due to long-term irrational, excessive use or abuse, bacteria have developed different degrees of drug resistance. N6, an arenicin-3 derivative isolated from the lugworm, has potent antibacterial activity and is poorly resistant to enzymatic hydrolysis and distribution in vivo. Polyethylene glycol (PEG) is an extensively studied polymer and commonly used in protein or peptide drugs to improve their therapeutic potential. Here, we modified the N-/C-terminal or Cys residue of N6 with liner PEGn of different lengths (n = 2, 6,12, and 24), and the effects of PEGylation of N6 on the stability, toxicity, bactericidal mechanism, distribution and efficacy were investigated in vitro and in vivo. RESULTS: The antimicrobial activity of the peptide showed that PEGylated N6 at the C-terminus (n = 2, N6-COOH-miniPEG) had potent activity against Gram-negative bacteria; PEGylated N6 at the N-terminus and Cys residues showed low or no activity with increasing lengths of PEG. N6-COOH-miniPEG has higher stability in trypsin than the parent peptide-N6. N6-COOH-miniPEG significantly regulated cytokine expression in lipopolysaccharides (LPS)-induced RAW 264.7 cells, and the levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and IL-1ß were reduced by 31.21%, 65.62% and 44.12%, respectively, lower than those of N6 (-0.06%, -12.36% and -12.73%); N6-COOH-miniPEG increased the level of IL-10 (37.83%), higher than N6 (-10.21%). The data indicated that N6-COOH-miniPEG has more potent anti-inflammatory and immune-regulatory effect than N6 in LPS-stimulated RAW 264.7 cells. N6-COOH-miniPEG exhibited a much wider biodistribution in mice and prolonged in vivo half-time. FITC-labeled N6-COOH-miniPEG was distributed throughout the body of mice in the range of 0.75 - 2 h after injection, while FITC-labeled N6 only concentrated in the abdominal cavity of mice after injection, and the distribution range was narrow. N6-COOH-miniPEG improved the survival rates of mice challenged with E. coli or S. pullorum, downregulated the levels of TNF-α, IL-6, IL-1ß and IL-10 in the serum of LPS-infected mice, and alleviated multiple-organ injuries (the liver, spleen, kidney, and lung), superior to antibiotics, but slightly inferior to N6. CONCLUSIONS: The antibacterial activity, bactericidal mechanism and cytotoxicity of N6-COOH-miniPEG and N6 were similar. N6-COOH-miniPEG has a higher resistance to trysin than N6. The distribution of N6-COOH-miniPEG in mice was superior to that of N6. In exploring the modulatory effects of antimicrobial peptides on cytokines, N6-COOH-miniPEG had stronger anti-inflammatory and immunomodulatory effects than N6. The results suggested that C-terminal PEGylated N6 may provide an opportunity for the development of effective anti-inflammatory and antibacterial peptides.

Encapsulation of Salmon Peptides in Marine Liposomes: Physico-Chemical Properties, Antiradical Activities and Biocompatibility Assays.

Salmon byproducts (Salmo salar) generated by the food chain represent a source of long-chain polyunsaturated fatty acids (eicosapentaenoic acid (EPA): 20:5n-3; docosahexaenoic acid (DHA): 22:6n-3) and peptides that can be used as supplements in food for nutraceutical or health applications, such as in the prevention of certain pathologies (e.g., Alzheimer's and cardiovascular diseases). The extraction of polar lipids naturally rich in PUFAs by enzymatic processes without organic solvent (controlled by pH-Stat method), coupled with the production of 1 kDa salmon peptides by membrane filtration, allowed the formulation of nanocarriers. The physicochemical properties of the nanoliposomes (size ranging from 120 to 140 nm, PDI of 0.27, zeta potential between -32 and -46 mV and encapsulation efficiency) were measured, and the bioactivity of salmon hydrolysate peptides was assessed (antioxidant and antiradical activity: ABTS, ORAC, DPPH; iron metal chelation). Salmon peptides exhibited good angiotensin-conversion-enzyme (ACE) inhibition activity, with an IC50 value of 413.43 ± 13.12 µg/mL. Cytotoxicity, metabolic activity and proliferation experiments demonstrated the harmlessness of the nanostructures in these experimental conditions.

Potent intracellular antibacterial activity of a marine peptide-N6NH2 and its D-enantiomer against multidrug-resistant Aeromonas veronii.

Aeromonas veronii can cause a variety of diseases such as sepsis in humans and animals. However, there has been no effective way to eradicate A. veronii. In this study, the intracellular antibacterial activities of the C-terminal aminated marine peptide N6 (N6NH2) and its D-enantiomer (DN6NH2) against A. veronii were investigated in macrophages and in mice, respectively. The result showed that DN6NH2 with the minimum inhibitory concentration (MIC) of 1.62 µM is more resistant to cathepsin B than N6NH2 (3.23 µM). The penetration percentages of the cells treated with 4-200 µg/mL fluorescein isothiocyanate (FITC)-DN6NH2 were 52.5-99.6%, higher than those of FITC-N6NH2 (27.0-99.1%). Both N6NH2 and DN6NH2 entered macrophages by macropinocytosis and an energy-dependent manner. DN6NH2 reduced intracellular A. veronii by 34.57%, superior to N6NH2 (19.52%). After treatment with 100 µg/mL DN6NH2, the levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and IL-1ß were reduced by 53.45%, 58.54%, and 44.62%, respectively, lower than those of N6NH2 (15.65%, 12.88%, and 14.10%, respectively); DN6NH2 increased the IL-10 level (42.94%), higher than N6NH2 (7.67%). In the mice peritonitis model, 5 µmol/kg DN6NH2 reduced intracellular A. veronii colonization by 73.22%, which was superior to N6NH2 (32.45%) or ciprofloxacin (45.67%). This suggests that DN6NH2 may be used as the candidate for treating intracellular multidrug-resistant (MDR) A. veronii. KEY POINTS: • DN6NH2 improved intracellular antibacterial activity against MDR A. veronii. • DN6NH2 entered macrophages by micropinocytosis and enhanced the internalization rates. • DN6NH2 effectively protected the mice from infection with A. veronii.

Marine Antitumor Peptide Dolastatin 10: Biological Activity, Structural Modification and Synthetic Chemistry.

Dolastatin 10 (Dol-10), a leading marine pentapeptide isolated from the Indian Ocean mollusk Dolabella auricularia, contains three unique amino acid residues. Dol-10 can effectively induce apoptosis of lung cancer cells and other tumor cells at nanomolar concentration, and it has been developed into commercial drugs for treating some specific lymphomas, so it has received wide attention in recent years. In vitro experiments showed that Dol-10 and its derivatives were highly lethal to common tumor cells, such as L1210 leukemia cells (IC50 = 0.03 nM), small cell lung cancer NCI-H69 cells (IC50 = 0.059 nM), and human prostate cancer DU-145 cells (IC50 = 0.5 nM), etc. With the rise of antibody-drug conjugates (ADCs), milestone progress was made in clinical research based on Dol-10. A variety of ADCs constructed by combining MMAE or MMAF (Dol-10 derivatives) with a specific antibody not only ensured the antitumor activity of the drugs themself but also improved their tumor targeting and reduced the systemic toxicity. They are currently undergoing clinical trials or have been approved for marketing, such as Adcetris®, which had been approved for the treatment of anaplastic large T-cell systemic malignant lymphoma and Hodgkin lymphoma. Dol-10, as one of the most medically valuable natural compounds discovered up to now, has brought unprecedented hope for tumor treatment. It is particularly noteworthy that, by modifying the chemical structure of Dol-10 and combining with the application of ADCs technology, Dol-10 as a new drug candidate still has great potential for development. In this review, the biological activity and chemical work of Dol-10 in the advance of antitumor drugs in the last 35 years will be summarized, which will provide the support for pharmaceutical researchers interested in leading exploration of antitumor marine peptides.

Anti-HSV-1 activity of Aspergillipeptide D, a cyclic pentapepetide isolated from fungus Aspergillus sp. SCSIO 41501.

BACKGROUND: Herpes simplex virus 1, an enveloped DNA virus belonging to the Herpesviridae family, spreads to neurons and causes pathological changes in the central nervous system. The purpose of this study was to investigate the potency and mechanism of antiviral activity of Aspergillipeptide D, a cyclic pentapeptide isolated from a culture broth of marine gorgonian-derived fungus Aspergillus sp. SCSIO 41501, At present, there are many studies on the anti-tumor, anti-clotting, anti-oxidant and immunoinflammatory effects of Aspergillipeptide D, but little research has been done on the anti-HSV-1 activity of Aspergillipeptide D. METHODS: The anti-HSV-1 activity of Aspergillipeptide D was evaluated by plaque reduction assay. The mechanism of action against HSV-1 was determined from the effective stage. Then we assayed the viral DNA replication, viral RNA synthesis and protein expression, respectively. We also identified the proteins that interact with gB by mass spectrometry, and assayed the effect of Aspergillipeptide D on the interaction between the virus gB protein and cell proteins. RESULTS: Plaque reduction experiments showed that Aspergillipeptide D did not affect HSV-1 early infection events, including viral inactivation, attachment and penetration. Interestingly, Aspergillipeptide D dramatically reduced both the gene and protein levels of viral late protein gB, and suppressed its location in the endoplasmic reticulum and Golgi apparatus. In contrast, overexpression of gB restored viral production. Finally, proteomic analysis revealed that the numbers of cellular proteins that interacted with gB protein was largely decreased by Aspergillipeptide D. These results suggested that Aspergillipeptide D inhibited gB function to affect HSV-1 intercellular spread. CONCLUSIONS: Our results indicated that Aspergillipeptide D might be a potential candidate for HSV-1 therapy, especially for ACV-resistant strains.

Improved Stability and Activity of a Marine Peptide-N6NH2 against Edwardsiella tarda and Its Preliminary Application in Fish.

Edwardsiella tarda can cause fatal gastro-/extraintestinal diseases in fish and humans. Overuse of antibiotics has led to antibiotic resistance and contamination in the environment, which highlights the need to find new antimicrobial agents. In this study, the marine peptide-N6 was amidated at its C-terminus to generate N6NH2. The antibacterial activity of N6 and N6NH2 against E. tarda was evaluated in vitro and in vivo; their stability, toxicity and mode of action were also determined. Minimal inhibitory concentrations (MICs) of N6 and N6NH2 against E. tarda were 1.29-3.2 µM. Both N6 and N6NH2 killed bacteria by destroying the cell membrane of E. tarda and binding to lipopolysaccharide (LPS) and genomic DNA. In contrast with N6, N6NH2 improved the stability toward trypsin, reduced hemolysis (by 0.19% at a concentration of 256 µg/mL) and enhanced the ability to penetrate the bacterial outer and inner membrane. In the model of fish peritonitis caused by E. tarda, superior to norfloxacin, N6NH2 improved the survival rate of fish, reduced the bacterial load on the organs, alleviated the organ injury and regulated the immunity of the liver and kidney. These data suggest that the marine peptide N6NH2 may be a candidate for novel antimicrobial agents against E. tarda infections.

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures.

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

Dual Antibacterial Activities and Biofilm Eradication of a Marine Peptide-N6NH2 and Its Analogs against Multidrug-Resistant Aeromonas veronii.

Aeromonas veronii is one of the main pathogens causing various diseases in humans and animals. It is currently difficult to eradicate drug-resistant A. veronii due to the biofilm formation by conventional antibiotic treatments. In this study, a marine peptide-N6NH2 and its analogs were generated by introducing Orn or replacing with D-amino acids, Val and Pro; their enzymic stability and antibacterial/antibiofilm ability against multi-drug resistant (MDR) A. veronii ACCC61732 were detected in vitro and in vivo, respectively. The results showed that DN6NH2 more rapidly killed A. veronii ACCC61732 and had higher stability in trypsin, simulated gastric/intestinal fluid, proteinase K, and mouse serum than the parent peptide-N6NH2. DN6NH2 and other analogs significantly improved the ability of N6NH2 to penetrate the outer membrane of A. veronii ACCC61732. DN6NH2, N6PNH2 and V112N6NH2 protected mice from catheter-associated biofilm infection with MDR A. veronii ACCC61732, superior to N6NH2 and CIP. DN6NH2 had more potent efficacy at a dose of 5 µmol/kg (100% survival) in a mouse peritonitis model than other analogs (50-66.67%) and CIP (83.33%), and it inhibited the bacterial translocation, downregulated pro-inflammatory cytokines, upregulated the anti-inflammatory cytokine, and ameliorated multiple-organ injuries (including the liver, spleen, lung, and kidney). These data suggest that the analogs of N6NH2 may be a candidate for novel antimicrobial and antibiofilm agents against MDR A. veronii infections.

A Potential Antineoplastic Peptide of Human Prostate Cancer Cells Derived from the Lesser Spotted Dogfish (Scyliorhinus canicula L.).

The purpose of the present paper is to investigate the mechanism of action of a pyroglutamate-modified peptide (pE-K092D) on in vitro growth inhibition of MDA-Pca-2b prostate cancer cells. This peptide was derived from a peptide previously isolated from the testis of the lesser spotted dogfish and identified as QLTPEALADEEEMNALAAR (K092D). The effect of the peptide on cell proliferation and cell death mechanisms was studied by flow cytometry. Cellular morphology and cytoskeleton integrity of peptide-treated cells were observed by immunofluorescence microscopy. Results showed the onset of peptide induced early cytoskeleton perturbation, inhibition of autophagy, inhibition of cell proliferation and, at the end, non-apoptotic cell death mechanisms (membrane destabilization and necrosis). All those mechanisms seem to contribute to MDA-Pca-2b growth inhibition by a main cytostatic fate.

K092A and K092B, Two Peptides Isolated from the Dogfish (Scyliorhinus canicula L.), with Potential Antineoplastic Activity Against Human Prostate and Breast Cancer Cells.

Cancer therapy is currently a major challenge within the research community, especially in reducing the side effects of treatments and to develop new specific strategies against cancers that still have a poor prognosis. In this context, alternative strategies using biotechnologies, such as marine peptides, have been developed based on their promise of effectivity associated with a low toxicity for healthy cells. The purpose of the present paper is to investigate the active mechanism of two peptides that were isolated from the epigonal tissue of the lesser spotted dogfish Scyliorhinus canicula L., identified NFDTDEQALEDVFSKYG (K092A) and EAPPEAAEEDEW (K092B) on the in vitro growth inhibition of ZR-75-1 mammary carcinoma cells and MDA-Pca-2b prostate cancer cells. The effects of the peptides on cell proliferation and cell death mechanisms were studied by the flow cytometry and immunofluorescence microscopy approaches. The results have shown the onset of both K092A- and K092B-induced early cytoskeleton changes, and then cell cycle perturbations followed by non-apoptotic cell death. Moreover, impedance perturbation and plasma membrane perforation in ZR-75-1 K092A-treated cell cultures and autophagy inhibition in MDA-Pca-2b K092B-treated cells have been observed. In conclusion, these two bioactive peptides from dogfish exhibit antineoplastic activity on the human prostate and breast cancer cells in vitro.

Marine Peptide-N6NH2 and Its Derivative-GUON6NH2 Have Potent Antimicrobial Activity Against Intracellular Edwardsiella tarda in vitro and in vivo.

Edwardsiella tarda is a facultative intracellular pathogen in humans and animals. There is no effective way except vaccine candidates to eradicate intracellular E. tarda. In this study, four derivatives of marine peptide-N6NH2 were designed by an introduction of unnatural residues or substitution of natural ones, and their intracellular activities against E. tarda were evaluated in macrophages and in mice, respectively. The minimum inhibitory concentration (MIC) value of N6NH2 and GUON6NH2 against E. tarda was 8 µg/mL. GUON6NH2 showed higher stability to trypsin, lower toxicity (<1%) and longer post-antibiotic effect (PAE) than N6NH2 and other derivatives. Antibacterial mechanism results showed that GUON6NH2 could bind to LPS and destroyed outer/inner cell membranes of E. tarda, superior to N6NH2 and norfloxacin. Both N6NH2 and GUON6NH2 were internalized into macrophages mainly via lipid rafts, micropinocytosis, and microtubule polymerization, respectively, and distributed in the cytoplasm. The intracellular inhibition rate of GUON6NH2 against E. tarda was 97.05-100%, higher than that in case of N6NH2 (96.82-100%). In the E. tarda-induced peritonitis mouse model, after treatment with of 1 µmol/kg N6NH2 and GUON6NH2, intracellular bacterial numbers were reduced by 1.54- and 1.97-Log10 CFU, respectively, higher than norfloxacin (0.35-Log10 CFU). These results suggest that GUON6NH2 may be an excellent candidate for novel antimicrobial agents to treat infectious diseases caused by intracellular E. tarda.

The effect of carbohydrate and marine peptide hydrolysate co-ingestion on endurance exercise metabolism and performance.

BACKGROUND: The purpose of this study was to examine the efficacy of introducing a fish protein hydrolysate (PEP) concurrently with carbohydrate (CHO) and whey protein (PRO) on endurance exercise metabolism and performance. METHODS: In a randomised, double blind crossover design, 12 male volunteers completed an initial familiarisation followed by three experimental trials. The trials consisted of a 90 min cycle task corresponding to 50% of predetermined maximum power output, followed by a 5 km time trial (TT). At 15 min intervals during the 90 min cycle task, participants consumed 180 ml of CHO (67 g(.)hr(-1) of maltodextrin), CHO-PRO (53.1 g(.)hr of CHO, 13.6 g(.)hr(-1) of whey protein) or CHO-PRO-PEP (53.1 g(.)hr(-1) of CHO, 11 g(.)hr(-1) of whey protein and 2.4 g(.)hr(-1)of hydrolyzed marine peptides). RESULTS AND CONCLUSIONS: During the 90 min cycle task, the respiratory exchange ratio (RER) in the CHO-PRO condition was significantly higher than CHO (p < 0.001) and CHO-PRO-PEP (p < 0.001). Additionally, mean heart rate for the CHO condition was significantly lower than that for CHO-PRO (p = 0.021). Time-to-complete the 5 km TT was not significantly different between conditions (m ± SD: 456 ± 16, 456 ± 18 and 455 ± 21 sec for CHO, CHO-PRO and CHO-PRO-PEP respectively, p = 0.98). Although the addition of hydrolyzed marine peptides appeared to influence metabolism during endurance exercise in the current study, it did not provide an ergogenic benefit as assessed by 5 km TT performance.