Metatranscriptomic data mining together with microfluidic card uncovered the potential pathogens and seasonal RNA viral ecology in a drinking water source.

AIMS: Despite metatranscriptomics becoming an emerging tool for pathogen surveillance, very little is known about the feasibility of this approach for understanding the fate of human-derived pathogens in drinking water sources. METHODS AND RESULTS: We conducted multiplexed microfluidic cards and metatranscriptomic sequencing of the drinking water source in a border city of North Korea in four seasons. Microfluidic card detected norovirus, hepatitis B virus (HBV), enterovirus, and Vibrio cholerae in the water. Phylogenetic analyses showed that environmental-derived sequences from norovirus GII.17, genotype C of HBV, and coxsackievirus A6 (CA6) were genetically related to the local clinical isolates. Meanwhile, metatranscriptomic assembly suggested that several bacterial pathogens, including Acinetobacter johnsonii and V. cholerae might be prevalent in the studied region. Metatranscriptomic analysis recovered 349 species-level groups with substantial viral diversity without detection of norovirus, HBV, and CA6. Seasonally distinct virus communities were also found. Specifically, 126, 73, 126, and 457 types of viruses were identified in spring, summer, autumn, and winter, respectively. The viromes were dominated by the Pisuviricota phylum, including members from Marnaviridae, Dicistroviridae, Luteoviridae, Potyviridae, Picornaviridae, Astroviridae, and Picobirnaviridae families. Further phylogenetic analyses of RNA (Ribonucleic Acid)-dependent RNA polymerase (RdRp) sequences showed a diverse set of picorna-like viruses associated with shellfish, of which several novel picorna-like viruses were also identified. Additionally, potential animal pathogens, including infectious bronchitis virus, Bat dicibavirus, Bat nodavirus, Bat picornavirus 2, infectious bursal disease virus, and Macrobrachium rosenbergii nodavirus were also identified. CONCLUSIONS: Our data illustrate the divergence between microfluidic cards and metatranscriptomics, highlighting that the combination of both methods facilitates the source tracking of human viruses in challenging settings without sufficient clinical surveillance.

Detection and Molecular Characterization of Porcine Teschoviruses in India: Identification of New Genotypes.

Porcine Teschoviruses (PTVs) are ubiquitous enteric viral pathogens that infect pigs and wild boars worldwide. PTVs have been responsible for causing the severe clinical disease (Teschen disease) to asymptomatic infections. However, to date, limited information is available on large-scale epidemiological data and molecular characterization of PTVs in several countries. In this study, we report epidemiological data on PTVs based on screening of 534 porcine fecal samples from different states of India and a RT-PCR based detection of PTVs shows a percent positivity of 8.24% (44/534). The PTV prevalence varied among different regions of the country with the highest detection rates observed in the state of Karnataka (38.1%). Phylogenetic analysis based on VP1 gene reveals the presence of PTV genotype 6 and 13 along with some unassigned novel genotypes which did not cluster with any of the established PTV genotypes (PTV 1-PTV 13). Indian PTV 6 strains are genetically closest to the Spanish strains (85.7-94.4%) whereas PTV 13 and novel genotype strains were found to be more similar to the Chinese strains (88.1-99.1%). Using recombination detection software, no Indian PTVs found to be recombinant on VP1 gene and selection pressure analysis revealed the purifying selection in the several sites of the VP1 gene of PTVs. The Bayesian analysis of Indian PTVs shows 1.16 × 10-4 substitution/site/year as the mean evolutionary rate. Further, isolation of the novel PTV strains from India and more detailed investigation much needed to know the evolutionary history of PTV strains circulating in porcine populations in India.

Structure of Human Enterovirus 70 and Its Inhibition by Capsid-Binding Compounds.

Enterovirus 70 (EV70) is a human pathogen belonging to the family Picornaviridae. EV70 is transmitted by eye secretions and causes acute hemorrhagic conjunctivitis, a serious eye disease. Despite the severity of the disease caused by EV70, its structure is unknown. Here, we present the structures of the EV70 virion, altered particle, and empty capsid determined by cryo-electron microscopy. The capsid of EV70 is composed of the subunits VP1, VP2, VP3, and VP4. The partially collapsed hydrophobic pocket located in VP1 of the EV70 virion is not occupied by a pocket factor, which is commonly present in other enteroviruses. Nevertheless, we show that the pocket can be targeted by the antiviral compounds WIN51711 and pleconaril, which block virus infection. The inhibitors prevent genome release by stabilizing EV70 particles. Knowledge of the structures of complexes of EV70 with inhibitors will enable the development of capsid-binding therapeutics against this virus. IMPORTANCE Globally distributed enterovirus 70 (EV70) causes local outbreaks of acute hemorrhagic conjunctivitis. The discharge from infected eyes enables the high-efficiency transmission of EV70 in overcrowded areas with low hygienic standards. Currently, only symptomatic treatments are available. We determined the structures of EV70 in its native form, the genome release intermediate, and the empty capsid resulting from genome release. Furthermore, we elucidated the structures of EV70 in complex with two inhibitors that block virus infection, and we describe the mechanism of their binding to the virus capsid. These results enable the development of therapeutics against EV70.

Diversity of picornaviruses detected in diarrheal samples from children in Belém, Brazilian Amazon (1982-2019).

In this investigation, fecal specimens from children with diarrhea were collected from four community studies conducted between 1982 and 2019 in Belém, Brazilian Amazon. A total of 234 samples were tested by quantitative reverse transcription polymerase chain reaction (RT-qPCR) to detect infections by picornaviruses of the Enterovirus (EV), Parechovirus (HPeV), Cosavirus (HCoSV), Kobuvirus (Aichivirus - AiV) and Salivirus (SalV) genera. The positive samples were subjected to different amplification protocols of the VP1 region of the genome, such as nested PCR or snPCR, and were subsequently genotyped by sequencing VP1 and VP3 of the viral genome. Positivity was observed in 76.5% (179/234) of the samples tested using RT-qPCR for at least one virus, and co-infection was observed in 37.4% (67/179) of the cases. EV was detected in 50.8% (119/234), HPeV in 29.9% (70/234), HCoSV in 27.3% (64/234), and AiV/SalV in 2.1% (5/234) of the specimens tested by RT-qPCR. Using nested PCR and/or snPCR techniques, the positivity rates were 94.11% (112/119) for EV, 72.85% (51/70) for HPeV, and 20.31% (13/64) for HCoSV. It was not possible to amplify the samples that were positive for AiV/SalV. Sequencing revealed 67.2% (80/119) EV, 51.4% (36/70) HPeV, and 20.31% (13/64) HCoSV. Forty-five different types of EV were found among species A, B, and C; HCoSV identified five species, including a possible recombinant strain; all HPeV were identified as belonging to species A, in two samples a possible recombination involving three different strains was verified. This study demonstrated the high circulation and diversity of different types of picornaviruses in fecal samples, including those collected more than 30 years ago. This endorsed the evaluation of important points in the epidemiology of these viruses, such as the presence of co-infection and the possibility of knowing more about these agents, considering that some were recently described; therefore, their detection in older samples can provide more data about their ancestry.

Seasonal dynamics of the wild rodent faecal virome.

Viral discovery studies in wild animals often rely on cross-sectional surveys at a single time point. As a result, our understanding of the temporal stability of wild animal viromes remains poorly resolved. While studies of single host-virus systems indicate that host and environmental factors influence seasonal virus transmission dynamics, comparable insights for whole viral communities in multiple hosts are lacking. Utilizing noninvasive faecal samples from a long-term wild rodent study, we characterized viral communities of three common European rodent species (Apodemus sylvaticus, A. flavicollis and Myodes glareolus) living in temperate woodland over a single year. Our findings indicate that a substantial fraction of the rodent virome is seasonally transient and associated with vertebrate or bacteria hosts. Further analyses of one of the most common virus families, Picornaviridae, show pronounced temporal changes in viral richness and evenness, which were associated with concurrent and up to ~3-month lags in host density, ambient temperature, rainfall and humidity, suggesting complex feedbacks from the host and environmental factors on virus transmission and shedding in seasonal habitats. Overall, this study emphasizes the importance of understanding the seasonal dynamics of wild animal viromes in order to better predict and mitigate zoonotic risks.

Insight into the Enterovirus A71: A review.

Enterovirus A71 is a major causative pathogen of hand, foot and mouth disease. It has become a global public health threat, and is especially important for infants and young children in the Asian-Pacific countries. The enterovirus A71 is a non-enveloped virus of the Picornaviridae family having a single-stranded positive-sense RNA genome of about 7.4 kb which encodes the structural and nonstructural proteins. Currently there are no US FDA-approved vaccines or antiviral therapy available against enterovirus A71 infection. Although enterovirus A71 vaccines have been licenced in China, clinically approved vaccines for widespread vaccination programs are lacking. Substantial progress has recently been achieved on understanding the structure and function of enterovirus A71 proteins together with information on the viral genetic diversity and geographic distribution. The present review is intended to provide an overview on our current understanding of the molecular biology and epidemiology of enterovirus A71 which will aid the development of vaccines, therapeutics and other control strategies so as to bolster the preparedness for future enterovirus A71 outbreaks.

Symbiotic survey of the bay scallop (Argopecten irradians) from the Gulf coast of Florida, USA.

The bay scallop Argopecten irradians supported a commercial fishery in Florida but their population declined and the fishery closed in 1994. A recreational fishery remains open along the west coast of Florida despite continued threats from overfishing and a changing environment. Disease is among those threats, as it is for bivalve fisheries globally. We examined the relationship between bay scallop population density, its symbiotic microbiome, and geographic location. We focused on three sites within the range of Florida's recreational scallop fishery: St. Joseph Bay (northern extent), offshore of the Steinhatchee River (central), and offshore of Hernando County (southern extent). The study was conducted prior to the seasonal opening of the fishery to minimize the impact of fishing on our results. We also sampled caged scallops that are used for restocking in St. Joseph Bay to assess the effect of artificially high density and confinement on the scallop pathobiome. Using a combination of traditional histological methods, molecular diagnostics, and metagenomics, a suite of 15 symbionts were identified. Among them, RNA-seq data revealed four novel + ssRNA viral genomes: three picorna-like viruses and one hepe-like virus. The DNA-seq library revealed a novel Mycoplasma species. Histological evaluation revealed that protozoan, helminth and crustacean infections were common in A. irradians. These potential pathogens add to those already known for A. irradians and underscores the risk they pose to the fishery.

First report of Mal de Rio Cuarto Virus and a picorna-like virus naturally infecting rice (Oryza sativa) in Argentina.

The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.

Anti-Glycolipid Antibody Examination in Five EAE Models and Theiler's Virus Model of Multiple Sclerosis: Detection of Anti-GM1, GM3, GM4, and Sulfatide Antibodies in Relapsing-Remitting EAE.

Anti-glycolipid antibodies have been reported to play pathogenic roles in peripheral inflammatory neuropathies, such as Guillain-Barré syndrome. On the other hand, the role in multiple sclerosis (MS), inflammatory demyelinating disease in the central nervous system (CNS), is largely unknown, although the presence of anti-glycolipid antibodies was reported to differ among MS patients with relapsing-remitting (RR), primary progressive (PP), and secondary progressive (SP) disease courses. We investigated whether the induction of anti-glycolipid antibodies could differ among experimental MS models with distinct clinical courses, depending on induction methods. Using three mouse strains, SJL/J, C57BL/6, and A.SW mice, we induced five distinct experimental autoimmune encephalomyelitis (EAE) models with myelin oligodendrocyte glycoprotein (MOG)35-55, MOG92-106, or myelin proteolipid protein (PLP)139-151, with or without an additional adjuvant curdlan injection. We also induced a viral model of MS, using Theiler's murine encephalomyelitis virus (TMEV). Each MS model had an RR, SP, PP, hyperacute, or chronic clinical course. Using the sera from the MS models, we quantified antibodies against 11 glycolipids: GM1, GM2, GM3, GM4, GD3, galactocerebroside, GD1a, GD1b, GT1b, GQ1b, and sulfatide. Among the MS models, we detected significant increases in four anti-glycolipid antibodies, GM1, GM3, GM4, and sulfatide, in PLP139-151-induced EAE with an RR disease course. We also tested cellular immune responses to the glycolipids and found CD1d-independent lymphoproliferative responses only to sulfatide with decreased interleukin (IL)-10 production. Although these results implied that anti-glycolipid antibodies might play a role in remissions or relapses in RR-EAE, their functional roles need to be determined by mechanistic experiments, such as injections of monoclonal anti-glycolipid antibodies.

Animal enteroviruses: a glimpse of a wide evolutionary landscape.

The genus Enterovirus (family Picornaviridae) contains numerous viruses, most of which have been identified in humans. Among them, the three serotypes of poliovirus, coxsackieviruses A and B, echoviruses, rhinoviruses and other enteroviruses (EVs) responsible in humans for a wide spectrum of clinical manifestations. There are also 60 identified EVs in different mammals. Some have been found in both humans and animals, demonstrating the possibility of zoonotic transmission of certain EVs. Compared to human EVs, genetic and epidemiological data about animal EVs are scarce. However, the detection of EVs in various species of mammals and their presence on all continents suggest that the number of EVs still to be discovered is very important. Some EVs found in animals have characteristics never seen in human EVs. Furthermore, the unique phylogenetic relationships observed between some animal EVs raise interesting questions about the rules that govern the evolution of these viruses. The aim of this review is to present the salient data on animal EVs and to highlight the questions they raise.

[Animal enteroviruses: a glimpse of a wide evolutionary landscape]. / Entérovirus des animaux : lumière sur l'immensité de l'espace évolutif des entérovirus.

The genus Enterovirus (family Picornaviridae) contains numerous viruses, most of which have been identified in humans. Among them, the three serotypes of poliovirus, coxsackieviruses A and B, echoviruses, rhinoviruses and other enteroviruses (EVs) responsible in humans for a wide spectrum of clinical manifestations. There are also 60 identified EVs in different mammals. Some have been found in both humans and animals, demonstrating the possibility of zoonotic transmission of certain EVs. Compared to human EVs, genetic and epidemiological data for animal EVs are scarce. However, the detection of EV in various species of mammals and their presence on all continents suggest that the number of EV still to be discovered is very important. Some EVs found in animals have characteristics never seen in human EVs. Furthermore, the unique phylogenetic relationships observed between animal EVs raise interesting questions about the rules that govern the evolution of these viruses. The aim of this review is to present the salient data on animal EVs and to highlight the questions they raise.

Antivirals blocking entry of enteroviruses and therapeutic potential.

Viruses from the genus Enterovirus (EV) of the Picornaviridae family are known to cause diseases such as hand foot and mouth disease (HFMD), respiratory diseases, encephalitis and myocarditis. The capsid of EV is an attractive target for the development of direct-acting small molecules that can interfere with viral entry. Some of the capsid binders have been evaluated in clinical trials but the majority have failed due to insufficient efficacy or unacceptable off-target effects. Furthermore, most of the capsid binders exhibited a low barrier to resistance. Alternatively, host-targeting inhibitors such as peptides derived from the capsid of EV that can recognize cellular receptors have been identified. However, the majority of these peptides displayed low anti-EV potency (µM range) as compared to the potency of small molecule compounds (nM range). Nonetheless, the development of anti-EV peptides is warranted as they may complement the small-molecules in a drug combination strategy to treat EVs. Lastly, structure-based approach to design antiviral peptides should be utilized to unearth potent anti-EV peptides.

Aphis glycines virus 1, a new bicistronic virus with two functional internal ribosome entry sites, is related to a group of unclassified viruses in the Picornavirales.

A novel picorna-like virus, provisionally named Aphis glycines virus 1 (ApGlV1) was discovered by high-throughput sequencing of soybean total RNAs and detected in suction trap-collected Aphis glycines. The ApGlV1 genome contains two large ORFs organized similar to those of dicipiviruses in the Picornaviridae where ORFs 1 and 2 encode structural and nonstructural proteins, respectively. Both ORFs are preceded by internal ribosome entry site (IRES) elements. The 5' IRES was more active in dual luciferase activity assays than the IRES in the intergenic region. The ApGlV1 genome was predicted to encode a serine protease instead of a cysteine protease and showed very low aa sequence identities to recognized members of the Picornavirales. In phylogenetic analyses based on capsid protein and RNA-dependent RNA polymerase sequences, ApGlV1 consistently clustered with a group of unclassified bicistronic picorna-like viruses discovered from arthropods and plants that may represent a novel family in the order Picornavirales.

Increase in Enterovirus D68 Infections in Young Children, United Kingdom, 2006-2016.

We determined the change in seroprevalence of enterovirus D68 (EV-D68) in the United Kingdom in age-stratified cohorts from 2006 to 2016, the period during which EV-D68 emerged as a cause of severe respiratory disease occasionally leading to paralysis. Infections were acquired primarily in infants and young children, and incidence was markedly higher in 2016.

[Rhinoviruses]. / Rhinoviren.

Human rhinoviruses (RV) belong to the Picornaviridae and are divided into three species: rhinovirus A, B and C. As causative viruses of upper airway infections (common cold), they possess enormous epidemiological and clinical importance. Furthermore, rhinoviruses are significant pathogens of acute exacerbations of chronic airway diseases such as asthma and chronic obstructive pulmonary disease. Their role as a cofactor in the development of pneumonia and their relevance in critically ill patients is still unclear and the focus of current research. Due to the unspecific clinical symptoms, diagnosis is difficult. Laboratory detection is sophisticated and a distinction between clinically relevant infection and contamination not always possible. Specific therapeutic antiviral strategies against rhinovirus infection do not exist as yet and, due to the large variety of subtypes, the development of vaccines remains a considerable challenge.

Lethal Respiratory Disease Associated with Human Rhinovirus C in Wild Chimpanzees, Uganda, 2013.

We describe a lethal respiratory outbreak among wild chimpanzees in Uganda in 2013 for which molecular and epidemiologic analyses implicate human rhinovirus C as the cause. Postmortem samples from an infant chimpanzee yielded near-complete genome sequences throughout the respiratory tract; other pathogens were absent. Epidemiologic modeling estimated the basic reproductive number (R0) for the epidemic as 1.83, consistent with the common cold in humans. Genotyping of 41 chimpanzees and examination of 24 published chimpanzee genomes from subspecies across Africa showed universal homozygosity for the cadherin-related family member 3 CDHR3-Y529 allele, which increases risk for rhinovirus C infection and asthma in human children. These results indicate that chimpanzees exhibit a species-wide genetic susceptibility to rhinovirus C and that this virus, heretofore considered a uniquely human pathogen, can cross primate species barriers and threatens wild apes. We advocate engineering interventions and prevention strategies for rhinovirus infections for both humans and wild apes.

Iterative Excretion of Human Cosaviruses from Different Genotypes Associated with Combined Immunodeficiency Disorder.

BACKGROUND: Human cosaviruses (HCoSVs) are newly discovered enteric viruses in the Picornaviridae family. They have been described in non-polio acute flaccid paralysis, diarrheal patients, and healthy individuals. They remain rarely documented in immunodeficient patients. OBJECTIVES: This study reports iterative excretion of HCoSVs in a patient with major histocompatibility complex (MHC) class II combined immunodeficiency, a relatively common primary immunodeficiency in consanguineous settings. METHODS: A total of 35 samples were collected from a patient followed for oral polio vaccine strains detection in stool samples during a 57-month period. Detection of HCoSVs in stools was performed by nested RT-PCR in the 5' noncoding region. The genotype identification and screening for recombinant strains was performed by sequencing in the VP1 and 3D genomic regions followed by phylogenetic analysis. RESULTS: The patient was infected with HCoSVs twice at a 3-year interval. The excreted viruses belonged to 2 different genotypes with 2 probable recombinant viruses. During HCoSV infections, the patient was also excreting Sabin-related polioviruses. CONCLUSIONS: This study describes excretion kinetics and genetic characteristics of HCoSVs in a patient with combined immunodeficiency due to MHC class II expression defect. The patient did not have concomitant symptoms related to the HCoSV infection.

ICTV Virus Taxonomy Profile: Picornaviridae.

The family Picornaviridae comprises small non-enveloped viruses with RNA genomes of 6.7 to 10.1 kb, and contains >30 genera and >75 species. Most of the known picornaviruses infect mammals and birds, but some have also been detected in reptiles, amphibians and fish. Many picornaviruses are important human and veterinary pathogens and may cause diseases of the central nervous system, heart, liver, skin, gastrointestinal tract or upper respiratory tract. Most picornaviruses are transmitted by the faecal-oral or respiratory routes. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Picornaviridae, which is available at www.ictv.global/report/picornaviridae.

Analysis of EV71 infection progression using triple-SILAC-based proteomics approach.

Enterovirus 71 (EV71), a member of Picornaviridae, causes severe neurological and systemic illness in children. To better understand the virus-host cell interactions, we performed a triple-SILAC-based quantitative proteomics study monitoring host cell proteome changes after EV71 infection. Based on the quantitative data for more than 4100 proteins, ∼17% of the proteins were found as significantly changed (p<0.01) at either 8 or 20 hours post infection. Five biological processes and seven protein classes showed significant differences. Functional screening of nine regulated proteins discovered the regulatory role of CHCH2, a mitochondrial protein known as a transcriptional activator for cytochrome c oxidase, in EV71 replication. Further studies showed that CHCH2 served as a negative regulator of innate immune responses. All MS data have been deposited in the ProteomeXchange with identifier PXD002483 (http://proteomecentral.proteomexchange.org/dataset/PXD002483).

Prevalence of human cosaviruses in Tunisia, North Africa.

A new picornavirus, named human Cosavirus (HCoSV) was isolated recently from stools of children with acute flaccid paralysis (AFP) and healthy children in Pakistan and Afghanistan. Since then, it was also isolated from patients from other countries. Five species are presently identified forming a new genus in the Picornaviridae family. This study reports the detection of HCoSV in stool specimens collected as part of the National Poliovirus surveillance Program in Tunisia, between 2011 and 2012, from patients with AFP and healthy individuals among their contacts. One hundred and ninety four stool samples were investigated by RT-PCR in the 5' non-coding region of the genome. A total of 64 specimens (33%) tested positive for HCoSV. HCoSV positive specimens were found in 36 cases with neurological syndromes and 28 of their healthy contacts. The highest rate of HCoSV infection (62.5%) occurred in children younger than 6 years of age. The sampling date of stool specimens suggested that HCoSV infection occurred regularly over time. Also, the sampling origin of stool specimen showed that HCoSV infection was detected in almost all the governorates of Tunisia from the North to the South of the country. This study is the first report of HCoSV prevalence in the North African region. It contributes to a better knowledge on the geographic distribution and the epidemiology of these viruses.