Limited potexvirus diversity in eastern Gulf of Mexico seagrass meadows.

Turtlegrass virus X, which infects the seagrass Thalassia testudinum, is the only potexvirus known to infect marine flowering plants. We investigated potexvirus distribution in seagrasses using a degenerate reverse transcription polymerase chain reaction (RT-PCR) assay originally designed to capture potexvirus diversity in terrestrial plants. The assay, which implements Potex-5 and Potex-2RC primers, successfully amplified a 584 nt RNA-dependent RNA polymerase (RdRp) fragment from TVX-infected seagrasses. Following validation, we screened 74 opportunistically collected, apparently healthy seagrass samples for potexviruses using this RT-PCR assay. The survey examined the host species T. testudinum, Halodule wrightii, Halophila stipulacea, Syringodium filiforme, Ruppia maritima, and Zostera marina. Potexvirus PCR products were successfully generated only from T. testudinum samples and phylogenetic analysis of sequenced PCR products revealed five distinct TVX sequence variants. Although the RT-PCR assay revealed limited potexvirus diversity in seagrasses, the expanded geographic distribution of TVX shown here emphasizes the importance of future studies to investigate T. testudinum populations across its native range and understand how the observed fine-scale genetic diversity affects host-virus interactions.

The phosphorylation of the movement protein TGBp1 regulates the accumulation of the Bamboo mosaic virus.

Phosphorylation and dephosphorylation of viral movement proteins plays a crucial role in regulating virus movement. Our study focused on investigating the movement protein TGBp1 of Bamboo mosaic virus (BaMV), which is a single-stranded positive-sense RNA virus. Specifically, we examined four potential phosphorylation sites (S15, S18, T58, and S247) within the TGBp1 protein. To study the impact of phosphorylation, we introduced amino acid substitutions at the selected sites. Alanine substitutions were used to prevent phosphorylation, while aspartate substitutions were employed to mimic phosphorylation. Our findings suggest that mimicking phosphorylation at S15, S18 and T58 of TGBp1 might be linked to silencing suppressor activities. The phosphorylated form at these sites exhibits a loss of silencing suppressor activity, leading to reduced viral accumulation in the inoculated leaves. Furthermore, mimicking phosphorylation at residues S15 and S18 could diminish viral accumulation at the single-cell level, while doing so at residue T58 could influence virus movement. However, mimicking phosphorylation at residue S247 does not appear to be relevant to both functions of TGBp1. Overall, our study provides insights into the functional significance of specific phosphorylation sites in BaMV TGBp1, illuminating the regulatory mechanisms involved in virus movement and silencing suppression.

Interaction of EXA1 and eIF4E Family Members Facilitates Potexvirus Infection in Arabidopsis thaliana.

Plant viruses depend on a number of host factors for successful infection. Deficiency of critical host factors confers recessively inherited viral resistance in plants. For example, loss of Essential for poteXvirus Accumulation 1 (EXA1) in Arabidopsis thaliana confers resistance to potexviruses. However, the molecular mechanism of how EXA1 assists potexvirus infection remains largely unknown. Previous studies reported that the salicylic acid (SA) pathway is upregulated in exa1 mutants, and EXA1 modulates hypersensitive response-related cell death during EDS1-dependent effector-triggered immunity. Here, we show that exa1-mediated viral resistance is mostly independent of SA and EDS1 pathways. We demonstrate that Arabidopsis EXA1 interacts with three members of the eukaryotic translation initiation factor 4E (eIF4E) family, eIF4E1, eIFiso4E, and novel cap-binding protein (nCBP), through the eIF4E-binding motif (4EBM). Expression of EXA1 in exa1 mutants restored infection by the potexvirus Plantago asiatica mosaic virus (PlAMV), but EXA1 with mutations in 4EBM only partially restored infection. In virus inoculation experiments using Arabidopsis knockout mutants, EXA1 promoted PlAMV infection in concert with nCBP, but the functions of eIFiso4E and nCBP in promoting PlAMV infection were redundant. By contrast, the promotion of PlAMV infection by eIF4E1 was, at least partially, EXA1 independent. Taken together, our results imply that the interaction of EXA1-eIF4E family members is essential for efficient PlAMV multiplication, although specific roles of three eIF4E family members in PlAMV infection differ. IMPORTANCE The genus Potexvirus comprises a group of plant RNA viruses, including viruses that cause serious damage to agricultural crops. We previously showed that loss of Essential for poteXvirus Accumulation 1 (EXA1) in Arabidopsis thaliana confers resistance to potexviruses. EXA1 may thus play a critical role in the success of potexvirus infection; hence, elucidation of its mechanism of action is crucial for understanding the infection process of potexviruses and for effective viral control. Previous studies reported that loss of EXA1 enhances plant immune responses, but our results indicate that this is not the primary mechanism of exa1-mediated viral resistance. Here, we show that Arabidopsis EXA1 assists infection by the potexvirus Plantago asiatica mosaic virus (PlAMV) by interacting with the eukaryotic translation initiation factor 4E family. Our results imply that EXA1 contributes to PlAMV multiplication by regulating translation.

bZIP60 and Bax inhibitor 1 contribute IRE1-dependent and independent roles to potexvirus infection.

IRE1, BI-1, and bZIP60 monitor compatible plant-potexvirus interactions though recognition of the viral TGB3 protein. This study was undertaken to elucidate the roles of three IRE1 isoforms, the bZIP60U and bZIP60S, and BI-1 roles in genetic reprogramming of cells during potexvirus infection. Experiments were performed using Arabidopsis thaliana knockout lines and Plantago asiatica mosaic virus infectious clone tagged with the green fluorescent protein gene (PlAMV-GFP). There were more PlAMV-GFP infection foci in ire1a/b, ire1c, bzip60, and bi-1 knockout than wild-type (WT) plants. Cell-to-cell movement and systemic RNA levels were greater bzip60 and bi-1 than in WT plants. Overall, these data indicate an increased susceptibility to virus infection. Transgenic overexpression of AtIRE1b or StbZIP60 in ire1a/b or bzip60 mutant background reduced virus infection foci, while StbZIP60 expression influences virus movement. Transgenic overexpression of StbZIP60 also confers endoplasmic reticulum (ER) stress resistance following tunicamycin treatment. We also show bZIP60U and TGB3 interact at the ER. This is the first demonstration of a potato bZIP transcription factor complementing genetic defects in Arabidopsis. Evidence indicates that the three IRE1 isoforms regulate the initial stages of virus replication and gene expression, while bZIP60 and BI-1 contribute separately to virus cell-to-cell and systemic movement.

Development of novel species-specific and genus-specific primers for the detection of Babaco Mosaic Virus (BabMV).

Babaco is a hybrid cultivar native to the Andean region of Ecuador and Colombia, commercially attractive for its fruit. Babaco production in Ecuador faces losses from plant pathogens like babaco mosaic virus (BabMV), an RNA virus that causes chlorosis, leaf mottling, and deformation. Phylogenetic studies link BabMV to papaya mosaic virus (PapMV), alternanthera mosaic virus, and senna mosaic virus. To address this threat, we developed novel species-specific primers to detect BabMV targeting a 165 bp region of the coat protein (CP). Genus-specific primers were designed to validate the species-specific primers and attest their ability to discriminate between BabMV and its closest relatives. These primers targeted a 175 bp fragment of the CP region. The most effective sets of primers were chosen for reverse transcription polymerase chain reaction (RT-PCR) and SYBR® Green-based quantitative reverse transcription polymerase chain reaction (RT-qPCR) in symptomatic and asymptomatic babaco plants. Among 28 plants tested, 25 were positive and 3 were negative for BabMV using species-specific and genus-specific primers in RT-PCR and RT-qPCR, while the PapMV positive control was detected with the genus-specific primers and was negative for the species-specific primers. These primers represent a valuable molecular tool for detecting BabMV, potentially enhancing crop management.

Occurrence, Distribution, and Population Structure of Schlumbergera Virus X in Dragon Fruit in Ecuador.

The occurrence of Schlumbergera virus X (SchVX) in commercial dragon fruit fields in three provinces of Ecuador has been identified in this study. The virus was found in symptomatic and asymptomatic cladodes of the two major species (Hylocereus undatus and H. megalanthus) cultivated in the country. Symptoms in H. undatus included irregular and ring-shaped chlorotic spots that coalesce into large chlorotic patches along the cladodes, whereas small chlorotic spot symptoms on the cladodes were observed in H. megalanthus. Phylogenetic inferences based on 27 partial nucleotide sequences of the RNA-dependent RNA polymerase (RdRp) and three whole genome comparisons showed that Ecuadorean isolates from H. undatus and H. megalanthus share a most recent ancestor with isolates from Spain and Portugal. In addition, an SchVX isolate with a distinct genomic lineage was found in symptomatic H. polyrhizus plants from a single location, suggesting two independent virus introductions into the country.

First Report of Pitaya Virus X Infecting Lophocereus schottii f. mieckleyanus (Thin-Stemmed Totem Pole Cactus) in the United States.

Lophocereus is a genus of three species of columnar cacti native to Arizona and Mexico (Lodi, 2015). These cacti produce several tall, ascending, columnar stems that branch at the base in a candelabra-like arrangement. The most common species, L. schottii is known as the senita cactus. Several unusual knobby-stemmed spineless forms of senita cactus have been found in nature in Baja California, Mexico, which are collectively known as totem pole cacti. The thin-stemmed totem pole cactus, L. schottii f. mieckleyanus is an important part of landscapes in southern Arizona. Cacti are clonally propagated which makes viral infections of economic importance in the ornamental/nursery industry. In February 2023, virus-like symptoms, such as mosaic and chlorotic spots were observed on the stems of L. schottii f. mieckleyanus grown in a nursery in Phoenix, AZ, USA. Total RNA was extracted from two symptomatic cacti (YPHC-61 A & B) following the protocol by Tzanetakis et al. (2007), and cDNA was synthesized using the Superscript IV Reverse Transcriptase (Invitrogen, Vilnius, Lithuania). Reverse transcription polymerase chain reaction (RT-PCR) performed with cactus virus X specific primers (Kim et al. 2016) targeting the coat protein (CP) gene failed to generate any amplicon, while potexvirus-replicase primers, Potex 2RC and Potex 5 (van der Vlugt and Berendsen 2002) targeting RNA-dependent RNA polymerase (RdRp) gene amplified an expected amplicon of ~580 bp from both the samples. One of the amplicons was Sanger sequenced and showed 90.7% nucleotide (nt) identity with pitaya virus X (PiVX) in the GenBank (MN982522). Sequence was submitted in the GenBank under the accession number OR425049. PiVX is a new species of the genus Potexvirus and is named after its origin from pitaya (Hylocereus spp.). Further, RT-PCR was conducted with PiVX-specific primers, CP 110F/CP 604R targeting CP gene (Bae and Park 2022) and RdRp gene (RdRp F 5' GCGTGGGCCCTGGAAAA-3'/RdRp R 5' CTAAGATTCATCAATTCACCTCTCC-3') (this study). Amplicons of ~500 and 1100 bp were obtained using primers, CP 110F/CP 604R and RdRp F/RdRp R, respectively. A BLAST search revealed 90.5% nt identity to PiVX CP sequences (OM802135 and OM802134) and 87.3% nt identity to RdRp sequences (MN982523 and LC654699) in the GenBank. Sequences of isolates YPHC-61A and YPHC-61B were submitted in the GenBank under accession numbers, OQ915350 and PP182358 (CP gene) and OQ915351 and PP209539 (RdRp gene). Phylogenetic analysis based on the combined sequence datasets of CP and RdRp genes also grouped YPHC-61A and YPHC-61B with PiVX isolates and separated from other potexviruses species. For a bioassay of the virus, sap extract from symptomatic cactus was mechanically inoculated onto indicator plant species, i.e., beans, alfalfa, and melon. Ten days post- inoculation, chlorotic lesions were observed on beans and alfalfa plants, while melon and mock-inoculated plants did not show any symptoms. Similarly, L. schottii f. mieckleyanus plants grafted with infected cactus showed chlorotic spots after 30 days post grafting. Mechanically inoculated beans, alfalfa, and cactus plants were found to be positive for PiVX based on RT-PCR and Sanger sequencing. PiVX has earlier been detected on Notocactus leninghausii f. cristatus (Park et al. 2018) and dragon fruit (Selenicereus undatus) plants in South Korea (Bae and Park 2022). To our knowledge, this is the first report of PiVX on L. schottii f. mieckleyanus in the United States and worldwide.

Engineering aphid transmission of foxtail mosaic virus in the presence of potyvirus helper component proteinase through coat protein modifications.

Biotechnologies that use plant viruses as plant enhancement tools have shown great potential to flexibly engineer crop traits, but field applications of these technologies are still limited by efficient dissemination methods. Potyviruses can be rapidly inoculated into plants by aphid vectors due to the presence of the potyviral helper component proteinase (HC-Pro), which binds to the DAG motif of the coat protein (CP) of the virion. Previously it was determined that a naturally occurring DAG motif in the non-aphid-transmissible potexvirus, potato aucuba mosaic virus (PAMV), is functional when a potyviral HC-Pro is provided to aphids in plants. The DAG motif of PAMV was successfully transferred to the CP of another non-aphid-transmissible potexvirus, potato virus X, to convey aphid transmission capabilities in the presence of HC-Pro. Here, we demonstrate that DAG-containing segments of the CP from two different potyviruses (sugarcane mosaic virus and turnip mosaic virus), and from the previously used potexvirus, PAMV, can make the potexvirus, foxtail mosaic virus (FoMV), aphid-transmissible when fused with the FoMV CP. We show that DAG-containing FoMVs are transmissible by aphids that have prior access to HC-Pro through potyvirus-infected plants or ectopic expression of HC-Pro. The transmission efficiency of the DAG-containing FoMVs varied from less than 10 % to over 70 % depending on the length and composition of the surrounding amino acid sequences of the DAG-containing segment, as well as due to the recipient plant species. Finally, we show that the engineered aphid-transmissible FoMV is still functional as a plant enhancement resource, as endogenous host target genes were silenced in FoMV-infected plants after aphid transmission. These results suggest that aphid transmission could be engineered into non-aphid-transmissible plant enhancement viral resources to facilitate their field applications.

Short 5' Untranslated Region Enables Optimal Translation of Plant Virus Tricistronic RNA via Leaky Scanning.

Regardless of the general model of translation in eukaryotic cells, a number of studies suggested that many mRNAs encode multiple proteins. Leaky scanning, which supplies ribosomes to downstream open reading frames (ORFs) by readthrough of upstream ORFs, has great potential to translate polycistronic mRNAs. However, the mRNA elements controlling leaky scanning and their biological relevance have rarely been elucidated, with exceptions such as the Kozak sequence. Here, we have analyzed the strategy of a plant RNA virus to translate three movement proteins from a single RNA molecule through leaky scanning. The in planta and in vitro results indicate thatthe significantly shorter 5' untranslated region (UTR) of the most upstream ORF promotes leaky scanning, potentially fine-tuning the translation efficiency of the three proteins in a single RNA molecule to optimize viral propagation. Our results suggest that the remarkably short length of the leader sequence, like the Kozak sequence, is a translational regulatory element with a biologically important role, as previous studies have shown biochemically. IMPORTANCEPotexvirus, a group of plant viruses, infect a variety of crops, including cultivated crops. It has been thought that the three transition proteins that are essential for the cell-to-cell transfer of potexviruses are translated from two subgenomic RNAs, sgRNA1 and sgRNA2. However, sgRNA2 has not been clearly detected. In this study, we have shown that sgRNA1, but not sgRNA2, is the major translation template for the three movement proteins. In addition, we determined the transcription start site of sgRNA1 in flexiviruses and found that the efficiency of leaky scanning caused by the short 5' UTR of sgRNA1, a widely conserved feature, regulates the translation of the three movement proteins. When we tested the infection of viruses with mutations introduced into the length of the 5' UTR, we found that the movement efficiency of the virus was affected. Our results provide important additional information on the protein translation strategy of flexiviruses, including Potexvirus, and provide a basis for research on their control as well as the need to reevaluate the short 5' UTR as a translational regulatory element with an important role in vivo.

Tomato SlGSTU38 interacts with the PepMV coat protein and promotes viral infection.

Pepino mosaic virus (PepMV) is pandemic in tomato crops, causing important economic losses world-wide. No PepMV-resistant varieties have been developed yet. Identification of host factors interacting with PepMV proteins is a promising source of genetic targets to develop PepMV-resistant varieties. The interaction between the PepMV coat protein (CP) and the tomato glutathione S-transferase (GST) SlGSTU38 was identified in a yeast two-hybrid (Y2H) screening and validated by directed Y2H and co-immunoprecipitation assays. SlGSTU38-knocked-out Micro-Tom plants (gstu38) generated by the CRISPR/Cas9 technology together with live-cell imaging were used to understand the role of SlGSTU38 during infection. The transcriptomes of healthy and PepMV-infected wild-type (WT) and gstu38 plants were profiled by RNA-seq analysis. SlGSTU38 functions as a PepMV-specific susceptibility factor in a cell-autonomous manner and relocalizes to the virus replication complexes during infection. Besides, knocking out SlGSTU38 triggers reactive oxygen species accumulation in leaves and the deregulation of stress-responsive genes. SlGSTU38 may play a dual role: On the one hand, SlGSTU38 may exert a proviral function depending on its specific interaction with the PepMV CP; and on the other hand, SlGSTU38 may delay PepMV-infection sensing by participating in the redox intracellular homeostasis in a nonspecific manner.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Identification of a Proline-Kinked Amphipathic α-Helix Downstream from the Methyltransferase Domain of a Potexvirus Replicase and Its Role in Virus Replication and Perinuclear Complex Formation.

Characterized positive-strand RNA viruses replicate in association with intracellular membranes. Regarding viruses in the genus Potexvirus, the mechanism by which their RNA-dependent RNA polymerase (replicase) associates with membranes is understudied. Here, by membrane flotation analyses of the replicase of Plantago asiatica mosaic potexvirus (PlAMV), we identified a region in the methyltransferase (MET) domain as a membrane association determinant. An amphipathic α-helix was predicted downstream from the core region of the MET domain, and hydrophobic amino acid residues were conserved in the helical sequences in replicases of other potexviruses. Nuclear magnetic resonance (NMR) analysis confirmed the amphipathic α-helical configuration and unveiled a kink caused by a highly conserved proline residue in the α-helix. Substitution of this proline residue and other hydrophobic and charged residues in the amphipathic α-helix abolished PlAMV replication. Ectopic expression of a green fluorescent protein (GFP) fusion with the entire MET domain resulted in the formation of a large perinuclear complex, where virus replicase and RNA colocated during virus infection. Except for the proline substitution, the amino acid substitutions in the α-helix that abolished virus replication also prevented the formation of the large perinuclear complex by the respective GFP-MET fusion. Small intracellular punctate structures were observed for all GFP-MET fusions, and in vitro high-molecular-weight complexes were formed by both replication-competent and -incompetent viral replicons and thus were not sufficient for replication competence. We discuss the roles of the potexvirus-specific, proline-kinked amphipathic helical structure in virus replication and intracellular large complex and punctate structure formation. IMPORTANCE RNA viruses characteristically associate with intracellular membranes during replication. Although virus replicases are assumed to possess membrane-targeting properties, their membrane association domains generally remain unidentified or poorly characterized. Here, we identified a proline-kinked amphipathic α-helix structure downstream from the methyltransferase core domain of PlAMV replicase as a membrane association determinant. This helical sequence, which includes the proline residue, was conserved among potexviruses and related viruses in the order Tymovirales. Substitution of the proline residue, but not the other residues necessary for replication, allowed formation of a large perinuclear complex within cells resembling those formed by PlAMV replicase and RNA during virus replication. Our results demonstrate the role of the amphipathic α-helix in PlAMV replicase in a perinuclear complex formation and virus replication and that perinuclear complex formation by the replicase alone will not necessarily indicate successful virus replication.

First Report of the Association of Zygocactus virus X with Dragon Fruit (Hylocereus spp.) plants from Telangana, India.

Dragon fruit (Hylocereus spp.) a member of the family Cactaceae, is widely cultivated throughout the world, includingspan style="font-family:'Times New Roman'; letter-spacing:0.05pt; color:#333333"> India. During 2020-2021 crop growing season, mosaic symptoms were observed on the cladodes of dragon fruit plants (Purple Pink cultivar: 1-2% disease incidence) grown at a farmer's field of Telangana, India (Fig. S1 a). The symptomatic cladodes (n= 4), observed under leaf-dip electron microscopy (Zuchmaan and Zellnig, 2009) at Indian Agricultural Research Institute, New Delhi, revealed the presence of flexuous rod- shaped virus-like particles (Fig S1 b). Virus particles were of 580 x 13 nm size, corresponding to the genus Potexvirus. For further confirmation, the total RNA isolated from symptomatic cladodes using a NucleoSpin RNA Plant Mini kit (Macherey-Nagel). Subsequently, a reverse transcription polymerase chain reaction (RT-PCR) was performed using the PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio). The cDNA was further amplified with the primers specific to coat protein (CP) gene of four different species of the genus Potexvirus known to infect members of Cactaceae family. Four sets of primers were used for detection, viz., Cactus virus X (CVX) (F, 5'-ATGTCTACTACTGGAGTCCA-3'; R, 5'-CTACTCAGGGCCTGGGAGAA-3'); Pitaya virus X (PiVX) (F, 5'-ATGGCTACTCAAACAGCACAA-3'; R, 5'-CTACTCTGGGGAGGGAAG-3'); Schlumbergera virus X (SchVX) (F, 5'-ATGTCGACCACTCCATCTTC-3'; R, 5'-TTATTCAGGGGATGGTAGTA-3') and Zygocactus virus X (ZyVX) (F, 5'-ATGTCTAACACTGCAGGAGT-3'; R, TCATTC GGGACCCGGTAGGA-3') (Duarte et al., 2008; Janssen et al., 2021; Parameswari et al., 2021), by following the PCR profile (Park et al., 2018). The species-specific primers of CVX, PiVX and SchVX did not amplify any amplicon, whereas the primers specific to ZyVX at nucleotide position 5841-6521 from complete CP gene have resulted in amplification of expected size (~680 base pairs) from all the samples. The gel-purified RT-PCR products were cloned into a pDrive cloning vector (Qiagen, Germany) and sequenced bi-directionally using Sanger sequencing. The resultant sequences (681 nt) of the CP gene showed 98% (nucleotide) and 100% (amino acid) sequence similarity with the CP gene sequence (Accession No: KY581590) of ZyVX. Hence, one representative sequence was deposited to the NCBI GenBank database as ZyVX-DPC isolate (Accession number- OK415019). The Neighbour Joining Phylogenetic Tree constructed using MEGA6 software (Tamura et al. 2013) showed grouping of Indian ZyVX-DPC isolate with the previously reported ZyVX isolates from Korea, Taiwan, China and Germany (Fig. S1c). These results confirmed the association of ZyVX with the symptomatic cladodes of dragon fruit plants collected from Telangana, India. Earlier studies revealed that ZyVX is a member of the genus Potexvirus known to infect dragon fruit plants from Brazil and China (Duarte et al., 2008). In India until now, anthracnose disease (Colletotrichum siamense) and CVX from Hylocereus spp. were reported (Abirami et al., 2019; Parameswari et al., 2021). To the best of our knowledge, this is the first report of ZyVX infection on dragon fruit in India. The draon fruit, being vegetatively propagated and with increasing cultivable area in India (Abirami et al, 2019), the present study gains significance. Further studies on mode of virus transmission, estimation of crop yield losses, host range studies and finding out source of resistance are essential.

Development and optimization of a pepino mosaic virus-based vector for rapid expression of heterologous proteins in plants.

Plant-virus-derived vectors are versatile tools with multiple applications in agricultural and medical biotechnology. In this study, we developed pepino mosaic virus (PepMV) (family Alphaflexiviridae; genus Potexvirus) into a vector for heterologous protein expression in plants. PepMV was initially cloned in a step-wise manner, fully sequenced and the full-length infectious clone was tested for infectivity in Nicotiana benthamiana. Initial infectious clones resulted in poor replication of PepMV and lack of systemic movement. Mutations in the viral sequence affected systemic infection. Two suspected mutations were altered to restore systemic infectivity. PepMV infection was apparent as early as 4 days post agroinfiltration (dpa) inoculation in N. benthamiana. A multiple cloning site was inserted into the PepMV genome for introduction and expression of foreign genes. Several modifications to the wild-type vector were made, such as a replacing the native subgenomic promoter (SGP) with a heterologous SGP, and introduction of translational enhancers and terminators, to improve heterologous expression of the foreign gene-of-interest. GFP was used as a reporter for monitoring virus infection and protein production. Strong GFP expression was observed as early as 4 dpa with a translational enhancer. The PepMV-based vector produces rapid expression of the foreign gene in comparison to two other potexvirus-based vectors. GFP production was monitored over time and optimal protein production was recorded between 5 and 7 dpa. GFP protein levels reached up to 4% and decreased to 0.5% total soluble protein at 7 and 14 dpa, respectively. Future studies will evaluate this virus-based vector for large-scale production of pharmaceutical compounds. KEY POINTS: • A pepino mosaic virus isolate was developed into a plant-based expression vector. • Expression levels of the heterologous protein were comparable or exceeded previously developed viral vectors. • Protein levels in plants were highest between 5 and 7 days and decreased gradually.

Transcriptional Regulatory Networks Associate with Early Stages of Potato Virus X Infection of Solanum tuberosum.

Potato virus X (PVX) belongs to genus Potexvirus. This study characterizes the cellular transcriptome responses to PVX infection in Russet potato at 2 and 3 days post infection (dpi). Among the 1242 differentially expressed genes (DEGs), 268 genes were upregulated, and 37 genes were downregulated at 2 dpi while 677 genes were upregulated, and 265 genes were downregulated at 3 dpi. DEGs related to signal transduction, stress response, and redox processes. Key stress related transcription factors were identified. Twenty-five pathogen resistance gene analogs linked to effector triggered immunity or pathogen-associated molecular pattern (PAMP)-triggered immunity were identified. Comparative analysis with Arabidopsis unfolded protein response (UPR) induced DEGs revealed genes associated with UPR and plasmodesmata transport that are likely needed to establish infection. In conclusion, this study provides an insight on major transcriptional regulatory networked involved in early response to PVX infection and establishment.

Proliferating Cell Nuclear Antigen Suppresses RNA Replication of Bamboo Mosaic Virus through an Interaction with the Viral Genome.

Bamboo mosaic virus (BaMV), a member of the Potexvirus genus, has a monopartite positive-strand RNA genome on which five open reading frames (ORFs) are organized. ORF1 encodes a 155-kDa nonstructural protein (REPBaMV) that plays a core function in replication/transcription of the viral genome. To find out cellular factors modulating the replication efficiency of BaMV, a putative REPBaMV-associated protein complex from Nicotiana benthamiana leaf was isolated on an SDS-PAGE gel, and a few proteins preferentially associated with REPBaMV were identified by tandem mass spectrometry. Among them, proliferating cell nuclear antigen (PCNA) was particularly noted. Overexpression of PCNA strongly suppressed the accumulation of BaMV coat protein and RNAs in leaf protoplasts. In addition, PCNA exhibited an inhibitory effect on BaMV polymerase activity. A pulldown assay confirmed a binding capability of PCNA toward BaMV genomic RNA. Mutations at D41 or F114 residues, which are critical for PCNA to function in nuclear DNA replication and repair, disabled PCNA from binding BaMV genomic RNA as well as suppressing BaMV replication. This suggests that PCNA bound to the viral RNA may interfere with the formation of a potent replication complex or block the replication process. Interestingly, BaMV is almost invisible in the newly emerging leaves where PCNA is actively expressed. Accordingly, PCNA is probably one of the factors restricting the proliferation of BaMV in young leaves. Foxtail mosaic virus and Potato virus X were also suppressed by PCNA in the protoplast experiment, suggesting a general inhibitory effect of PCNA on the replication of potexviruses.IMPORTANCE Knowing the dynamic interplay between plant RNA viruses and their host is a basic step toward first understanding how the viruses survive the plant defense mechanisms and second gaining knowledge of pathogenic control in the field. This study found that plant proliferating cell nuclear antigen (PCNA) imposes a strong inhibition on the replication of several potexviruses, including Bamboo mosaic virus, Foxtail mosaic virus, and Potato virus X Based on the tests on Bamboo mosaic virus, PCNA is able to bind the viral genomic RNA, and this binding is a prerequisite for the protein to suppress the virus replication. This study also suggests that PCNA plays an important role in restricting the proliferation of potexviruses in the rapidly dividing tissues of plants.

[A Recombinant Rotavirus Antigen Based on the Coat Protein of Alternanthera Mosaic Virus].

Thanks to their strong immunostimulating properties and safety for humans, plant viruses represent an appropriate basis for the design of novel vaccines. The coat protein of Alternanthera mosaic virus can form virus-like particles that are stable under physiological conditions and have adjuvant properties. This work presents a recombinant human rotavirus A antigen based on the epitope of rotavirus structural protein VP6, using Alternanthera mosaic virus coat protein as a carrier. An expression vector containing the gene of Alternanthera mosaic virus (MU strain) coat protein fused to the epitope of rotavirus protein VP6 was designed. Immunoblot analysis showed that the chimeric protein was effectively recognized by commercial polyclonal antibodies to rotavirus and therefore is a suitable candidate for development of a vaccine prototype. Interaction of the chimeric recombinant protein with the native coat protein of Alternanthera mosaic virus and its RNA resulted in the formation of ribonucleoprotein complexes that were recognized by anti-rotavirus antibodies.

EXA1, a GYF domain protein, is responsible for loss-of-susceptibility to plantago asiatica mosaic virus in Arabidopsis thaliana.

One of the plant host resistance machineries to viruses is attributed to recessive alleles of genes encoding critical host factors for virus infection. This type of resistance, also referred to as recessive resistance, is useful for revealing plant-virus interactions and for breeding antivirus resistance in crop plants. Therefore, it is important to identify a novel host factor responsible for robust recessive resistance to plant viruses. Here, we identified a mutant from an ethylmethane sulfonate (EMS)-mutagenized Arabidopsis population which confers resistance to plantago asiatica mosaic virus (PlAMV, genus Potexvirus). Based on map-based cloning and single nucleotide polymorphism analysis, we identified a premature termination codon in a functionally unknown gene containing a GYF domain, which binds to proline-rich sequences in eukaryotes. Complementation analyses and robust resistance to PlAMV in a T-DNA mutant demonstrated that this gene, named Essential for poteXvirus Accumulation 1 (EXA1), is indispensable for PlAMV infection. EXA1 contains a GYF domain and a conserved motif for interaction with eukaryotic translation initiation factor 4E (eIF4E), and is highly conserved among monocot and dicot species. Analysis using qRT-PCR and immunoblotting revealed that EXA1 was expressed in all tissues, and was not transcriptionally responsive to PlAMV infection in Arabidopsis plants. Moreover, accumulation of PlAMV and a PlAMV-derived replicon was drastically diminished in the initially infected cells by the EXA1 deficiency. Accumulation of two other potexviruses also decreased in exa1-1 mutant plants. Our results provided a functional annotation to GYF domain-containing proteins by revealing the function of the highly conserved EXA1 gene in plant-virus interactions.

First report of Hosta virus X infecting hosta plants in Ukraine.

In September 2011, the leaf samples of hosta cultivar 'Sum and substance' were collected from the collection of Gryshko' National Botanical Garden in Kyiv. The leaves showed dark green streaking and puckering along the leaf veins. Transmission electron microscopy revealed the presence of filamentous viral particles 13 nm in diameter and 470-580 nm in length. Reverse transcription PCR (RT-PCR) analysis confirmed the presence of Hosta virus X (HVX). The sequencing of the complete genome revealed 99% identity to HVX-37 and 97.5% identity to HVX-Kr. Notably, ORF4 initiation codon presented a non-conventional start codon (UUG) like it was previously identified in HVX-37.

Pepino mosaic virus RNA-Dependent RNA Polymerase POL Domain Is a Hypersensitive Response-Like Elicitor Shared by Necrotic and Mild Isolates.

Pepino mosaic virus (PepMV) is an emerging pathogen that represents a serious threat to tomato production worldwide. PepMV-induced diseases manifest with a wide range of symptoms, including systemic necrosis. Our results showed that PepMV accumulation depends on the virus isolate, tomato cultivar, and environmental conditions, and associates with the development of necrosis. Substitution of lysine for glutamic acid at position 67 in the triple gene block 3 (TGB3) protein, previously described as a necrosis determinant, led to increased virus accumulation and was necessary but not sufficient to induce systemic necrosis. Systemic necrosis both in tomato and Nicotiana benthamiana shared hypersensitive response (HR) features, allowing the assessment of the role of different genomic regions on necrosis induction. Overexpression of both TGB3 and the polymerase domain (POL) of the RNA-dependent RNA polymerase (RdRp) resulted in necrosis, although only local expression of POL triggered HR-like symptoms. Our results also indicated that the necrosis-eliciting activity of POL resides in its highly conserved "palm" domain, and that necrosis was jasmonic acid-dependent but not salicylic acid-dependent. Altogether, our data suggest that the RdRp-POL domain plays an important role in PepMV necrosis induction, with necrosis development depending on the virus accumulation level, which can be modulated by the nature of TGB3, host genotype and environmental conditions.