Identifying MiR-140-3p as a stable internal reference to normalize MicroRNA qRT-PCR levels of plasma small extracellular vesicles in lung cancer patients.

Exploration of a stably expressed gene as a reference is critical for the accurate evaluation of miRNAs isolated from small extracellular vesicles (sEVs). In this study, we analyzed small RNA sequencing on plasma sEV miRNAs in the training dataset (n = 104) and found that miR-140-3p was the most stably expressed candidate reference for sEV miRNAs. We further demonstrated that miR-140-3p expressed most stably in the validation cohort (n = 46) when compared to two other reference miRNAs, miR-451a and miR-1228-3p, and the commonly-used miRNA reference U6. Finally, we compared the capability of miR-140-3p and U6 as the internal reference for sEV miRNA expression by evaluating key miRNAs expression in lung cancer patients and found that miR-140-3p was more suitable as a sEV miRNA reference gene. Taken together, our data indicated miR-140-3p as a stable internal reference miRNA of plasma sEVs to evaluate miRNA expression profiles in lung cancer patients.

Mitochondrial microRNA profiles are altered in thirteen-lined ground squirrels (Ictidomys tridecemlineatus) during hibernation.

Thirteen-lined ground squirrels (TLGSs) are obligate hibernators that cycle between torpor (low metabolic rate and body temperature) and interbout euthermia (IBE; typical euthermic body temperature and metabolism) from late autumn to spring. Many physiological changes occur throughout hibernation, including a reduction in liver mitochondrial metabolism during torpor, which is reversed during arousal to interbout euthermia. Nuclear-encoded microRNA (miRNA, small posttranscriptional regulator molecules) differ in abundance throughout TLGS hibernation and have been shown to regulate mitochondrial gene expression in mammalian cell culture (where they are referred to as mitomiRs). This study characterized differences in mitomiR profiles from TLGS liver mitochondria isolated during summer, torpor, and IBE, and predicted their mitochondrial targets. Using small RNA sequencing, differentially abundant mitomiRs were identified between hibernation states, and using quantitative PCR analysis, we quantified the expression of predicted mitochondrial mRNA targets. Most differences in mitomiR abundances were seasonal (i.e., between summer and winter) with only one mitomiR differentially abundant between IBE and torpor. Multiple factor analysis (MFA) revealed three clusters divided by hibernation states, where clustering was predominantly driven by mitomiR abundances. Nine of these differentially abundant mitomiRs had predicted mitochondrial RNA targets, including subunits of electron transfer system complexes I and IV, 12S rRNA, and two tRNAs. Overall, mitomiRs were predicted to suppress the expression of their mitochondrial targets and may have some involvement in regulating protein translation in mitochondria. This study found differences in mitomiR abundances between seasons and hibernation states of TLGS and suggests potential mechanisms for regulating the mitochondrial electron transfer system.NEW & NOTEWORTHY During the hibernation season, thirteen-lined ground squirrels periodically increase metabolism remarkably between torpor and interbout euthermia (IBE). This process involves rapid reactivation of mitochondrial respiration. We predicted that mitochondrial microRNA (mitomiRs) might be altered during this response. We found that the abundance of 38 liver mitomiRs differs based on hibernation state (summer, IBE, and torpor). Small RNA sequencing identified mitomiR profiles, including some mitomiRs that are predicted to bind to mitochondrial RNAs.

Small RNA and Degradome Deep Sequencing Reveal Regulatory Roles of MicroRNAs in Response to Sugarcane Mosaic Virus Infection on Two Contrasting Sugarcane Cultivars.

MicroRNAs (miRNAs) play an essential regulatory role in plant-virus interaction. However, few studies have focused on the roles of miRNAs and their targets after sugarcane mosaic virus (SCMV) infection in sugarcane. To address this issue, we conducted small RNA (sRNA) and degradome sequencing on two contrasting sugarcanes (SCMV-resistant 'Fuoguo1' [FG1] and susceptible 'Badila') infected by SCMV at five time points. A total of 1,578 miRNAs were profiled from 30 sRNA libraries, comprising 660 known miRNAs and 380 novel miRNAs. Differential expression analysis of miRNAs revealed that most were highly expressed during the SCMV exponential phase in Badila at 18 h postinfection, with expression profiles positively correlated with virus replication dynamics as observed through clustering. Analysis of degradome data indicated a higher number of differential miRNA targets in Badila compared to FG1 at 18 h postinfection. Gene ontology (GO) enrichment analysis significantly enriched the stimulus-response pathway, suggesting negative regulatory roles to SCMV resistance. Specifically, miR160 upregulated expression patterns and validated in Badila through quantitative real-time PCR (qRT-PCR) in the early stages of SCMV multiplication. Our research provides new insights into the dynamic response of plant miRNA and virus replication and contributes valuable information on the intricate interplay between miRNAs and SCMV infection dynamics. [Formula: see text] Copyright © 2024 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Analysis of microRNA Expression Profiles in Broiler Muscle Tissues by Feeding Different Levels of Guanidinoacetic Acid.

The aim of this study was to explore the molecular mechanisms through which different levels of GAA affect chicken muscle development by influencing miRNA expression, to lay a theoretical foundation for the identification of key functional small RNAs related to poultry muscle development, and to provide new insights into the regulatory mechanisms of GAA on muscle development and meat quality in broilers. It provides a new theoretical basis for using GAA as a feed additive to improve feed performance. Small RNA sequencing technology was utilized to obtain the expression profiles of miRNA in the broiler pectoral muscle fed with different levels of GAA (0 g/kg, 1.2 g/kg and 3.6 g/kg). An analysis of differentially expressed miRNAs revealed 90 such miRNAs in the three combination comparisons, with gga-miR-130b-5p exhibiting significant differences across all three combinations. Furthermore, three of the differentially expressed miRNAs were performed by RT-qPCR verification, yielding results consistent with those obtained from small RNA sequencing. Target gene prediction, as well as the GO and KEGG enrichment analysis of differentially expressed miRNAs, indicated their involvement in muscle cell differentiation and other processes, particularly those associated with the MAPK signaling pathway. This study has, thus, provided valuable insights and resources for the further exploration of the miRNA molecular mechanism underlying the influence of guanidine acetic acid on broiler muscle development. Combined with previous studies and small RNA sequencing, adding 1.2 g/kg GAA to the diet can better promote the muscle development of broilers.

A Fecal MicroRNA Signature by Small RNA Sequencing Accurately Distinguishes Colorectal Cancers: Results From a Multicenter Study.

BACKGROUND & AIMS: Fecal tests currently used for colorectal cancer (CRC) screening show limited accuracy in detecting early tumors or precancerous lesions. In this respect, we comprehensively evaluated stool microRNA (miRNA) profiles as biomarkers for noninvasive CRC diagnosis. METHODS: A total of 1273 small RNA sequencing experiments were performed in multiple biospecimens. In a cross-sectional study, miRNA profiles were investigated in fecal samples from an Italian and a Czech cohort (155 CRCs, 87 adenomas, 96 other intestinal diseases, 141 colonoscopy-negative controls). A predictive miRNA signature for cancer detection was defined by a machine learning strategy and tested in additional fecal samples from 141 CRC patients and 80 healthy volunteers. miRNA profiles were compared with those of 132 tumors/adenomas paired with adjacent mucosa, 210 plasma extracellular vesicle samples, and 185 fecal immunochemical test leftover samples. RESULTS: Twenty-five miRNAs showed altered levels in the stool of CRC patients in both cohorts (adjusted P < .05). A 5-miRNA signature, including miR-149-3p, miR-607-5p, miR-1246, miR-4488, and miR-6777-5p, distinguished patients from control individuals (area under the curve [AUC], 0.86; 95% confidence interval [CI], 0.79-0.94) and was validated in an independent cohort (AUC, 0.96; 95% CI, 0.92-1.00). The signature classified control individuals from patients with low-/high-stage tumors and advanced adenomas (AUC, 0.82; 95% CI, 0.71-0.97). Tissue miRNA profiles mirrored those of stool samples, and fecal profiles of different gastrointestinal diseases highlighted miRNAs specifically dysregulated in CRC. miRNA profiles in fecal immunochemical test leftover samples showed good correlation with those of stool collected in preservative buffer, and their alterations could be detected in adenoma or CRC patients. CONCLUSIONS: Our comprehensive fecal miRNome analysis identified a signature accurately discriminating cancer aimed at improving noninvasive diagnosis and screening strategies.

Nascent transcription reveals regulatory changes in extremophile fishes inhabiting hydrogen sulfide-rich environments.

Regulating transcription allows organisms to respond to their environment, both within a single generation (plasticity) and across generations (adaptation). We examined transcriptional differences in gill tissues of fishes in the Poecilia mexicana species complex (family Poeciliidae), which have colonized toxic springs rich in hydrogen sulfide (H2S) in southern Mexico. There are gene expression differences between sulfidic and non-sulfidic populations, yet regulatory mechanisms mediating this gene expression variation remain poorly studied. We combined capped-small RNA sequencing (csRNA-seq), which captures actively transcribed (i.e. nascent) transcripts, and messenger RNA sequencing (mRNA-seq) to examine how variation in transcription, enhancer activity, and associated transcription factor binding sites may facilitate adaptation to extreme environments. csRNA-seq revealed thousands of differentially initiated transcripts between sulfidic and non-sulfidic populations, many of which are involved in H2S detoxification and response. Analyses of transcription factor binding sites in promoter and putative enhancer csRNA-seq peaks identified a suite of transcription factors likely involved in regulating H2S-specific shifts in gene expression, including several key transcription factors known to respond to hypoxia. Our findings uncover a complex interplay of regulatory processes that reflect the divergence of extremophile populations of P. mexicana from their non-sulfidic ancestors and suggest shared responses among evolutionarily independent lineages.

Milk exosomal microRNA profiling identified miR-375 and miR-199-5p for regulation of immune response during subclinical mastitis of crossbred cattle.

BACKGROUND: The dairy industry has experienced significant economic losses as a result of mastitis, an inflammatory disease of cows, including both subclinical and clinical cases. Milk exosome microRNAs have gained attention due to their stable and selective wrapping nature, offering potential for the prognosis and diagnosis of bovine mastitis, the most common pathological condition of the mammary gland. METHODS AND RESULTS:  In the present investigation, the microRNA profile of milk exosomes was explored using high-throughput small RNA sequencing data in sub-clinical mastitic and healthy crossbred Vrindavani cattle. In both groups, 349 microRNAs were identified, with 238 (68.19%) microRNAs co-expressed; however, 35 and 76 distinct microRNAs were found in subclinical mastitic and healthy cattle, respectively. Differential expression analysis revealed 11 microRNAs upregulated, and 18 microRNAs were downregulated in sub-clinical mastitic cattle. The functional annotation of the target genes of differentially expressed known and novel microRNAs including bta-miR-375, bta-miR-199-5p and bta-miR-12030 reveals their involvement in the regulation of immune response and inflammatory mechanisms and could be involved in development of mastitis. CONCLUSIONS: The analysis of milk exosomal miRNAs cargos hold great promise as an approach to study the underlying molecular mechanisms associated with mastitis in high milk producing dairy cattle. Concurrently, the significantly downregulated miR-375 may upregulate key target genes, including CTLA4, IHH, IRF1, and IL7R. These genes are negative regulators of immune response pathways, which could be associated with impaired inflammatory mechanisms in mammary cells. According to the findings, bta-miR-375 could be a promising biomarker for the development of mastitis in dairy cattle.

Deciphering the miRNA transcriptome of granulosa cells from dominant and subordinate follicles at first follicular wave in goat.

In goats, most follicles in the ovaries will be atresia and only a few dominant follicles (DFs) may eventually mature and ovulate at a follicular wave. To investigate the potential microRNAs (miRNAs) that regulate the expression of genes associated with follicular dominance or atresia, small RNA sequencing was performed on granulosa cells of DF and subordinate follicle at the first follicular wave in goats. A total of 108 differentially expressed miRNAs were detected in the two types of follicle granulosa cells: 16 upregulated miRNAs and 92 downregulated miRNAs. Kyoto Encyclopedia of Genes and Genomes analysis of the target genes showed that TKTL1, LOC102187810, LOC102184409 and ALDOA are closely associated with follicle dominance and are involved in the pentose phosphate pathway. Furthermore, a coexpression network of miRNAs and follicular dominance-related genes was constructed. The qPCR results well correlated with the small RNA sequencing data. Our findings provide new insight for exploring the molecular mechanism of miRNAs in regulating follicular development in goats.

Importance of core microRNA pathway genes and microRNAs associated with the defense of Odontotermes formosanus (Shiraki) against Serratia marcescens infection.

MicroRNAs (miRNAs) are noncoding small regulatory RNAs involved in diverse biological processes. Odontotermes formosanus (Shiraki) is a polyphagous pest that causes economic damage to agroforestry. Serratia marcescens is a bacterium with great potential for controlling this insect. However, knowledge about the miRNA pathway and the role of miRNAs in O. formosanus defense against SM1 is limited. In this study, OfAgo1, OfDicer1 and OfDrosha were differentially expressed in different castes and tissues. SM1 infection affected the expression of all three genes in O. formosanus. Then, we used specific double-stranded RNAs to silence OfAgo1, OfDicer1 and OfDrosha. Knockdown of these genes enhanced the virulence of SM1 to O. formosanus, suggesting that miRNAs were critical in the defense of O. formosanus against SM1. Furthermore, we sequenced miRNAs from SM1-infected and uninfected O. formosanus. 33 differentially expressed (DE) miRNAs were identified, whereby 22 were upregulated and 11 were downregulated. Finally, the miRNA-mRNA networks were constructed, which further suggested the important role of miRNAs in the defense of O. formosanus against SM1. Totally, O. formosanus miRNA core genes defend against SM1 infection by regulating miRNA expression. This study elucidates the interactions between O. formosanus and SM1 and provides new theories for biological control.

First Report of Sugarcane Mosaic Virus Infecting Goose Grass in Shandong Province, China.

Sugarcane mosaic virus (SCMV genus Potyvirus, family Potyviridae) can infect maize, sugarcane, sorghum, other graminaceous crops, and some weed species (Alegria et al., 2003; Achon et al., 2007). In August 2023, the leaves of goose grass (Eleusine indica) plants surrounding maize fields in a village of Liaocheng City, Shandong Province, China showed mosaic and chlorotic symptoms (26%, 11 of 43 grasses; Figure S1). Three symptomatic goose grass samples were selected and pooled for total RNA isolation using TRIzol reagent (Tiangen, Beijing, China). A small RNA library was created using 2.0 µg of total RNA and the mirVana miRNA Isolation Kit, followed by size selection (18-28 nt), adapter ligation, purification, reverse transcription (RT), and polymerase chain reaction (PCR) enrichment. High-throughput sequencing (HTS) was then performed on a HiSeq 2500 platform (Illumina, San Diego, CA, USA). The adapter sequences were removed and the reads were assembled de novo into larger contigs using ABySS software v. 1.9.0 with a k-mer of 32. Fifty-one contigs were obtained after the reads were spliced and screened (alignment length > 30 bp; e-value ≤ 0.05). The contigs were compared with viral sequences in GenBank using local BLASTn. Thirty-four contigs (34-64 nt) had the highest identities (97.18-100%) with the SCMV genome sequence, covering approximately 12.8% of the SCMV genome (Table S1). The low coverage of small contigs mapping to the SCMV genome in the HTS results may be attributed to variations in sequencing depth and sample preparation quality, biological aspects of the virus affecting siRNA production and detection, as well as the variability in viral genome and its size (Golyaev et al., 2019; Valenzuela et al., 2022). The other 17 contigs did not align to any plant virus sequences, but aligned to plant sequences, including Phragmites australis and Panicum virgatum. Potyvirus-degenerated primers PotyF (5'-ATGGTHTGGTGYATHGARAAYGG-3') and PotyR (5'-TGCTGCKGCYTTCATYTG-3') (Marie-Jeanne et al. 2000) were used in RT-PCR to detect SCMV in symptomatic leaves, yielding a ~300 bp amplicon. Sanger sequencing and BLASTn analysis confirmed the 97.98% nucleotide identity with SCMV isolate BJ (GenBank accession No. AY042184.1). The sequence was deposited in GenBank under accession number OR777055. In addition, specific SCMV primers SCMV-F (5'- TCCGGAACTGTGGATGCA-3') and SCMV-R (5'- GTGGTGCTGCTGCACTCCC-3') (coat protein region, 939 bp) detected the virus in all 11 symptomatic goose grass leaves, with no detection in asymptomatic leaves. Inoculation tests using extracts from symptomatic goose grass on maize plants resulted in mosaic symptoms (7 of 15 plants) at 4-6 days post-inoculation (Figure S2 and 3). However, no symptoms were observed in maize plants following inoculation with leaf extracts from healthy goose grass. RT-PCR confirmed the presence of SCMV in the diseased maize plants. Sequencing analysis revealed that all amplified fragments shared 100% identity with the partial CP-encoding sequence of SCMV. Taken together these results support the presence of SCMV in symptomatic goose grass. To the best of our knowledge, this is the first report of SCMV in E. indica in China. In general, potyviruses can be easily transmitted in multiple ways including aphid vectors, grafting, and wounding. Therefore, investigating SCMV in goose grass is crucial for developing integrated strategies to prevent its transmission to economically important plants such as maize.

A statistical approach for identifying primary substrates of ZSWIM8-mediated microRNA degradation in small-RNA sequencing data.

BACKGROUND: One strategy for identifying targets of a regulatory factor is to perturb the factor and use high-throughput RNA sequencing to examine the consequences. However, distinguishing direct targets from secondary effects and experimental noise can be challenging when confounding signal is present in the background at varying levels. RESULTS: Here, we present a statistical modeling strategy to identify microRNAs that are primary substrates of target-directed miRNA degradation (TDMD) mediated by ZSWIM8. This method uses a bi-beta-uniform mixture (BBUM) model to separate primary from background signal components, leveraging the expectation that primary signal is restricted to upregulation and not downregulation upon loss of ZSWIM8. The BBUM model strategy retained the apparent sensitivity and specificity of the previous ad hoc approach but was more robust against outliers, achieved a more consistent stringency, and could be performed using a single cutoff of false discovery rate (FDR). CONCLUSIONS: We developed the BBUM model, a robust statistical modeling strategy to account for background secondary signal in differential expression data. It performed well for identifying primary substrates of TDMD and should be useful for other applications in which the primary regulatory targets are only upregulated or only downregulated. The BBUM model, FDR-correction algorithm, and significance-testing methods are available as an R package at https://github.com/wyppeter/bbum .

Profiling small RNAs in fecal immunochemical tests: is it possible?

Fecal microRNAs represent promising molecules with potential clinical interest as non-invasive diagnostic and prognostic biomarkers. Colorectal cancer (CRC) screening based on the fecal immunochemical test (FIT) is an effective tool for prevention of cancer development. However, due to the poor sensitivity of FIT especially for premalignant lesions, there is a need for implementation of complementary tests. Improving the identification of individuals who would benefit from further investigation with colonoscopy using molecular analysis, such as miRNA profiling of FIT samples, would be ideal due to their widespread use. In the present study, we assessed the feasibility of applying small RNA sequencing to measure human miRNAs in FIT leftover buffer in samples from two European screening populations. We showed robust detection of miRNAs with profiles similar to those obtained from specimens sampled using the established protocol of RNA stabilizing buffers, or in long-term archived samples. Detected miRNAs exhibited differential abundances for CRC, advanced adenoma, and control samples that were consistent for FIT and RNA-stabilizing buffers. Interestingly, the sequencing data also allowed for concomitant evaluation of small RNA-based microbial profiles. We demonstrated that it is possible to explore the human miRNome in FIT leftover samples across populations and envision that the analysis of small RNA biomarkers can complement the FIT in large scale screening settings.

MicroRNAs from Holarrhena pubescens stems: Identification by small RNA Sequencing and their Potential Contribution to Human Gene Targets.

Holarrhena pubescens is an effective medicinal plant from the Apocynaceae family, widely distributed over the Indian subcontinent and extensively used by Ayurveda and ethno-medicine systems without apparent side effects. We postulated that miRNAs, endogenous non-coding small RNAs that regulate gene expression at the post-transcriptional level, may, after ingestion into the human body, contribute to the medicinal properties of plants of this species by inducing regulated human gene expression to modulate. However, knowledge is scarce about miRNA in Holarrhena. In addition, to test the hypothesis on the potential pharmacological properties of miRNA, we performed a high-throughput sequencing analysis using the Next Generation Sequencing Illumina platform; 42,755,236 raw reads have been generated from H. pubescens stems from a library of small RNA isolated, identifying 687 known and 50 new miRNAs led. The novel H. pubescens miRNAs were predicted to regulate specific human genes, and subsequent annotations of gene functions suggested a possible role in various biological processes and signaling pathways, such as Wnt, MAPK, PI3K-Akt, and AMPK signaling pathways and endocytosis. The association of these putative targets with many diseases, including cancer, congenital malformations, nervous system disorders, and cystic fibrosis, has been demonstrated. The top hub proteins STAT3, MDM2, GSK3B, NANOG, IGF1, PRKCA, SNAP25, SRSF1, HTT, and SNCA show their interaction with human diseases, including cancer and cystic fibrosis. To our knowledge, this is the first report of uncovering H. pubescens miRNAs based on high-throughput sequencing and bioinformatics analysis. This study has provided new insight into a potential cross-species control of human gene expression. The potential for miRNA transfer should be evaluated as one possible mechanism of action to account for the beneficial properties of this valuable species.

Plasma exosomal microRNA expression profiles in patients with high-altitude polycythemia.

High-altitude polycythemia (HAPC) is a chronic mountain sickness characterized by multiple severe ill-effects. Its pathogenesis is still unclear, and till date, no study has been conducted to investigate the plasma exome profile of Tibetan patients with HAPC. In this study, we aimed to elucidate the pathogenesis of HAPC by determining the microRNA (miRNA) signatures. We compared the plasma exosome miRNA expression profiles of eight patients with HAPC and eight healthy controls using next-generation miRNA sequencing. Further, we extracted and identified plasma exosomes using transmission electron microscopy, nanoparticle tracking analysis, and western blotting. We used quantitative reverse-transcription polymerase chain reaction (qRT-PCR) to validate differentially expressed plasma exosomal miRNAs. Finally, we analyzed the diagnostic values of the differentially expressed miRNAs for HAPC using receiver operating characteristic (ROC) curves. We detected 2007 miRNAs from confirmed plasma exosomes, including 1342 known miRNAs and 665 newly predicted miRNAs. We verified the expression of the top 10 differentially expressed miRNAs via qRT-PCR. Patients with HAPC showed significantly upregulated hsa-miR-122-5p, hsa-miR-423-5p, hsa-miR-4433b-3p, hsa-miR-1291, and hsa-miR-106b-5p expression levels, while hsa-miR-200c-3p expression was downregulated. This study may provide background knowledge for future studies on HAPC studies, which may further facilitate the development of novel therapies against this common disease.

Multiomics analysis reveals a link between Brassica-specific miR1885 and rapeseed tolerance to low temperature.

Brassica crops include various edible vegetable and plant oil crops, and their production is limited by low temperature beyond their tolerant capability. The key regulators of low-temperature resistance in Brassica remain largely unexplored. To identify posttranscriptional regulators of plant response to low temperature, we performed small RNA profiling, and found that 16 known miRNAs responded to cold treatment in Brassica rapa. The cold response of seven of those miRNAs were further confirmed by qRT-PCR and/or northern blot analyses. In parallel, a genome-wide association study of 220 accessions of Brassica napus identified four candidate MIRNA genes, all of which were cold-responsive, at the loci associated with low-temperature resistance. Specifically, these large-scale data analyses revealed a link between miR1885 and the plant response to low temperature in both B. rapa and B. napus. Using 5' rapid amplification of cDNA ends approach, we validated that miR1885 can cleave its putative target gene transcripts, Bn.TIR.A09 and Bn.TNL.A03, in B. napus. Furthermore, overexpression of miR1885 in Semiwinter type B. napus decreased the mRNA abundance of Bn.TIR.A09 and Bn.TNL.A03 and resulted in increased sensitivity to low temperature. Knocking down of miR1885 in Spring type B. napus led to increased mRNA abundance of its targets and improved rapeseed tolerance to low temperature. Together, our results suggested that the loci of miR1885 and its targets could be potential candidates for the molecular breeding of low temperature-tolerant Spring type Brassica crops.

Investigating microRNAs in diabetic cardiomyopathy as tools for early detection and therapeutics.

To profile microRNAs population of glucose-induced cardiomyoblast cell line and identify the differentially expressed microRNAs and their role under pre-diabetes and diabetes condition in vitro. Rat fetal ventricular cardiomyoblast cell line H9c2 was treated with D-glucose to mimic pre-diabetic, diabetic, and high-glucose conditions. Alteration in cellular, nuclear morphology, and change in ROS generation was analyzed through fluorescent staining. Small RNA sequencing was performed using Illumina NextSeq 550 sequencer and was validated using stem-loop qRT-PCR. A large number (~ 100) differential miRNAs were detected in each treated samples as compared to control; however, a similar expression pattern was observed between pre-diabetes and diabetes conditions with the exception for miR-429, miR-101b-5p, miR-503-3p, miR-384-5p, miR-412-5p, miR-672-5p, and miR-532-3p. Functional annotation of differential expressed target genes revealed their involvement in significantly enriched key pathways associated with diabetic cardiomyopathy. For the first time, we report the differential expression of miRNAs (miR-1249, miR-3596d, miR- 3586-3p, miR-7b-3p, miR-191, miR-330-3p, miR-328a, let7i-5p, miR-146-3p, miR-26a-3p) in diabetes-induced cardiac cells. Hyperglycemia threatens the cell homeostasis by dysregulation of miRNAs that begins at a glucose level 10 mM and remains undetected. Analysis of differential expressed miRNAs in pre-diabetes and diabetes conditions and their role in regulatory mechanisms of diabetic cardiomyopathy holds high potential in the direction of using miRNAs as minimally invasive diagnostic and therapeutic tools.

Significance of microRNA-targeted ErbB signaling pathway genes in cardiomyocyte differentiation.

OBJECTIVE(S): Cardiomyocyte differentiation is a complex process that follows the progression of gene expression alterations. The ErbB signaling pathway is necessary for various stages of cardiac development. We aimed to identify potential microRNAs targeting the ErbB signaling pathway genes by in silico approaches. METHODS: Small RNA-sequencing data were obtained from GSE108021 for cardiomyocyte differentiation. Differentially expressed miRNAs were acquired via the DESeq2 package. Signaling pathways and gene ontology processes for the identified miRNAs were determined and the targeted genes of those miRNAs affecting the ErbB signaling pathway were determined. RESULTS: Results revealed highly differentially expressed miRNAs were common between the differentiation stages and they targeted the genes involved in the ErbB signaling pathway as follows: let-7g-5p targets both CDKN1A and NRAS, while let-7c-5p and let-7d-5p hit CDKN1A and NRAS exclusively. let-7 family members targeted MAPK8 and ABL2. GSK3B was targeted by miR-199a-5p and miR-214-3p, and ERBB4 was targeted by miR-199b-3p and miR-653-5p. miR-214-3p, miR-199b-3p, miR-1277-5p, miR-21-5p, and miR-21-3p targeted CBL, mTOR, Jun, JNKK, and GRB1, respectively. MAPK8 was targeted by miR-214-3p, and ABL2 was targeted by miR-125b-5p and miR-1277-5p, too. CONCLUSION: We determined miRNAs and their target genes in the ErbB signaling pathway in cardiomyocyte development and consequently heart pathophysiology progression.

Detection of microRNAs expression signatures in vitreous humor of intraocular tuberculosis.

BACKGROUND: MicroRNA (miRNA) expression analysis has been shown to provide them as biomarkers in several eye diseases and has a regulatory role in pathogenesis. However, miRNA expression analysis in the vitreous humor (VH) of intraocular tuberculosis (IOTB) is not studied. Thus, we aim to find miRNA expression signatures in the VH of IOTB patients to identify their regulatory role in disease pathogenesis and to find them as potential biomarkers for IOTB. METHODS AND RESULTS: First, we profiled miRNAs in VH of three IOTB and three Macular hole (MH) samples as controls through small-RNA deep sequencing using Illumina Platform. In-house bioinformatics analysis identified 81 dysregulated miRNAs in IOTB. Further validation in VH of IOTB (n = 15) compared to MH (n = 15) using Real-Time quantitative PCR (RT-qPCR) identified three significantly upregulated miRNAs, hsa-miR-150-5p, hsa-miR-26b-5p, and hsa-miR-21-5p. Based on the miRNA target prediction, functional network analysis, and RT-qPCR analysis of target genes, the three miRNAs downregulating WNT5A, PRKCA, MAP3K7, IL7, TGFB2, IL1A, PRKCB, TNFA, and TP53 genes involving MAPK signaling pathway, PI3K-AKT signaling pathway, WNT signaling pathway, Cell cycle, TGF-beta signaling pathway, Long-term potentiation, and Sphingolipid signaling pathways, have a potential role in disease pathogenesis. The ROC analysis of RT-qPCR data showed that hsa-miR-150-5p with AUC = 0.715, hsa-miR-21-5p with AUC = 0.789, and hsa-miR-26b-5p with AUC = 0.738; however, the combination of hsa-miR-21-5p and hsa-miR-26b-5p with AUC = 0.796 could serve as a potential biomarker for IOTB. CONCLUSIONS: This study provides the first report on miRNA expression signatures detected in VH for IOTB pathogenesis and also provides a potential biomarker for IOTB.

First Report of Broad Bean Wilt Virus 2 Infecting Balsam (Impatiens balsamina) in China.

Balsam (Impatiens balsamina L.) is an ornamental plant cultivated extensively in China and elsewhere, but it has also been used as a medicinal plant for thousands of years (Qian et al., 2023). In 2022, an examination of 10 garden-grown I. balsamina plants in Chaoyang, Beijing, China revealed eight plants with blotches, mosaic symptoms, and deformed leaves (Fig. S1A). Total RNA was extracted from the symptomatic leaf tissue of these eight plants using the TRIzol reagent (Invitrogen, USA). Four RNA preparations (high quality and quantity) were combined for the small RNA sequencing analysis (TIANGEN Biotech Co., China). A total of 16,509,586 clean reads (18-30 nt) were obtained and assembled into larger contigs using Velvet 1.0.5. A search of the National Center for Biotechnology Information non-redundant database using BLASTX indicated 72, 24, and 19 contigs were homologous to broad bean wilt virus 2 (BBWV2), cucumber mosaic virus (CMV), and impatiens cryptic virus 1 (ICV1) sequences (Zheng et al., 2022), respectively. To verify the next-generation sequencing data, the following three sets of primer pairs were designed according to the contig sequences of these three viruses: CMV-F:5'-ATGGACAAATCTGAATCAACCAGTGC-3'/CMV-R: 5'-CCGTAAGCTGGATGGACAACC-3'; BBWV2-F:5'-CAATTTGGACAACTACAATTTGCC-3'/ BBWV2-R: 5'-GCTGAGTCTAAATCCCATCTATC-3'; and ICV1-F: 5'-CGCACAACT CTACAAT GACATGGTC-3'/ICV1-R: 5'-AGTTCCATCGTCCAGTAGGCG-3'. The primers were used to amplify CMV, BBWV2, and ICV1 sequences by reverse transcription-polymerase chain reaction (RT-PCR), with individual RNA preparations serving as the template. The CMV, BBWV2, and ICV1 target sequences were amplified from eight, four, and four samples, respectively (Fig. S1B). To evaluate virus infectivity, Nicotiana benthamiana seedlings were inoculated using a leaf tissue extract prepared from an infected I. balsamina plant. At 7 days post-inoculation, disease symptoms were detected on N. benthamiana systemic leaves (e.g., deformation and apical necrosis) (Fig. S1C). Confirmation tests involving RT-PCR indicated the N. benthamiana plants were infected with BBWV2 and CMV, but not with ICV1 (Fig. S1D). To obtain the complete BBWV2 genome sequence (RNA1 and RNA2), virus-specific PCR primers (Table S1) were designed to produce the terminal sequences via 5' and 3' rapid amplification of cDNA ends (RACE), which was completed using the SMARTer RACE 5'/3' Kit (Clontech, China). The RNA1 and RNA2 sequences comprised 5,957 nt (GenBank: OQ857921) and 3,614 nt (GenBank: OQ857922), respectively. The BLAST analyses revealed RNA1 and RNA2 were similar to sequences in other BBWV2 isolates (sequence identities of 78.88% to 95.15% and 80.83% to 91.51%, respectively). Using the neighbor-joining method and MEGA 7.0, the phylogenetic relationships between the BBWV2 isolated in this study and other isolates were determined on the basis of the full-length RNA1 and RNA2 sequences (Kumar et al., 2016). According to the RNA1 and RNA2 sequences, the BBWV2 isolated in this study was most closely related to the BBWV2 isolate from Gynura procumbens (GenBank: KX686589) and the BBWV2 isolate from Nicotiana tabacum (GenBank: KX650868), respectively (Fig. S1E). To the best of our knowledge, this is the first report of I. balsamina naturally infected with BBWV2 in China. The study findings may be useful for detecting BBWV2 in I. balsamina and for diagnosing and managing the associated disease. The authors declare no conflict of interest. Yanhong Qiu and Haijun Zhang contributed equally to this paper. Funding: This research was supported by the Beijing Academy of Agriculture and Forestry Foundation, China (KYCX202305, QNJJ202131, and KJCX20230214). References: Qian H.Q., et al. 2023. J Ethnopharmacol. 303. Zheng Y., et al. 2022. Arch Virol. 167: 2099-2102. Kumar et al. 2016. Mol Biol Evol. 33: 1870-1874.

Occurrence of Watermelon silver mottle virus in Peanut in China.

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.