RESUMO
BACKGROUND: New sequencing technologies have opened the way to the discovery and the characterization of pathogenic viruses in clinical samples. However, the use of these new methods can require an amplification of viral RNA prior to the sequencing. Among all the available methods, the procedure based on the use of Phi29 polymerase produces a huge amount of amplified DNA. However, its major disadvantage is to generate a large number of chimeric sequences which can affect the assembly step. The pre-process method proposed in this study strongly limits the negative impact of chimeric reads in order to obtain the full-length of viral genomes. FINDINGS: Three different assembly softwares (ABySS, Ray and SPAdes) were tested for their ability to correctly assemble the full-length of viral genomes. Although in all cases, our pre-processed method improved genome assembly, only its combination with the use of SPAdes allowed us to obtain the full-length of the viral genomes tested in one contig. CONCLUSIONS: The proposed pipeline is able to overcome drawbacks due to the generation of chimeric reads during the amplification of viral RNA which considerably improves the assembling of full-length viral genomes.
Assuntos
RNA Polimerases Dirigidas por DNA/genética , Genoma Viral , Técnicas de Amplificação de Ácido Nucleico/métodos , RNA Viral , Análise de Sequência de RNA/métodos , Montagem de Vírus , Alphavirus/genética , República Centro-Africana , Biologia Computacional , Mapeamento de Sequências Contíguas , Mengovirus/genética , Valores de Referência , Reprodutibilidade dos Testes , SoftwareRESUMO
During the infection of a host cell by an infectious agent, a series of gene expression changes occurs as a consequence of host-pathogen interactions. Unraveling this complex interplay is the key for understanding of microbial virulence and host response pathways, thus providing the basis for new molecular insights into the mechanisms of pathogenesis and the corresponding immune response. Dual RNA sequencing (dual RNA-seq) has been developed to simultaneously determine pathogen and host transcriptomes enabling both differential and coexpression analyses between the two partners as well as genome characterization in the case of RNA viruses. Here, we provide a detailed laboratory protocol and bioinformatics analysis guidelines for dual RNA-seq experiments focusing on - but not restricted to - measles virus (MeV) as a pathogen of interest. The application of dual RNA-seq technologies in MeV-infected patients can potentially provide valuable information on the structure of the viral RNA genome and on cellular innate immune responses and drive the discovery of new targets for antiviral therapy.
Assuntos
Genoma Viral , Interações Hospedeiro-Patógeno , Vírus do Sarampo , Sarampo , RNA Viral , Humanos , Sarampo/virologia , Sarampo/imunologia , Sarampo/genética , Vírus do Sarampo/genética , Vírus do Sarampo/patogenicidade , RNA Viral/genética , Interações Hospedeiro-Patógeno/genética , Interações Hospedeiro-Patógeno/imunologia , Biologia Computacional/métodos , Análise de Sequência de RNA/métodos , RNA-Seq/métodos , Transcriptoma , Perfilação da Expressão Gênica/métodos , Sequenciamento de Nucleotídeos em Larga Escala/métodosRESUMO
Infections by non-segmented negative-strand RNA viruses (NNSV) are widely thought to entail gradient gene expression from the well-established existence of a single promoter at the 3' end of the viral genome and the assumption of constant transcriptional attenuation between genes. But multiple recent studies show viral mRNA levels in infections by respiratory syncytial virus (RSV), a major human pathogen and member of NNSV, that are inconsistent with a simple gradient. Here we integrate known and newly predicted phenomena into a biophysically reasonable model of NNSV transcription. Our model succeeds in capturing published observations of respiratory syncytial virus and vesicular stomatitis virus (VSV) mRNA levels. We therefore propose a novel understanding of NNSV transcription based on the possibility of ejective polymerase-polymerase collisions and, in the case of RSV, biased polymerase diffusion.
RESUMO
Virus infections of mammalian and animal cells consist of a series of events. As intracellular parasites, viruses rely on the use of host cellular machinery. Through the use of cell culture and molecular approaches over the past decade, our knowledge of the biology of aquatic viruses has grown exponentially. The increase in aquaculture operations worldwide has provided new approaches for the transmission of aquatic viruses that include RNA and DNA viruses. Therefore, the struggle between the virus and the host for control of the cell's death machinery is crucial for survival. Viruses are obligatory intracellular parasites and, as such, must modulate apoptotic pathways to control the lifespan of their host to complete their replication cycle. This paper updates the discussion on the detailed mechanisms of action that various aquatic viruses use to induce cell death pathways in the host, such as Bad-mediated, mitochondria-mediated, ROS-mediated and Fas-mediated cell death circuits. Understanding how viruses exploit the apoptotic pathways of their hosts may provide great opportunities for the development of future potential therapeutic strategies and pathogenic insights into different aquatic viral diseases.
Assuntos
Apoptose , Organismos Aquáticos/virologia , Viroses/veterinária , Fenômenos Fisiológicos Virais , Animais , Viroses/genética , Viroses/fisiopatologia , Viroses/virologia , Vírus/genética , Vírus/isolamento & purificaçãoRESUMO
BACKGROUND: New sequencing technologies have opened the way to the discovery and the characterization of pathogenic viruses in clinical samples. However, the use of these new methods can require an amplification of viral RNA prior to the sequencing. Among all the available methods, the procedure based on the use of Phi29 polymerase produces a huge amount of amplified DNA. However, its major disadvantage is to generate a large number of chimeric sequences which can affect the assembly step. The pre-process method proposed in this study strongly limits the negative impact of chimeric reads in order to obtain the full-length of viral genomes. FINDINGS: Three different assembly softwares (ABySS, Ray and SPAdes) were tested for their ability to correctly assemble the full-length of viral genomes. Although in all cases, our pre-processed method improved genome assembly, only its combination with the use of SPAdes allowed us to obtain the full-length of the viral genomes tested in one contig. CONCLUSIONS: The proposed pipeline is able to overcome drawbacks due to the generation of chimeric reads during the amplification of viral RNA which considerably improves the assembling of full-length viral genomes.
Assuntos
RNA Polimerases Dirigidas por DNA/genética , RNA Viral , Genoma Viral , Análise de Sequência de RNA/métodos , Montagem de Vírus , Técnicas de Amplificação de Ácido Nucleico/métodos , Valores de Referência , Software , República Centro-Africana , Reprodutibilidade dos Testes , Alphavirus/genética , Mengovirus/genética , Biologia Computacional , Mapeamento de Sequências ContíguasRESUMO
With the identification of a novel coronavirus associated with the severe acute respiratory syndrome (SARS), computational analysis of its RNA genome sequence is expected to give useful clues to help elucidate the origin, evolution, and pathogenicity of the virus. In this paper, we study the collective counts of palindromes in the SARS genome along with all the completely sequenced coronaviruses. Based on a Markov-chain model for the genome sequence, the mean and standard deviation for the number of palindromes at or above a given length are derived. These theoretical results are complemented by extensive simulations to provide empirical estimates. Using a z score obtained from these mathematical and empirical means and standard deviations, we have observed that palindromes of length four are significantly underrepresented in all the coronaviruses in our data set. In contrast, length-six palindromes are significantly underrepresented only in the SARS coronavirus. Two other features are unique to the SARS sequence. First, there is a length-22 palindrome TCTTTAACAAGCTTGTTAAAGA spanning positions 25962-25983. Second, there are two repeating length-12 palindromes TTATAATTATAA spanning positions 22712-22723 and 22796-22807. Some further investigations into possible biological implications of these palindrome features are proposed.