Discovery and Characterization of Putative Glycoprotein-Encoding Mycoviruses in the Bunyavirales.

Although segmented negative-sense RNA viruses (SNSRVs) have been frequently discovered in various fungi, most SNSRVs reported only the large segments. In this study, we investigated the diversity of the mycoviruses in the phytopathogenic fungus Fusarium asiaticum using the metatranscriptomic technique. We identified 17 fungal single-stranded RNA (ssRNA) viruses including nine viruses within Mitoviridae, one each in Narnaviridae, Botourmiaviridae, Hypoviridae, Fusariviridae, and Narliviridae, two in Mymonaviridae, and one trisegmented virus temporarily named Fusarium asiaticum mycobunyavirus 1 (FaMBV1). The FaMBV1 genome comprises three RNA segments, large (L), medium (M), and small (S) with 6,468, 2,639, and 1,420 nucleotides, respectively. These L, M, and S segments putatively encode the L protein, glycoprotein, and nucleocapsid, respectively. Phylogenetic analysis based on the L protein showed that FaMBV1 is phylogenetically clustered with Alternaria tenuissima negative-stranded RNA virus 2 (AtNSRV2) and Sclerotinia sclerotiorum negative-stranded RNA virus 5 (SsNSRV5) but distantly related to the members of the family Phenuiviridae. FaMBV1 could be vertically transmitted by asexual spores with lower efficiency (16.7%, 2/42). Comparison between FaMBV1-free and -infected fungal strains revealed that FaMBV1 has little effect on hyphal growth, pathogenicity, and conidium production, and its M segment is dispensable for viral replication and lost during subculture and asexual conidiation. The M and S segments of AtNSRV2 and SsNSRV5 were found using bioinformatics methods, indicating that the two fungal NSRVs harbor trisegmented genomes. Our results provide a new example of the existence and evolution of the segmented negative-sense RNA viruses in fungi. IMPORTANCE Fungal segmented negative-sense RNA viruses (SNSRVs) have been frequently found. Only the large segment encoding RNA-dependent RNA polymerase (RdRp) has been reported in most fungal SNSRVs, except for a few fungal SNSRVs reported to encode nucleocapsids, nonstructural proteins, or movement proteins. Virome analysis of the Fusarium spp. that cause Fusarium head blight discovered a novel virus, Fusarium asiaticum mycobunyavirus 1 (FaMBV1), representing a novel lineage of the family Phenuiviridae. FaMBV1 harbors a trisegmented genome that putatively encodes RdRp, glycoproteins, and nucleocapsids. The putative glycoprotein was first described in fungal SNSRVs and shared homology with glycoprotein of animal phenuivirus but was dispensable for its replication in F. asiaticum. Two other trisegmented fungal SNSRVs that also encode glycoproteins were discovered, implying that three-segment bunyavirus infections may be common in fungi. These findings provide new insights into the ecology and evolution of SNSRVs, particularly those infecting fungi.

ICTV Virus Taxonomy Profile: Phenuiviridae 2023.

The family Phenuiviridae comprises viruses with 2-8 segments of negative-sense or ambisense RNA, comprising 8.1-25.1 kb in total. Virions are typically enveloped with spherical or pleomorphic morphology but can also be non-enveloped filaments. Phenuivirids infect animals including livestock and humans, birds, plants or fungi, as well as arthropods that serve as single hosts or act as biological vectors for transmission to animals or plants. Phenuivirids include important pathogens of humans, livestock, seafood and agricultural crops. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Phenuiviridae, which is available at ictv.global/report/phenuiviridae.

Annual (2023) taxonomic update of RNA-directed RNA polymerase-encoding negative-sense RNA viruses (realm Riboviria: kingdom Orthornavirae: phylum Negarnaviricota).

In April 2023, following the annual International Committee on Taxonomy of Viruses (ICTV) ratification vote on newly proposed taxa, the phylum Negarnaviricota was amended and emended. The phylum was expanded by one new family, 14 new genera, and 140 new species. Two genera and 538 species were renamed. One species was moved, and four were abolished. This article presents the updated taxonomy of Negarnaviricota as now accepted by the ICTV.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Highly adaptive Phenuiviridae with biomedical importance in multiple fields.

The newly established virus family Phenuiviridae in Bunyavirales harbors viruses infecting three kingdoms of host organisms (animals, plants, and fungi), which is rare in known virus families. Many phenuiviruses are arboviruses and replicate in two distinct hosts (e.g., insects and humans or rice). Multiple phenuivirid species, such as Dabie bandavirus, Rift Valley fever phlebovirus, and Rice stripe tenuivirus, are highly pathogenic to humans, animals, or plants. They impose heavy global burdens on human health, livestock industry, and agriculture and are research hotspots. In recent years the taxonomy of Phenuiviridae has been expanded greatly, and research on phenuiviruses has made significant progress. With these advances, this review drew a novel panorama regarding the biomedical significance, distribution, morphology, genomics, taxonomy, evolution, replication, transmission, pathogenesis, and control of phenuiviruses, to aid researchers in various fields to recognize this highly adaptive and important virus family and conduct relevant risk analysis.

Emergence of Toscana Virus, Romania, 2017-2018.

We describe a series of severe neuroinvasive infections caused by Toscana virus, identified by real-time reverse transcription PCR testing, in 8 hospitalized patients in Bucharest, Romania, during the summer seasons of 2017 and 2018. Of 8 patients, 5 died. Sequencing showed that the circulating virus belonged to lineage A.

Incubation Period for Neuroinvasive Toscana Virus Infections.

Toscana virus (TOSV) is an emerging pathogen in the Mediterranean area and is neuroinvasive in its most severe form. Basic knowledge on TOSV biology is limited. We conducted a systematic review on travel-related infections to estimate the TOSV incubation period. We estimated the incubation period at 12.1 days.

Characterization of tulip streak virus, a novel virus associated with the family Phenuiviridae.

In Japan, tulip-growing areas have been plagued by viral diseases for decades, but the viruses causing the damage remain undescribed. In this study, Nicotiana benthamiana and Chenopodium quinoa plants mechanically inoculated with crude sap from a symptomatic tulip flower exhibited necrosis symptoms. Additionally, flexuous and filamentous virus particles were detected by electron microscopy analysis. Moreover, we determined the complete sequences of two genomic segments of the tulip streak virus (TuSV), which is a new virus associated with streaking symptoms, on the basis of a next-generation sequencing analysis. Homology analyses of the amino acid sequence of RNA-dependent RNA polymerase and the terminal sequence of the genomic RNA indicated that TuSV is associated with viruses in the family Phenuiviridae, but differs substantially from other reported viruses.

First report of watermelon crinkle leaf-associated virus 1 (WCLaV-1) and WCLaV-2 infecting watermelon (Citrullus lanatus) in the United States.

Watermelon (Citrullus lanatus) and other cucurbits are cultivated globally, and Texas ranks among its top 5 producers in the U.S. In July 2020, plants with virus-like disease symptoms consisting of mild leaf crinkling and yellow mosaic patterns were observed in a 174-ha watermelon field in Burleson Co., TX; disease incidence was visually estimated at 5%. Total nucleic acids were extracted from leaf tissues of 5 randomly sampled plants (Dellaporta 1983) and their equimolar amounts were made into a composite sample that was used for cDNA library construction with TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina). The cDNA library was sequenced on the Illumina NextSeq 500 platform, generating ~37M single-end reads (each 75 nt), which were analyzed as per Al Rwahnih et al. (2018). Of these, 58,200 and 27,500 reads mapped to the genomes of watermelon crinkle leaf-associated virus 1 (WCLaV-1) and WCLaV-2 (Xin et al. 2017), respectively, along with 4 other virus-specific reads (data not shown). The near complete RNA1-RNA3 segments of WCLaV-1 (354-652X) and WCLaV-2 (144-258X) were generated from the mapped reads and they shared ≥96% nt identities with published RNA segments of both viruses. The results were verified by RT-PCR using newly designed primers WCLaV-1vRP: 5'-GGTGAGTTAGTGTGTCTGAAGG/WCLaV-1cRP: 5'-GAGGTTGCCTGAGGTGATAAG to target 881 bp of the RNA1-encoded RNA-dependent RNA polymerase (RdRP), WCLaV-1vMP: 5'-GAAGGTTTGCTCCCTTGAAATG/WCLaV-1cMP: 5'-GACTGTGGCTGAAGAGTCTATG target 538 bp of the RNA2-encoded movement protein (MP), and WCLaV-1vNP: 5'-CGAATAGACTCTGGAGGGTAGA/WCLaV-1cMP: 5'-GAAAGCAAGAAAGCTGGCTAAA target 786 bp of the RNA3-encoded nucleoprotein (NP). Similarly, the WWCLaV-2-specific primers WCLaV-2vRP: 5'-GTCTCACATTCCTGCACTAACT/WCLaV-2cRP: 5'-ATCGGTCCTGGGTTATTTGTATC target 968 bp of the RdRP, WCLaV-2vMP: 5'-GACTTCAGAACCTCAACATCCA/WCLaV-2cMP: 5'-CAAGGGAGAGTGCTGACAAA target 562 bp of the MP, and WCLaV-2vNP: 5'-ATTCCCAGTGAGAGCAACAA/WCLaV-2cMP: 5'-GAGGTGGAGGTAGGAAAGAAAG target 449 bp of the NP. Fresh cDNA synthesized from the 5 samples with PrimeScript First Strand cDNA synthesis kit (Takara Bio) were tested by PCR with all 6 primer pairs using the PrimeSTAR GXL DNA Polymerase kit (Takara Bio). Three of the 5 samples were positive for both viruses and one sample was positive for each virus. The obtained products from 4 samples were cloned individually into pJET1.2/Blunt vector (Thermo Scientific, USA), followed by bidirectional Sanger-sequencing of the plasmids with the GenElute Five-Minute Plasmid Miniprep kit (Sigma-Aldrich). In pairwise comparisons, the partial RNA1-RNA3 sequences of WCLaV-1 (GenBank accession nos. MW559074-82) shared 100% nt/aa identities with each other and with corresponding sequences of WCLaV-1 isolate KF-1 from China (KY781184-86). The partial RNA1-RNA3 sequences of WCLaV-2 (MW559083-91) shared 97-100% nt/96-100% aa identities with each other and with corresponding sequences of WCLaV-2 isolate KF-15 from China (KY781187-89). This is the first report of WCLaV-1 and WCLaV-2 in Texas and the first record of both viruses in the U.S. and elsewhere outside of China. Both negative-sense, single-stranded RNA viruses represent a novel taxon in the family Phenuiviridae (order Bunyavirales) (Xin et al. 2017). While aspects of the biology of both viruses are yet to be elucidated, our results expand their geographical range. The detection primers developed here will be useful for screening cucurbits germplasm to avert their spread.

Severe Fever with Thrombocytopenia Syndrome, Japan, 2013-2017.

We conducted an epidemiologic study of severe fever with thrombocytopenia syndrome (SFTS) in Japan during 2013-2017. Of 303 cases reported during that period, 133 (44%) were included in this study. The median time between onset of illness and diagnosis of SFTS shortened, from 11.5 to 3.0 days, but the case-fatality rate remained high, at 27%. In 64 patients (48%), a close contact with companion animals was reported within 2 weeks of disease onset. Of these 64 patients, 40 were surveyed further, and we confirmed that 3 had direct contact with body fluids of ill companion animals; 2 had direct contact with the saliva of an ill feral cat or pet dog. These patients reported no history of tick bite, suggesting that ill companion animals might be a source of SFTS virus transmission. Direct contact with the body fluids of ill companion animals should be avoided.

The initial detection of Toscana virus in phlebotomine sandflies from Turkey.

Toscana virus (TOSV) is a prominent arthropod-borne viral agent of human central nervous system infections occurring in the Mediterranean region. The main transmission route to susceptible individuals involves sandflies as vectors. Despite several reports revealing widespread TOSV activity in Turkey, vectors remained unidentified. A sandfly field survey was carried out in five provinces in Central, Southeast and Mediterranean Anatolia in 2017 to identify TOSV and related sandfly-borne phleboviruses and Leishmania parasites, with evidence for circulation in the region. A total of 7136 sandfly specimens, collected via standard methods, were evaluated in 163 pools. TOSV was detected in 11 pools (6.7%), comprising Phlebotomus major sensu lato, Sergentomyia dentata and Phlebotomus papatasi species. TOSV partial L and S segment sequences were characterized, that phylogenetically clustered with local and global genotype A strains. An amino acid substitution outside the conserved motifs of the viral polymerase, also present in previous TOSV sequences in endemic regions, was observed. Leishmania tropica was detected in a single pool of Ph. sergentii (0.6%). This is the first report of TOSV in sandflies from Turkey, and this study further provides evidence for additional sandfly species with the potential to transmit TOSV.

Mourilyan virus pathogenicity in kuruma shrimp (Penaeus japonicus).

The bunyavirus Mourilyan virus (MoV) occurs commonly in Black tiger (Penaeus monodon) and kuruma shrimp (Penaeus japonicus) farmed in eastern Australia. There is circumstantial evidence of MoV causing mortalities among P. japonicus moved from farm ponds to tanks for rearing as broodstock. To directly assess its pathogenic potential, independent cohorts of pond- (n = 24) or tank-reared juvenile (n = 21) P. japonicus were challenged intramuscularly with a cephalothorax tissue homogenate of P. monodon containing high loads of MoV (1.48 ± 0.28 × 108 MoV RNA copies/µg total RNA). In each trial, mortalities accumulated gradually among the saline-injected controls. Mortality onset occurred 12-14 days earlier in the pond-reared shrimp, possibly due to them possessing low-level pre-existing MoV infections. Despite the time to onset of mortality differing, Kaplan-Meier survival analyses confirmed mortality rates to be significantly higher in both the pond- (p = .017) and tank-reared shrimp (p = .031) challenged with MoV. RT-qPCR data on shrimp sampled progressively over each trial showed high loads of MoV to establish following challenge and discounted GAV and other endemic viruses from contributing to mortality. Together, the data show that acute MoV infection can adversely compromise the survival of juvenile P. japonicus.

Heartland Virus and Hemophagocytic Lymphohistiocytosis in Immunocompromised Patient, Missouri, USA.

Heartland virus is a suspected tickborne pathogen in the United States. We describe a case of hemophagocytic lymphohistiocytosis, then death, in an immunosuppressed elderly man in Missouri, USA, who was infected with Heartland virus.

Toscana virus cap-snatching and initiation of transcription.

Toscana virus (TOSV) is an arthropod-borne phlebovirus within the family Phenuiviridae in the order Bunyavirales. It seems to be an important agent of human meningoencephalitis in the warm season in the Mediterranean area. Because the polymerase of Bunyavirales lacks a capping activity, it cleaves short-capped RNA leaders derived from the host cell, and uses them to initiate viral mRNA synthesis. To determine the size and nucleotide composition of the host-derived RNA leaders, and to elucidate the first steps of TOSV transcription initiation, we performed a high-throughput sequencing of the 5' end of TOSV mRNAs in infected cells at different times post-infection. Our results indicated that the viral polymerase cleaved the host-capped RNA leaders within a window of 11-16 nucleotides. A single population of cellular mRNAs could be cleaved at different sites to prime the synthesis of several viral mRNA species. The majority of the mRNA resulted from direct priming, but we observed mRNAs resulting from several rounds of prime-and-realign events. Our data suggest that the different rounds of the prime-and-realign mechanism result from the blocking of the template strand in a static position in the active site, leading to the slippage of the nascent strand by two nucleotides when the growing duplex is sorted out from the active site. To minimize this rate-limiting step, TOSV polymerase cleaves preferentially capped RNA leaders after GC, so as to greatly reduce the number of cycles of priming and realignment, and facilitate the separation of the growing duplex.

The Adaptive Immune Response against Bunyavirales.

The Bunyavirales order includes at least fourteen families with diverse but related viruses, which are transmitted to vertebrate hosts by arthropod or rodent vectors. These viruses are responsible for an increasing number of outbreaks worldwide and represent a threat to public health. Infection in humans can be asymptomatic, or it may present with a range of conditions from a mild, febrile illness to severe hemorrhagic syndromes and/or neurological complications. There is a need to develop safe and effective vaccines, a process requiring better understanding of the adaptive immune responses involved during infection. This review highlights the most recent findings regarding T cell and antibody responses to the five Bunyavirales families with known human pathogens (Peribunyaviridae, Phenuiviridae, Hantaviridae, Nairoviridae, and Arenaviridae). Future studies that define and characterize mechanistic correlates of protection against Bunyavirales infections or disease will help inform the development of effective vaccines.

Identification of Three Novel Genes in Phenuiviridae Detected from Aedes Mosquitoes in Hokkaido, Japan.

Mosquitoes are important arthropod vectors of arboviruses. The family Phenuiviridae includes several medically important arboviruses, such as the Rift Valley fever phlebovirus and Toscana phlebovirus. Recent comprehensive genetic analyses have identified many novel mosquito-specific viruses that are phylogenetically related to Phenuiviridae. We collected mosquitoes from Hokkaido in northern Japan, and conducted reverse transcription polymerase chain reactions (RT-PCRs) targeting the RNA-dependent RNA polymerase (RdRp) gene of Phenuiviridae. A total of 285 pools, comprising 3,082 mosquitoes from 2 genera and 8 species, were collected. Partial RdRp sequences were detected in 97 pools, which allowed us to classify the viruses into 3 clusters provisionally designated as Etutanne virus (ETTV) 1, 2, and 3. The virus most closely related to ETTVs is Narangue virus (family Phenuiviridae, genus Mobuvirus), which was detected in Mansonia mosquitoes; the nucleotide and amino acid sequences of the Narangue virus are 58.4-66.2% and 64.7-86.7% similar, respectively, to those of ETTVs. PCR and RT-PCR using DNA and RNase digestion methods showed that the ETTVs are RNA viruses that do not form non-retroviral integrated RNA virus sequences in the mosquito genome.

Humoral immunity to phlebovirus infection.

Phleboviruses are zoonotic pathogens found in parts of Africa, Asia, Europe, and North America and cause disease symptoms ranging from self-limiting febrile illness to severe disease, including hemorrhagic diathesis, encephalitis, and ocular pathologies. There are currently no approved preventative vaccines against phlebovirus infection or antivirals for the treatment of the disease. Here, we discuss the roles of neutralizing antibodies in phlebovirus infection, the antigenic targets present on the mature polyproteins Gn and Gc, progress in vaccine development, and the prospects of identifying conserved neutralizing epitopes across multiple phleboviruses. Further research in this area will pave the way for the rational design of pan-phlebovirus vaccines that will protect against both known phleboviruses but also newly emerging phleboviruses that may have pandemic potential.

Neutralizing based seroprevalence study of Toscana virus in livestock from Algeria.

Toscana virus is a sandfly-borne human pathogen belonging to Phlebovirus genus into Phenuiviridae family. It is emerging in north Africa posing a complex threat to public health. TOSV is heavily affecting sandfly-exposed people in northern Algeria. A larger distribution has recently been stated in Algeria by using dog sera. Dog exposure to TOSV was repeatedly identified in north Algeria, with 4.56% lately detected to possess respective neutralizing antibodies. However, evidence for TOSV has only been observed in dogs among various species of domestic animals. Therefore, we attempted to assess sera from 221 livestock comprising cattle, sheep, goats, rabbits and horses, to identify the presence of TOSV neutralizing antibodies. The study was conducted during 2017, in 11 areas from the governorates of Blida, Medea, Algiers, Tipaza, Ain Defla, Tissemsilt in the north center, and Setif, Mila, Tizi Ouzou, Jijel in the northeast of Algeria. Positive results were obtained in 14.6% (12/82) cattle, 17.18% (11/64) sheep, 15% (3/20) horses and 3.33% (1/30) goats, whereas rabbits remained negative. Positive samples originated mainly from the north centre, with new areas being first-ever detected. The seroprevalence was noticed to be very strongly related to sample origin (p < 0.01). Females (OR=4.09) were observed to be more likely infected. Our findings represent a further proof of TOSV circulation in Algeria. Moreover, they revealed a potential role of livestock (p = 0.00731) in its natural cycle. This fact emphasize how important is to elucidate the exact contribution of livestock to the epidemiology of sandfly-borne phleboviruses, and their impact on public health.

Human and animal exposure to newly discovered sand fly viruses, China.

Introduction: The Hedi virus (HEDV) and Wuxiang virus (WUXV) are newly discovered Bunyaviruses transmitted by sandflies. The geographical distribution of isolation of these two viruses continues to expand and it has been reported that WUXV causes neurological symptoms and even death in suckling mice. However, little is known about the prevalence of the two viruses in mammalian infections. Methods: In order to understand the infection status of HEDV and WUXV in humans and animals from regions where the viruses have been isolated, this study used Western blotting to detect the positive rates of HEDV and WUXV IgG antibodies in serum samples from febrile patients, dogs, and chickens in the forementioned regions. Results: The results showed that of the 29 human serum samples, 17.24% (5/29) tested positive for HEDV, while 68.96% (20/29) were positive for WUXV. In the 31 dog serum samples, 87.10% (27/31) were positive for HEDV and 70.97% (22/31) were positive for WUXV, while in the 36 chicken serum samples, 47.22% (17/36) were positive for HEDV, and 52.78% (19/36) were positive for WUXV. Discussion: These findings suggest there are widespread infections of HEDV and WUXV in mammals (dogs, chickens) and humans from the regions where these viruses have been isolated. Moreover, the positive rate of HEDV infections was higher in local animals compared to that measured in human specimens. This is the first seroepidemiological study of these two sandfly-transmitted viruses. The findings of the study have practical implications for vector-borne viral infections and related zoonotic infections in China, as well as providing an important reference for studies on the relationship between sandfly-transmitted viruses and zoonotic infections outside of China.

Presence of the sandfly-borne phlebovirus (Toscana virus) in different bio-geographical regions of Algeria demonstrated by a microneutralisation-based seroprevalence study in owned dogs.

Toscana virus (TOSV) is major meningitis and meningoencephalitis agent in the Mediterranean basin. Dogs are frequently exposed to TOSV; thereby they can contribute to estimating its circulation. In Algeria, little is known about its circulation, and available data are restricted to the Kabylian region. To investigate the current situation in Algeria, a total of 205 dog sera collected from 13 different wilayas over the country were analyzed by using in-house Enzyme Linked Immunosorbent Assay (ELISA) and microneutralization test (MNT). An overall seroprevalence rate of 20% (14.5-25.5%) was observed by ELISA. Whereas, a seroprevalence rate of 4.56% (1.65-7.43%) was recorded by microneutralization test elucidating the exact occurrence of TOSV exposure in dogs, in Algeria. Positive dogs were detected from the areas of Algiers, Bejaia, Blida, Bouira, Medea, Setif, and Tlemcen in the north; Laghouat in the high lands and Tamanrasset in great Sahara. Only one serum, originating from Bejaia in the north east, was positive for both testing methods, while 8/9 positive sera in MNT remained negative in ELISA. MNT negative/ELISA positive result of 40/41 might suggest evidence for dog transmission, and circulation of phleboviruses other than TOSV. Noticeably, TOSV and antigenically related viruses are largely prevalent. Thus, they are not only confined to Kabylia region, but are widespread in Algeria, despite its climate diversity.