Scribble scrambles parathyroid hormone receptor interactions to regulate phosphate and vitamin D homeostasis.

G protein-coupled receptors, including PTHR, are pivotal for controlling metabolic processes ranging from serum phosphate and vitamin D levels to glucose uptake, and cytoplasmic interactors may modulate their signaling, trafficking, and function. We now show that direct interaction with Scribble, a cell polarity-regulating adaptor protein, modulates PTHR activity. Scribble is a crucial regulator for establishing and developing tissue architecture, and its dysregulation is involved in various disease conditions, including tumor expansion and viral infections. Scribble co-localizes with PTHR at basal and lateral surfaces in polarized cells. Using X-ray crystallography, we show that colocalization is mediated by engaging a short sequence motif at the PTHR C-terminus using Scribble PDZ1 and PDZ3 domain, with binding affinities of 31.7 and 13.4 µM, respectively. Since PTHR controls metabolic functions by actions on renal proximal tubules, we engineered mice to selectively knockout Scribble in proximal tubules. The loss of Scribble impacted serum phosphate and vitamin D levels and caused significant plasma phosphate elevation and increased aggregate vitamin D3 levels, whereas blood glucose levels remained unchanged. Collectively these results identify Scribble as a vital regulator of PTHR-mediated signaling and function. Our findings reveal an unexpected link between renal metabolism and cell polarity signaling.

A Frameshift Variant of GluN2A Identified in an Epilepsy Patient Results in NMDA Receptor Mistargeting.

N-methyl-D-aspartate receptors (NMDARs) are crucial for neuronal development and synaptic plasticity. Dysfunction of NMDARs is associated with multiple neurodevelopmental disorders, including epilepsy, autism spectrum disorder, and intellectual disability. Understanding the impact of genetic variants of NMDAR subunits can shed light on the mechanisms of disease. Here, we characterized the functional implications of a de novo mutation of the GluN2A subunit (P1199Rfs*32) resulting in the truncation of the C-terminal domain. The variant was identified in a male patient with epileptic encephalopathy, multiple seizure types, severe aphasia, and neurobehavioral changes. Given the known role of the CTD in NMDAR trafficking, we examined changes in receptor localization and abundance at the postsynaptic membrane using a combination of molecular assays in heterologous cells and rat primary neuronal cultures. We observed that the GluN2A P1199Rfs*32-containing receptors traffic efficiently to the postsynaptic membrane but have increased extra-synaptic expression relative to WT GluN2A-containing NMDARs. Using in silico predictions, we hypothesized that the mutant would lose all PDZ interactions, except for the recycling protein Scribble1. Indeed, we observed impaired binding to the scaffolding protein postsynaptic protein-95 (PSD-95); however, we found the mutant interacts with Scribble1, which facilitates the recycling of both the mutant and the WT GluN2A. Finally, we found that neurons expressing GluN2A P1199Rfs*32 have fewer synapses and decreased spine density, indicating compromised synaptic transmission in these neurons. Overall, our data show that GluN2A P1199Rfs*32 is a loss-of-function variant with altered membrane localization in neurons and provide mechanistic insight into disease etiology.

JNK Kinase regulates cachexia like syndrome in scribble knockdown tumor model of Drosophila melanogaster.

Cachexia and systemic organ wasting are metabolic syndrome often associated with cancer. However, the exact mechanism of cancer associated cachexia like syndrome still remain elusive. In this study, we utilized a scribble (scrib) knockdown induced hindgut tumor to investigate the role of JNK kinase in cachexia like syndrome. Scrib, a cell polarity regulator, also acts as a tumor suppressor gene. Its loss and mis-localization are reported in various type of malignant cancer-like breast, colon and prostate cancer. The scrib knockdown flies exhibited male lethality, reduced life span, systemic organ wasting and increased pJNK level in hindgut of female flies. Interestingly, knocking down of human JNK Kinase analogue, hep, in scrib knockdown background in hindgut leads to restoration of loss of scrib mediated lethality and systemic organ wasting. Our data showed that scrib loss in hindgut is capable of inducing cancer associated cachexia like syndrome. Here, we firstly report that blocking the JNK signaling pathway effectively rescued the cancer cachexia induced by scrib knockdown, along with its associated gut barrier disruption. These findings have significantly advanced our understanding of cancer cachexia and have potential implications for the development of therapeutic strategies. However, more research is needed to fully understand the complex mechanisms underlying this condition.

Scribble and E-cadherin cooperate to control symmetric daughter cell positioning by multiple mechanisms.

The fate of the two daughter cells is intimately connected to their positioning, which is in turn regulated by cell junction remodelling and orientation of the mitotic spindle. How multiple cues are integrated to dictate the ultimate positioning of daughters is not clear. Here, we identify novel mechanisms of regulation of daughter positioning in single MCF10A cells. The polarity protein, Scribble cooperates with E-cadherin for sequential roles in daughter positioning. First Scribble stabilises E-cadherin at the mitotic cortex as well as the retraction fibres, to mediate spindle orientation. Second, Scribble re-locates to the junction between the two daughters to allow a new E-cadherin-based-interface to form between them, influencing the width of the nascent daughter-daughter junction and subsequent cell positioning. Thus, E-cadherin and Scribble dynamically relocate to different intracellular sites during cell division to orient the mitotic spindle and control placement of the daughter cells after cell division. This article has an associated First Person interview with the first author of the paper.

Dynamic localization of the Na+-HCO3- co-transporter NBCn1 to the plasma membrane, centrosomes, spindle and primary cilia.

Finely tuned regulation of transport protein localization is vital for epithelial function. The Na+-HCO3- co-transporter NBCn1 (also known as SLC4A7) is a key contributor to epithelial pH homeostasis, yet the regulation of its subcellular localization is not understood. Here, we show that a predicted N-terminal ß-sheet and short C-terminal α-helical motif are essential for NBCn1 plasma membrane localization in epithelial cells. This localization was abolished by cell-cell contact disruption, and co-immunoprecipitation (co-IP) and proximity ligation (PLA) revealed NBCn1 interaction with E-cadherin and DLG1, linking it to adherens junctions and the Scribble complex. NBCn1 also interacted with RhoA and localized to lamellipodia and filopodia in migrating cells. Finally, analysis of native and GFP-tagged NBCn1 localization, subcellular fractionation, co-IP with Arl13B and CEP164, and PLA of NBCn1 and tubulin in mitotic spindles led to the surprising conclusion that NBCn1 additionally localizes to centrosomes and primary cilia in non-dividing, polarized epithelial cells, and to the spindle, centrosomes and midbodies during mitosis. We propose that NBCn1 traffics between lateral junctions, the leading edge and cell division machinery in Rab11 endosomes, adding new insight to the role of NBCn1 in cell cycle progression.

The water channels Aquaporin-1 and Aquaporin-3 interact with and affect the cell polarity protein Scribble in 3D in vitro models of breast cancer.

Cellular changes in carcinomas include alterations in cell proliferation, cell migration, cell-cell adhesion and cellular polarity. In vitro studies have revealed that the water channels, aquaporin-1 (AQP1) and AQP3 can influence cell migration and cell-cell adhesion. Of note, we previously showed that AQP1 overexpression reduced levels of cell-cell adhesion proteins, whereas AQP3 increased levels when overexpressed in normal epithelial cells. Expression of AQP1 and AQP3 in breast carcinoma is associated with lymph node metastasis, recurrence, and poor survival of breast cancer patients. In this study, we investigated if AQP1 and AQP3 affected cell polarity in breast cancer by studying the relationship between the major polarity protein Scribble and AQP1 and AQP3. In breast cancer tissue samples, the protein expression of AQP1, AQP3 and Scribble did not show an obvious correlation. However, in a GST pull-down assay, AQP1 and AQP3 interacted with Scribble. AQP1 overexpression reduced the size of 3D spheroids as well as reduced Scribble levels at cell-cell contacts, whereas AQP3 overexpression showed no significant change in spheroid size compared to control, AQP3 overexpression also reduced Scribble levels at cell-cell contacts. Of note, AQP1 overexpression increased cell migration and induced cell detachment and dissemination from migrating breast cancer cell sheets, whereas AQP3 overexpression did not. Thus, AQP1 and AQP3 differentially affect 3D grown breast cancer spheroids and especially AQP1 may contribute to cancer development and spread via negatively affecting cellular junctions and cell polarity proteins as well as increasing cell migration and cell detachment.

The Cyst Epithelium in Polycystic Kidney Disease Patients Displays Normal Apical-Basolateral Cell Polarity.

The main characteristic of polycystic kidney disease is the development of multiple fluid-filled renal cysts. The discovery of mislocalized sodium-potassium pump (Na,K-ATPase) in the apical membrane of cyst-lining epithelia alluded to reversal of polarity as a possible explanation for the fluid secretion. The topic of apical Na,K-ATPase in cysts remains controversial. We investigated the localization of the Na,K-ATPase and assessed the apical-basolateral polarization of cyst-lining epithelia by means of immunohistochemistry in kidney tissue from six polycystic kidney disease patients undergoing nephrectomy. The Na,K-ATPase α1 subunit was conventionally situated in the basolateral membrane of all immunoreactive cysts. Proteins of the Crumbs and partitioning defective (Par) complexes were localized to the apical membrane domain in cyst epithelial cells. The apical targeting protein Syntaxin-3 also immunolocalized to the apical domain of cyst-lining epithelial cells. Proteins of the basolateral Scribble complex immunolocalized to the basolateral domain of cysts. Thus, no deviations from the typical epithelial distribution of basic cell polarity proteins were observed in the cysts from the six patients. Furthermore, we confirmed that cysts can originate from virtually any tubular segment with preserved polarity. In conclusion, we find no evidence of a reversal in apical-basolateral polarity in cyst-lining epithelia in polycystic kidney disease.

The cell polarity protein Scribble is downregulated by the water channel aquaporin-5 in breast cancer cells.

Breast carcinomas originate from cells in the terminal duct-lobular unit. Carcinomas are associated with increased cell proliferation and migration, altered cellular adhesion, as well as loss of epithelial polarity. In breast cancer, aberrant and high levels of aquaporin-5 (AQP5) are associated with increased metastasis, poor prognosis, and cancer recurrence. AQP5 increases the proliferation and migration of cancer cells, and ectopic expression of AQP5 in normal epithelial cells reduces cell-cell adhesion and increases cell detachment and dissemination from migrating cell sheets, the latter via AQP5-mediated activation of the Ras pathway. Here, we investigated if AQP5 also affects cellular polarity by examining the relationship between the essential polarity protein Scribble and AQP5. In tissue samples from invasive lobular and ductal carcinomas, the majority of cells with high AQP5 expression displayed low Scribble levels, indicating an inverse relationship. Probing for interactions via a Glutathione S-transferase pull-down experiment revealed that AQP5 and Scribble interacted. Moreover, overexpression of AQP5 in the breast cancer cell line MCF7 reduced both size and circularity of three-dimensional (3-D) spheroids and induced cell detachment and dissemination from migrating cell sheets. In addition, Scribble levels were reduced. An AQP5 mutant cell line, which cannot activate Ras (AQP5S156A) signaling, displayed unchanged spheroid size and circularity and an intermediate level of Scribble, indicating that the effect of AQP5 on Scribble is, at least in part, dependent on AQP5-mediated activation of Ras. Thus, our results suggest that high AQP5 expression negatively regulates the essential polarity protein Scribble and thus, can affect cellular polarity in breast cancer.

Viral subversion of the cell polarity regulator Scribble.

Scribble is a scaffolding protein that regulates key events such as cell polarity, tumorigenesis and neuronal signalling. Scribble belongs to the LAP family which comprise of 16 Leucine Rich Repeats (LRR) at the N-terminus, two LAP Specific Domains (LAPSD) and four PSD-95/Discs-large/ZO-1 (PDZ) domains at the C-terminus. The four PDZ domains have been shown to be key for a range of protein-protein interactions and have been identified to be crucial mediators for the vast majority of Scribble interactions, particularly via PDZ Binding Motifs (PBMs) often found at the C-terminus of interacting proteins. Dysregulation of Scribble is associated with poor prognosis in viral infections due to subversion of multiple cell signalling pathways by viral effector proteins. Here, we review the molecular details of the interplay between Scribble and viral effector proteins that provide insight into the potential modes of regulation of Scribble mediated polarity signalling.

Dysregulation of the Scribble/YAP/ß-catenin axis sustains the fibroinflammatory response in a PKHD1-/- mouse model of congenital hepatic fibrosis.

Congenital hepatic fibrosis (CHF), a genetic cholangiopathy characterized by fibropolycystic changes in the biliary tree, is caused by mutations in the PKHD1 gene, leading to defective fibrocystin (FPC), changes in planar cell polarity (PCP) and increased ß-catenin-dependent chemokine secretion. In this study, we aimed at understanding the role of Scribble (a protein involved in PCP), Yes-associated protein (YAP), and ß-catenin in the regulation of the fibroinflammatory phenotype of FPC-defective cholangiocytes. Immunohistochemistry showed that compared with wild type (WT) mice, in FPC-defective (Pkhd1del4/del4 ) mice nuclear expression of YAP/TAZ in cystic cholangiocytes, significantly increased and correlated with connective tissue growth factor (CTGF) expression and pericystic fibrosis, while Scribble expression on biliary cyst cells was markedly decreased. Cholangiocytes isolated from WT mice showed intense Scribble immunoreactivity at the membrane, but minimal nuclear expression of YAP, which conversely increased, together with CTGF, after small interfering RNA (siRNA) silencing of Scribble. In FPC-defective cholangiocytes, inhibition of YAP nuclear import reduced ß-catenin nuclear expression, and CTGF, integrin ß6, CXCL1, and CXCL10 mRNA levels, whereas inhibition of ß-catenin signaling did not affect nuclear translocation of YAP. Notably, siRNA silencing of Scribble and YAP in WT cholangiocytes mimics the fibroinflammatory changes of FPC-defective cholangiocytes. Conditional deletion of ß-catenin in Pkhd1del4/del4  mice reduced cyst growth, inflammation and fibrosis, without affecting YAP nuclear expression. In conclusion, the defective anchor of Scribble to the membrane facilitates the nuclear translocation of YAP and ß-catenin with gain of a fibroinflammatory phenotype. The Scribble/YAP/ß-catenin axis is a critical factor in the sequence of events linking the genetic defect to fibrocystic trait of cholangiocytes in CHF.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Scribble mutation disrupts convergent extension and apical constriction during mammalian neural tube closure.

Morphogenesis of the vertebrate neural tube occurs by elongation and bending of the neural plate, tissue shape changes that are driven at the cellular level by polarized cell intercalation and cell shape changes, notably apical constriction and cell wedging. Coordinated cell intercalation, apical constriction, and wedging undoubtedly require complex underlying cytoskeletal dynamics and remodeling of adhesions. Mutations of the gene encoding Scribble result in neural tube defects in mice, however the cellular and molecular mechanisms by which Scrib regulates neural cell behavior remain unknown. Analysis of Scribble mutants revealed defects in neural tissue shape changes, and live cell imaging of mouse embryos showed that the Scrib mutation results in defects in polarized cell intercalation, particularly in rosette resolution, and failure of both cell apical constriction and cell wedging. Scrib mutant embryos displayed aberrant expression of the junctional proteins ZO-1, Par3, Par6, E- and N-cadherins, and the cytoskeletal proteins actin and myosin. These findings show that Scribble has a central role in organizing the molecular complexes regulating the morphomechanical neural cell behaviors underlying vertebrate neurulation, and they advance our understanding of the molecular mechanisms involved in mammalian neural tube closure.

Basolateral protein Scribble binds phosphatase PP1 to establish a signaling network maintaining apicobasal polarity.

Scribble, a member of the LAP protein family, contributes to the apicobasal polarity (ABP) of epithelial cells. The LAP-unique region of these proteins, which is essential and sufficient for ABP, includes a conserved Leucine-Rich Repeat (LRR) domain. The major binding partners of this region that could regulate ABP remain unknown. Here, using proteomics, native gel electrophoresis, and site-directed mutagenesis, we show that the concave surface of LRR domain in Scribble participates in three types of mutually exclusive interactions-(i) homodimerization, serving as an auto-inhibitory mechanism; (ii) interactions with a diverse set of polarity proteins, such as Llgl1, Llgl2, EPB41L2, and EPB41L5, which produce distinct multiprotein complexes; and (iii) a direct interaction with the protein phosphatase, PP1. Analogy with the complex between PP1 and LRR domain of SDS22, a well-studied PP1 regulator, suggests that the Scibble-PP1 complex stores a latent form of PP1 in the basolateral cell cortex. Such organization may generate a dynamic signaling network wherein PP1 could be dispatched from the complex with Scribble to particular protein ligands, achieving fast dephosphorylation kinetics.

Scribble and Discs-large direct initial assembly and positioning of adherens junctions during the establishment of apical-basal polarity.

Apical-basal polarity is a fundamental property of animal tissues. Drosophila embryos provide an outstanding model for defining mechanisms that initiate and maintain polarity. Polarity is initiated during cellularization, when cell-cell adherens junctions are positioned at the future boundary of apical and basolateral domains. Polarity maintenance then involves complementary and antagonistic interplay between apical and basal polarity complexes. The Scribble/Dlg module is well-known for promoting basolateral identity during polarity maintenance. Here, we report a surprising role for Scribble/Dlg in polarity initiation, placing it near the top of the network-positioning adherens junctions. Scribble and Dlg are enriched in nascent adherens junctions, are essential for adherens junction positioning and supermolecular assembly, and also play a role in basal junction assembly. We test the hypotheses for the underlying mechanisms, exploring potential effects on protein trafficking, cytoskeletal polarity or Par-1 localization/function. Our data suggest that the Scribble/Dlg module plays multiple roles in polarity initiation. Different domains of Scribble contribute to these distinct roles. Together, these data reveal novel roles for Scribble/Dlg as master scaffolds regulating assembly of distinct junctional complexes at different times and places.

Single cell transcriptomic landscapes of pattern formation, proliferation and growth in Drosophila wing imaginal discs.

Organ formation relies on the orchestration of pattern formation, proliferation and growth during development. How these processes are integrated at the individual cell level remains unclear. In the past decades, studies using Drosophila wing imaginal discs as a model system have provided valuable insights into pattern formation, growth control and regeneration. Here, we provide single cell transcriptomic landscapes of pattern formation, proliferation and growth of wing imaginal discs. We found that patterning information is robustly maintained in the single cell transcriptomic data and can provide reference matrices for computationally mapping single cells into discrete spatial domains. Assignment of wing disc single cells to spatial subregions facilitates examination of patterning refinement processes. We also clustered single cells into different proliferation and growth states and evaluated the correlation between cell proliferation/growth states and spatial patterning. Furthermore, single cell transcriptomic analyses allowed us to quantitatively examine disturbances of differentiation, proliferation and growth in a well-established tumor model. We provide a database to explore these datasets at http://drosophilayanlab-virtual-wingdisc.ust.hk:3838/v2/This article has an associated 'The people behind the papers' interview.

Scribble and Discs Large mediate tricellular junction formation.

Junctional complexes that mediate cell adhesion are key to epithelial integrity, cell division and permeability barrier formation. In Drosophila, the scaffolding proteins Scribble (Scrib) and Discs Large (Dlg) are key regulators of epithelial polarity, proliferation, assembly of junctions and protein trafficking. We found that Scrib and Dlg are necessary for the formation of the tricellular junction (TCJ), a unique junction that forms in epithelia at the point of convergence of three neighboring cells. Scrib and Dlg are in close proximity with the TCJ proteins Gliotactin (Gli) and Bark Beetle (Bark), and both are required for TCJ protein recruitment. Loss of Bark or Gli led to basolateral spread of the TCJ complex at the cell corners. Loss of the septate junction proteins Nrx-IV and the Na+/K+ ATPase also resulted in basolateral spread of the entire TCJ complex at the cell corners. The Scrib PDZ1-2 domains and the Dlg GUK domain are necessary for Bark and Gli localization to the TCJ. Overall, we propose a model in which Scrib and Dlg are key components of the TCJ, and form a complex with Bark and Gli.

PHLPP isoforms differentially regulate Akt isoforms and AS160 affecting neuronal insulin signaling and insulin resistance via Scribble.

BACKGROUND: The aim of the present study was to determine the role of individual PHLPP isoforms in insulin signaling and insulin resistance in neuronal cells. METHODS: PHLPP isoforms were either silenced or overexpressed individually, and the effects were observed on individual Akt isoforms, AS160 and on neuronal glucose uptake, under insulin sensitive and resistant conditions. To determine PHLPP regulation itself, we tested effect of scaffold protein, Scribble, on PHLPP isoforms and neuronal glucose uptake. RESULTS: We observed elevated expression of both PHLPP1 and PHLPP2 in insulin resistant neuronal cells (Neuro-2A, mouse neuroblastoma; SHSY-5Y, human neuroblastoma) as well as in the whole brain lysates of high-fat-diet mediated diabetic mice. In insulin sensitive condition, PHLPP isoforms differentially affected activation of all Akt isoforms, wherein PHLPP1 regulated serine phosphorylation of Akt2 and Akt3, while PHLPP2 regulated Akt1 and Akt3. This PHLPP mediated Akt isoform specific regulation activated AS160 affecting glucose uptake. Under insulin resistant condition, a similar trend of results were observed in Akt isoforms, AS160 and glucose uptake. Over-expressed PHLPP isoforms combined with elevated endogenous expression under insulin resistant condition drastically affected downstream signaling, reducing neuronal glucose uptake. No compensation was observed amongst PHLPP isoforms under all conditions tested, indicating independent roles and pointing towards possible scaffolding interactions behind isoform specificity. Silencing of Scribble, a scaffolding protein known to interact with PHLPP, affected cellular localization of both PHLPP1 and PHLPP2, and caused increase in glucose uptake. CONCLUSIONS: PHLPP isoforms play independent roles via Scribble in regulating Akt isoforms differentially, affecting AS160 and neuronal glucose uptake. Video abstract.

Structural basis of the human Scribble-Vangl2 association in health and disease.

Scribble is a critical cell polarity regulator that has been shown to work as either an oncogene or tumor suppressor in a context dependent manner, and also impacts cell migration, tissue architecture and immunity. Mutations in Scribble lead to neural tube defects in mice and humans, which has been attributed to a loss of interaction with the planar cell polarity regulator Vangl2. We show that the Scribble PDZ domains 1, 2 and 3 are able to interact with the C-terminal PDZ binding motif of Vangl2 and have now determined crystal structures of these Scribble PDZ domains bound to the Vangl2 peptide. Mapping of mammalian neural tube defect mutations reveal that mutations located distal to the canonical PDZ domain ligand binding groove can not only ablate binding to Vangl2 but also disrupt binding to multiple other signaling regulators. Our findings suggest that PDZ-associated neural tube defect mutations in Scribble may not simply act in a Vangl2 dependent manner but as broad-spectrum loss of function mutants by disrupting the global Scribble-mediated interaction network.

A 21-bp indel within the LLGL1 gene is significantly associated with litter size in goat.

The scribble cell polarity complex component (LLGL1) is part of the cytoskeletal network and is involved in maintaining cell polarity and epithelial integrity. Based on the whole-genome sequencing analysis in goat, LLGL1 gene is suggested as a putative important candidate gene affecting litter size in Shaanbei White Cashmere Goats (SBWC). Therefore, the objective of this study was to uncover the possible novel insertion/deletion (Indel) variant in goat LLGL1 gene and to evaluate its association with litter size of SBWC (n = 827). Using the PCR detection and DNA sequencing, the 21-bp indel in the upstream of LLGL1 was firstly founded and two genotypes were identified: II (insertion/insertion) and ID (insertion/deletion), respectively. Association analyses revealed that the 21-bp indel was significantly correlated with litter size (p = 0.017). Notably, the individuals with II genotype were significantly greater than that of the genotype ID, and the 'I' allele was dominant. Additionally, the remarkable influence of the indel on traits might be related to the change of DEAF-1-related (NUDR) binding site through bioinformatics analysis. Briefly, the 21-bp indel within the goat LLGL1 gene could be an effective DNA molecular marker and provide valuable theoretical basis for marker-assisted selection (MAS) in goat industry.

Drosophila Larval Models of Invasive Tumorigenesis for In Vivo Studies on Tumour/Peripheral Host Tissue Interactions during Cancer Cachexia.

Cancer cachexia is a common deleterious paraneoplastic syndrome that represents an area of unmet clinical need, partly due to its poorly understood aetiology and complex multifactorial nature. We have interrogated multiple genetically defined larval Drosophila models of tumourigenesis against key features of human cancer cachexia. Our results indicate that cachectic tissue wasting is dependent on the genetic characteristics of the tumour and demonstrate that host malnutrition or tumour burden are not sufficient to drive wasting. We show that JAK/STAT and TNF-α/Egr signalling are elevated in cachectic muscle and promote tissue wasting. Furthermore, we introduce a dual driver system that allows independent genetic manipulation of tumour and host skeletal muscle. Overall, we present a novel Drosophila larval paradigm to study tumour/host tissue crosstalk in vivo, which may contribute to future research in cancer cachexia and impact the design of therapeutic approaches for this pathology.