NtMYB1 and NtNCED1/2 control abscisic acid biosynthesis and tepal senescence in Chinese narcissus (Narcissus tazetta).

Chinese narcissus (Narcissus tazetta var. chinensis cv. 'Jinzhanyintai') is one of the 10 most famous traditional flowers of China, having a beautiful and highly ornamental flower with a rich fragrance. However, the flower longevity affects its commercial appeal. While petal senescence in Narcissus is ethylene-independent and abscisic acid-dependent, the regulatory mechanism has yet to be determined. In this study, we identified a R2R3-MYB gene (NtMYB1) from Narcissus tazetta and generated oeNtMYB1 and Ntmyb1 RNA interference mutants in Narcissus as well as an oeNtMYB1 construct in Arabidopsis. Overexpressing NtMYB1 in Narcissus or Arabidopsis led to premature leaf yellowing, an elevated level of total carotenoid, a reduced level of chlorophyll b, and a decrease in photosystem II fluorescence (Fv/Fm). A dual-luciferase assay and chromatin immunoprecipitation-quantitative PCR revealed that NtMYB1 directly binds to the promoter of NtNCED1 or NtNCED2 and activates NtNCED1/2 gene expression both in vitro and in vivo. Moreover, overexpressing NtMYB1 accelerated abscisic acid biosynthesis, up-regulated the content of zeatin and abscisic acid, and down-regulated the level of ß-carotene and gibberellin A1, leading to petal senescence and leaf yellowing in Narcissus. This study revealed a regulatory process that is fundamentally different between non-photosynthetic organs and leaves.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Alkaloid Profile in Wild Autumn-Flowering Daffodils and Their Acetylcholinesterase Inhibitory Activity.

Amaryllidaceae alkaloids are secondary metabolites with interesting medicinal properties. Almost every Narcissus species can synthesize them and constitute an excellent source for their isolation and study. Several Amaryllidaceae alkaloids have shown acetylcholinesterase inhibitory activities and are a promising tool for treating cholinergic disorders such as Alzheimer's disease (AD). Indeed, three of the four palliative treatments approved for AD are acetylcholinesterase (AChE) inhibitors and one of them, galanthamine, is an Amaryllidaceae alkaloid itself. This molecule is currently isolated from natural sources. However, its production is insufficient to supply the increasing demand for the active principle. Our main aim is to discover tools to improve galanthamine production and to prospect for potential new and more efficient drugs for AD treatment. Furthermore, we seek to broaden the knowledge of plants of the genus Narcissus from a chemotaxonomic perspective. Hence, in this study, we evaluate the alkaloid content through GC-MS and the AChE inhibitory activity of ten autumn-flowering Narcissus, which have been less studied than their spring-flowering counterparts. A total of thirty Amaryllidaceae alkaloids have been found, twenty-eight properly identified. Two Narcissus contained galanthamine, and seven were able to inhibit AChE.

Direct evidence supporting Darwin's hypothesis of cross-pollination promoted by sex organ reciprocity.

The floral phenotype plays a main role in the attraction and fit of pollinators. Both perianth traits and the positioning of sex organs can be subjected to natural selection and determine nonrandom mating patterns in populations. In stylar-polymorphic species, the Darwinian hypothesis predicts increased mating success between individuals with sex organs at equivalent heights (i.e. with higher reciprocity). We used paternity analyses in experimental populations of a stylar-dimorphic species. By comparing the observed mating patterns with those expected under random mating, we tested the effects of sex organ reciprocity and perianth traits on mating success. We also analysed phenotypic selection on perianth traits through female and male functions. The (dis)similarity of parental perianth traits had no direct effects on the mating patterns. Sex organ reciprocity had a positive effect on mating success. Narrow floral tubes increased this effect in upper sex organs. Perianth traits showed little signs of phenotypic selection. Female and absolute fitness measures resulted in different patterns of phenotypic selection. We provide precise empirical evidence of the Darwinian hypothesis about the functioning of stylar polymorphisms, demonstrating that mating patterns are determined by sex organ reciprocity and only those perianth traits which are critical to pollinator fit.

Genetic diversity and evolutionary analyses of potyviruses infecting narcissus in Iran.

Potyviruses are among the most important pathogens of dicotyledonous and monocotyledonous ornamentals and crop plants. In this study, leaf samples were collected from symptomatic narcissus plants and weeds in Fars and Tehran provinces of Iran. Enzyme-linked immunosorbent assay using broad-spectrum potyvirus antibodies gave a positive reaction with 38 out of 61 narcissus samples tested (62.3%); the results were confirmed by reverse-transcription polymerase chain reaction using universal NIb primers, and for thirty samples, by sequencing and phylogenetic studies. The results suggested the infection of almost all positive samples with narcissus yellow stripe virus (NYSV); only one sample seemed to be infected with narcissus late season yellows virus (NLSYV). The 3'-end of the genome of the NLSYV isolate and six NYSV isolates, encompassing the complete coat protein gene, was amplified and sequenced using species-specific and universal potyvirus primers. Sequence analysis indicated the presence of NLSYV and NYSV, not previously identified from Western Asia. No evidence of recombination was found in Iranian isolates. Based on phylogenetic analyses, isolates of NLSYV and NYSV clustered into five and three phylogroups, respectively, where all the Iranian isolates fell into distinct subpopulations in groups NLSYV-I and NYSV-II. Multiple sequence alignments showed some phylogroup-specific amino acid substitutions for both viruses. Phylogroup IV and II populations had higher nucleotide diversities as compared with other populations of NLSYV and NYSV, respectively. Our findings revealed the presence of negative selection in the populations of both viruses. Almost no statistically significant gene flow was found between populations of these viruses. Supplementary information: The online version contains supplementary material available at 10.1007/s42161-021-00985-0.

Supercritical CO2 Extraction of Narcissus poeticus L. Flowers for the Isolation of Volatile Fragrance Compounds.

The flowers of Narcissus poeticus are used for the isolation of valuable fragrance substances. So far, as the majority of these substances consist of volatile and sensitive to heat compounds, there is a need of developing effective methods for their recovery. In this study, freeze-dried N. poeticus inflorescences were extracted with pure supercritical CO2 (SFE-CO2) and its mixture with 5% co-solvent ethanol (EtOH) at 40 °C. Extract yields varied from 1.63% (12 MPa) to 3.12% (48 MPa, 5% EtOH). In total, 116 volatile compounds were identified by GC-TOF/MS in the extracts, which were divided into 20 different groups. Benzyl benzoate (9.44-10.22%), benzyl linoleate (1.72-2.17%) and benzyl alcohol (0.18-1.00%) were the major volatiles among aromatic compounds. The amount of the recovered benzyl benzoate in N. poeticus SFE-CO2 extracts varied from 58.98 ± 2.61 (24 MPa) to 91.52 ± 1.36 (48 MPa) mg/kg plant dry weight (pdw). α-Terpineol dominated among oxygenated monoterpenes (1.08-3.42%); its yield was from 9.25 ± 0.63 (12 MPa) to 29.88 ± 1.25 (48 MPa/EtOH) mg/kg pdw. Limonene was the major monoterpene hydrocarbon; (3E)-hexenol and heneicosanol dominated among alcohols and phenols; dihydroactinidiolide and 4,8,12,16-tetramethyl heptadecan-4-olide were the most abundant lactones; heptanal, nonanal, (2E,4E)-decadienal and octadecanal were the most abundant aldehydes. The most important prenol lipids were triterpenoid squalene, from 0.86 ± 0.10 (24 MPa) to 7.73 ± 0.18 (48 MPa/EtOH) mg/kg pdw and D-α-tocopherol, from 1.20 ± 0.04 (12 MPa) to 15.39 ± 0.31 (48 MPa/EtOH) mg/kg pdw. Aliphatic hydrocarbons (waxes) constituted the main part (41.47 to 54.93%) in the extracts; while in case of a 5% EtOH the percentage of alkanes was the lowest. The fraction of waxes may be removed for the separation of higher value fragrance materials. In general, the results obtained are promising for a wider application of SFE-CO2 for the recovery of fragrance substances from N. poeticus flowers.

NtbHLH1, a JAF13-like bHLH, interacts with NtMYB6 to enhance proanthocyanidin accumulation in Chinese Narcissus.

BACKGROUND: Flavonoid biosynthesis in plants is primarily regulated at the transcriptional level by transcription factors modulating the expression of genes encoding enzymes in the flavonoid pathway. One of the most studied transcription factor complexes involved in this regulation consists of a MYB, bHLH and WD40. However, in Chinese Narcissus (Narcissus tazetta L. var. chinensis), a popular monocot bulb flower, the regulatory mechanism of flavonoid biosynthesis remains unclear. RESULTS: In this work, genes related to the regulatory complex, NtbHLH1 and a R2R3-MYB NtMYB6, were cloned from Chinese Narcissus. Phylogenetic analysis indicated that NtbHLH1 belongs to the JAF13 clade of bHLH IIIf subgroup, while NtMYB6 was highly homologous to positive regulators of proanthocyanidin biosynthesis. Both NtbHLH1 and NtMYB6 have highest expression levels in basal plates of Narcissus, where there is an accumulation of proanthocyanidin. Ectopic over expression of NtbHLH1 in tobacco resulted in an increase in anthocyanin accumulation in flowers, and an up-regulation of expression of the endogenous tobacco bHLH AN1 and flavonoid biosynthesis genes. In contrast, the expression level of LAR gene was significantly increased in NtMYB6-transgenic tobacco. Dual luciferase assays showed that co-infiltration of NtbHLH1 and NtMYB6 significantly activated the promoter of Chinese Narcissus DFR gene. Furthermore, a yeast two-hybrid assay confirmed that NtbHLH1 interacts with NtMYB6. CONCLUSIONS: Our results suggest that NtbHLH1 may function as a regulatory partner by interacting directly with NtMYB6 to enhance proanthocyanidin accumulation in Chinese Narcissus.

Transcriptome-Based WGCNA Analysis Reveals Regulated Metabolite Fluxes between Floral Color and Scent in Narcissus tazetta Flower.

A link between the scent and color of Narcissus tazetta flowers can be anticipated due to their biochemical origin, as well as their similar biological role. Despite the obvious aesthetic and ecological significance of these colorful and fragrant components of the flowers and the molecular profiles of their pigments, fragrant formation has addressed in some cases. However, the regulatory mechanism of the correlation of fragrant components and color patterns is less clear. We simultaneously used one way to address how floral color and fragrant formation in different tissues are generated during the development of an individual plant by transcriptome-based weighted gene co-expression network analysis (WGCNA). A spatiotemporal pattern variation of flavonols/carotenoids/chlorophyll pigmentation and benzenoid/phenylpropanoid/ monoterpene fragrant components between the tepal and corona in the flower tissues of Narcissus tazetta, was exhibited. Several candidate transcription factors: MYB12, MYB1, AP2-ERF, bZIP, NAC, MYB, C2C2, C2H2 and GRAS are shown to be associated with metabolite flux, the phenylpropanoid pathway to the production of flavonols/anthocyanin, as well as related to one branch of the phenylpropanoid pathway to the benzenoid/phenylpropanoid component in the tepal and the metabolite flux between the monoterpene and carotenoids biosynthesis pathway in coronas. It indicates that potential competition exists between floral pigment and floral fragrance during Narcissus tazetta individual plant development and evolutionary development.

Electron transport pathways in isolated chromoplasts from Narcissus pseudonarcissus L.

During daffodil flower development, chloroplasts differentiate into photosynthetically inactive chromoplasts having lost functional photosynthetic reaction centers. Chromoplasts exhibit a respiratory activity reducing oxygen to water and generating ATP. Immunoblots revealed the presence of the plastid terminal oxidase (PTOX), the NAD(P)H dehydrogenase (NDH) complex, the cytochrome b6 f complex, ATP synthase and several isoforms of ferredoxin-NADP+ oxidoreductase (FNR), and ferredoxin (Fd). Fluorescence spectroscopy allowed the detection of chlorophyll a in the cytochrome b6 f complex. Here we characterize the electron transport pathway of chromorespiration by using specific inhibitors for the NDH complex, the cytochrome b6 f complex, FNR and redox-inactive Fd in which the iron was replaced by gallium. Our data suggest an electron flow via two separate pathways, both reducing plastoquinone (PQ) and using PTOX as oxidase. The first oxidizes NADPH via FNR, Fd and cytochrome bh of the cytochrome b6 f complex, and does not result in the pumping of protons across the membrane. In the second, electron transport takes place via the NDH complex using both NADH and NADPH as electron donor. FNR and Fd are not involved in this pathway. The NDH complex is responsible for the generation of the proton gradient. We propose a model for chromorespiration that may also be relevant for the understanding of chlororespiration and for the characterization of the electron input from Fd to the cytochrome b6 f complex during cyclic electron transport in chloroplasts.

Temporal patterns of seed germination in early spring-flowering temperate woodland geophytes are modified by warming.

BACKGROUND AND AIMS: Understorey species in temperate deciduous woodlands such as wild daffodil (Narcissus pseudonarcissus) and common snowdrop (Galanthus nivalis) have complex dormancy: seeds that are shed in late spring require warm summer temperatures for embryo elongation and dormancy alleviation, but then cooler temperatures for germination in autumn. As seasons warm and tree canopies alter, how will different seasonal temperature sequences affect these complex dormancy responses? METHODS: The effect of different sequences of warmer (+5 °C), current or cooler (-5 °C) seasons (summer to spring) on seed germination patterns over seven successive seasons were investigated, with all sequences combined factorially to determine the consequences of differential seasonal temperature change for the temporal pattern of germination (and so seedling recruitment). KEY RESULTS: Little (<1 %, G. nivalis) or no (N. pseudonarcissus) seed germination occurred during the first summer in any treatment. Germination of N. pseudonarcissus in the first autumn was considerable and greatest at the average (15 °C) temperature, irrespective of the preceding summer temperature; germination was also substantial in winter after a warmer autumn. Germination in G. nivalis was greatest in the warmest first autumn and influenced by preceding summer temperature (average > warmer > cooler); the majority of seeds that germinated over the whole study did so during the two autumns but also in year 2's cooler summer after a warm spring. CONCLUSIONS: Warmer autumns and winters delay first autumn germination of N. pseudonarcissus to winter but advance it in G. nivalis; overall, warming will deplete the soil seed bank of these species, making annual seed influx increasingly important for recruitment and persistence. This study provides a comprehensive account of the effects of temperature changes in different seasons on seed germination in these early spring-flowering geophytes and consequently informs how these and other temperate woodland species with complex seed dormancy may respond to future climate change.

Optimization of Plant Production by Seed Treatment in Two Wild Subspecies of Narcissus pseudonarcissus Rich in Alkaloids.

The daffodil Narcissus pseudonarcissus L. contains alkaloids of pharmaceutical interest. Wild daffodil populations have diverse genetic backgrounds and various genetic traits of possible importance. Developing protocols for plant production from seeds may ensure the availability of a large reservoir of individuals as well as being important for species with bulbs that are difficult to acquire. The closely related Narcissus pseudonarcissus subsp. munozii-garmendiae and subsp. nevadensis were investigated in this study because the alkaloids isolated from both are of high pharmacological interest. At the dispersal time, the seeds of both were dormant with underdeveloped embryos, i.e., morphophysiological dormancy (MPD). Experiments were conducted outdoors and under controlled laboratory conditions. Embryo growth and the percentages of radicle and seedling emergence were calculated under different temperature-light stratifications. In N. munozii-garmendiae, embryo growth occurred during warm stratification (28/14 °C or 25/10 °C) and the radicle then emerged when the temperature decreased, but the shoot was dormant. In N. nevadensis, the seeds germinated when cold stratified (5 °C) and then incubated at cool temperatures. Thus, N. munozii-garmendiae and N. nevadensis exhibit different levels of MPD, i.e., deep simple epicotyl and intermediate complex, respectively. Plant production protocols from seeds were established for both taxa in this study.

NtMYB3, an R2R3-MYB from Narcissus, Regulates Flavonoid Biosynthesis.

R2R3-MYB transcription factors play important roles in the regulation of plant flavonoid metabolites. In the current study, NtMYB3, a novel R2R3-MYB transcriptional factor isolated from Chinese narcissus (Narcissus tazetta L. var. chinensis), was functionally characterized. Phylogenetic analysis indicated that NtMYB3 belongs to the AtMYB4-like clade, which includes repressor MYBs involved in the regulation of flavonoid biosynthesis. Transient assays showed that NtMYB3 significantly reduced red pigmentation induced by the potato anthocyanin activator StMYB-AN1 in agro-infiltrated leaves of tobacco. Over-expression of NtMYB3 decreased the red color of transgenic tobacco flowers, with qRT-PCR analysis showing that NtMYB3 repressed the expression levels of genes involved in anthocyanin and flavonol biosynthesis. However, the proanthocyanin content in flowers of transgenic tobacco increased as compared to wild type. NtMYB3 showed expression in all examined narcissus tissues; the expression level in basal plates of the bulb was highest. A 968 bp promoter fragment of narcissus FLS (NtFLS) was cloned, and transient expression and dual luciferase assays showed NtMYB3 repressed the promoter activity. These results reveal that NtMYB3 is involved in the regulation of flavonoid biosynthesis in narcissus by repressing the biosynthesis of flavonols, and this leads to proanthocyanin accumulation in the basal plate of narcissus.

Cloning and characterization of norbelladine synthase catalyzing the first committed reaction in Amaryllidaceae alkaloid biosynthesis.

BACKGROUND: Amaryllidaceae alkaloids (AAs) are a large group of plant-specialized metabolites displaying an array of biological and pharmacological properties. Previous investigations on AA biosynthesis have revealed that all AAs share a common precursor, norbelladine, presumably synthesized by an enzyme catalyzing a Mannich reaction involving the condensation of tyramine and 3,4-dihydroxybenzaldehyde. Similar reactions have been reported. Specifically, norcoclaurine synthase (NCS) which catalyzes the condensation of dopamine and 4-hydroxyphenylacetaldehyde as the first step in benzylisoquinoline alkaloid biosynthesis. RESULTS: With the availability of wild daffodil (Narcissus pseudonarcissus) database, a transcriptome-mining search was performed for NCS orthologs. A candidate gene sequence was identified and named norbelladine synthase (NBS). NpNBS encodes for a small protein of 19 kDa with an anticipated pI of 5.5. Phylogenetic analysis showed that NpNBS belongs to a unique clade of PR10/Bet v1 proteins and shared 41% amino acid identity to opium poppy NCS1. Expression of NpNBS cDNA in Escherichia coli produced a recombinant enzyme able to condense tyramine and 3,4-DHBA into norbelladine as determined by high-resolution tandem mass spectrometry. CONCLUSIONS: Here, we describe a novel enzyme catalyzing the first committed step of AA biosynthesis, which will facilitate the establishment of metabolic engineering and synthetic biology platforms for the production of AAs.

Sources for developing new medicinal products: biochemical investigations on alcoholic extracts obtained from aerial parts of some Romanian Amaryllidaceae species.

BACKGROUND: Although Galanthus nivalis L. (snowdrop) is known for the galanthamine content, used in the treatment of Alzheimer disease, the polyphenolic compounds of Amaryllidaceae species are less studied. Proper understanding of the polyphenolics in these extracts and of their antioxidant and antimicrobial properties may allow a reconsideration of their medicinal uses. METHODS: The polyphenolic content of four selected Amaryllidaceae species harvested from Romania (Galanthus nivalis L., Narcissus pseudonarcissus L., N. poeticus L. and Leucojum vernum L.) was determined by spectrophotometric methods; the identification of phenolic compounds was performed by a HPLC-MS method, in order to establish their polyphenolic fingerprints. For the evaluation of the antioxidant potential the following methods were employed: DPPH radical scavenging, FRAP, hemoglobin ascorbate peroxidase activity inhibition (HAPX), inhibition of lipid peroxidation catalyzed by cytochrome c, and electron paramagnetic resonance (EPR) spectroscopy assays. Antimicrobial activity was assessed using the disc diffusion method. RESULTS: Qualitative and quantitative analyses highlight important amount of polyphenols (over 15 mg/g); the main identified compounds are chlorogenic and p-coumaric acids in all species. Only G. nivalis shows antioxidant activity by all the used methods. G. nivalis and L. vernum strongly inhibits the growth of S. aureus, while N. poeticus shows a very good antifungal activity. CONCLUSIONS: The results of this study provide a new approach to the properties and therapeutic uses of some Romanian widespread Amaryllidaceae species that could be considered sources of developing new medicinal products with anti anti-staphylococcal and antifungal activity.

Transcriptome Sequencing and Biochemical Analysis of Perianths and Coronas Reveal Flower Color Formation in Narcissus pseudonarcissus.

Narcissus pseudonarcissus is an important bulbous plant with white or yellow perianths and light yellow to orange-red coronas, but little is known regarding the biochemical and molecular basis related to flower color polymorphisms. To investigate the mechanism of color formation, RNA-Seq of flower of two widely cultured cultivars ('Slim Whitman' and 'Pinza') with different flower color was performed. A total of 84,463 unigenes were generated from the perianths and coronas. By parallel metabolomic and transcriptomic analyses, we provide an overview of carotenoid biosynthesis, degradation, and accumulation in N. pseudonarcissus. The results showed that the content of carotenoids in the corona was higher than that in the perianth in both cultivars. Accordingly, phytoene synthase (PSY) transcripts have a higher abundance in the coronas than that in perianths. While the expression levels of carotenoid biosynthetic genes, like GGPPS, PSY, and LCY-e, were not significantly different between two cultivars. In contrast, the carotenoid degradation gene NpCCD4 was highly expressed in white-perianth cultivars, but was hardly detected in yellow-perianth cultivars. Silencing of NpCCD4 resulted in a significant increase in carotenoid accumulation, especially in all-trans-ß-carotene. Therefore, we presume that NpCCD4 is a crucial factor that causes the low carotenoid content and color fading phenomenon of 'Slim Whitman' by mediating carotenoid turnover. Our findings provide mass RNA-seq data and new insights into carotenoid metabolism in N. pseudonarcissus.

Ectopic Overexpression of a Novel R2R3-MYB, NtMYB2 from Chinese Narcissus Represses Anthocyanin Biosynthesis in Tobacco.

R2R3 MYB transcription factors play key functions in the regulation of secondary metabolites. In the present study, a R2R3 MYB transcriptional factor NtMYB2 was identified from Chinese narcissus (Narcissus tazetta L. var. Chinensis Roem) and functionally characterized. NtMYB2 belongs to subgroup 4 of the R2R3 MYB transcription factor family that are related to repressor MYBs involved in the regulation of anthocyanin and flavonoids. Transient expression confirmed that NtMYB2 strongly reduced the red pigmentation induced by MYB- anthocyanin activators in agro-infiltrated tobacco leaves. Ectopic expression of NtMYB2 in tobacco significantly reduced the pigmentation and altered the floral phenotypes in transgenic tobacco flowers. Gene expression analysis suggested that NtMYB2 repressed the transcript levels of structural genes involved in anthocyanin biosynthesis pathway, especially the UFGT gene. NtMYB2 gene is expressed in all examined narcissus tissues; the levels of transcription in petals and corona is higher than other tissues and the transcription level at the bud stage was highest. These results show that NtMYB2 is involved in the regulation of anthocyanin biosynthesis pathway and may act as a repressor by down regulating the transcripts of key enzyme genes in Chinese narcissus.

Narcissus yellow stripe virus and Narcissus mosaic virus detection in Narcissus via multiplex TaqMan-based reverse transcription-PCR assay.

AIMS: Development of a multiplex TaqMan RT-qPCR assay to simultaneously detect Narcissus yellow stripe virus (NYSV) and Narcissus mosaic virus (NMV), frequently causing mixed narcissus infection. Feasibility verification was confirmed in natural samples. METHODS AND RESULTS: Primers and probes were designed based on the conserved CP gene regions of NYSV or NMV and their suitability for singleplex and multiplex TaqMan RT-qPCR assays as well as for conventional RT-PCR. Conventional RT-PCR, singleplex and multiplex TaqMan RT-qPCR assays proved to be NYSV and NMV specific. P-values and coefficients of variation of TaqMan RT-qPCR assays indicated high reproducibility. Significantly increased sensitivity was achieved compared to conventional RT-PCR. The detection limit of both viruses was 103 copies with superior correlation coefficients and linear standard curve responses between plasmid concentrations and Ct values. NYSV and NMV infection of narcissus leaves, petals and bulbs could successfully be detected via our multiplex RT-qPCR method at 1·25 mg. CONCLUSION: Our multiplex TaqMan RT-qPCR assay provides rapid, specific, sensitive and reliable testing to simultaneously detect NYSV and NMV, supplying useful routine monitoring for different narcissus samples. SIGNIFICANCE AND IMPACT OF THE STUDY: Efficient identification and discrimination of the narcissus viruses provides reliable information for scientists and conventional growers. Furthermore, it enriches the information of NYSV, NMV and other narcissus viruses.

Structure of Pigment Metabolic Pathways and Their Contributions to White Tepal Color Formation of Chinese Narcissus tazetta var. chinensis cv Jinzhanyintai.

Chinese narcissus (Narcissus tazetta var. chinensis) is one of the ten traditional flowers in China and a famous bulb flower in the world flower market. However, only white color tepals are formed in mature flowers of the cultivated varieties, which constrains their applicable occasions. Unfortunately, for lack of genome information of narcissus species, the explanation of tepal color formation of Chinese narcissus is still not clear. Concerning no genome information, the application of transcriptome profile to dissect biological phenomena in plants was reported to be effective. As known, pigments are metabolites of related metabolic pathways, which dominantly decide flower color. In this study, transcriptome profile and pigment metabolite analysis methods were used in the most widely cultivated Chinese narcissus "Jinzhanyintai" to discover the structure of pigment metabolic pathways and their contributions to white tepal color formation during flower development and pigmentation processes. By using comparative KEGG pathway enrichment analysis, three pathways related to flavonoid, carotenoid and chlorophyll pigment metabolism showed significant variations. The structure of flavonoids metabolic pathway was depicted, but, due to the lack of F3'5'H gene; the decreased expression of C4H, CHS and ANS genes; and the high expression of FLS gene, the effect of this pathway to synthesize functional anthocyanins in tepals was weak. Similarly, the expression of DXS, MCT and PSY genes in carotenoids synthesis sub-pathway was decreased, while CCD1/CCD4 genes in carotenoids degradation sub-pathway was increased; therefore, the effect of carotenoids metabolic pathway to synthesize adequate color pigments in tepals is restricted. Interestingly, genes in chlorophyll synthesis sub-pathway displayed uniform down-regulated expression, while genes in heme formation and chlorophyll breakdown sub-pathways displayed up-regulated expression, which also indicates negative regulation of chlorophyll formation. Further, content change trends of various color metabolites detected by HPLC in tepals are consistent with the additive gene expression patterns in each pathway. Therefore, all three pathways exhibit negative control of color pigments synthesis in tepals, finally resulting in the formation of white tepals. Interestingly, the content of chlorophyll was more than 10-fold higher than flavonoids and carotenoids metabolites, which indicates that chlorophyll metabolic pathway may play the major role in deciding tepal color formation of Chinese narcissus.

Convergent recruitment of new pollinators is triggered by independent hybridization events in Narcissus.

Hybridization can generate new species if some degree of isolation prevents gene flow between the hybrids and their progenitors. The recruitment of novel pollinators by hybrids has been hypothesized to be one way in which such reproductive isolation can be achieved. We tested whether pollinators contributed to isolation between two natural Narcissus hybrids and their progenitors using pollination experiments, observations, plus morphological and floral-volatile measurements. These hybrids share the same maternal but different paternal progenitors. We found that only the hybrids were visited by and pollinated by ants. The two hybrids exceeded their progenitors in floral-tube aperture size and nectar production. The emission of floral volatiles by hybrid plants was not only equal to or higher than the progenitor species, but also contained some new compounds not produced by the progenitors. The recruitment of ants as novel pollinators in the hybrids involved the combination of increased nectar secretion and the production of novel floral scent compounds. A breakdown of chemical defence against ants may also be involved. This study provides support for the hypothesis that the recruitment of novel pollinators can contribute to reproductive isolation between hybrids and their progenitors.

Range-wide population genetics and variation in morph ratio in style-dimorphic Narcissus papyraceus.

UNLABELLED: • PREMISE OF THE STUDY: Theoretical models state that natural selection and mating patterns account for floral morph ratio in style-polymorphic plants. However, the demographic history of populations can also influence variation in morph ratios. If so, we hypothesize an association between the morph ratios and the genetic structure across populations.• METHODS: We used nuclear microsatellites to assess genetic variation and structure in populations of Narcissus papyraceus, a style-dimorphic plant whose floral morph ratios (L-morph to S-morph) gradually vary throughout its distribution range in the southwestern Mediterranean Basin. We implemented analyses to relate the genetic features of populations with their morph ratios.• KEY RESULTS: We found greater frequencies of the S-morph in central populations and declining frequencies toward the periphery. This geographic pattern was not associated with the genetic structure of populations. Instead, we found two distinct genetic groups, mainly separated by the Strait of Gibraltar, with a mixture of morph ratios within each one. Overall, there was a weak genetic structure. Genetic diversity was greater in central and southern dimorphic populations than in northern L-monomorphic populations.• CONCLUSIONS: Altogether, our results do not support the hypothesis that the demographic history of populations can account for the observed geographical pattern of morph ratios in N. papyraceus. We suggest that adaptive processes shown in previous studies in the species are the main determinant of the existing variation in the morph composition of populations.