Novel report of Bipolaris heliconiae causing frog-eye-like leaf spot on Dypsis lutescens in Indian Sub-Continent.

Dypsis lutescens, commonly known as areca palm, is a highly valued ornamental species due to its aesthetic value. However, the foliage is vulnerable to various pathogens, particularly those responsible for fungal leaf spot diseases. In October 2023, a severe incidence (93 %) of destructive leaf spots was recorded on Dypsis lutescens at the University of Agricultural Sciences, GKVK, Bangalore, and surrounding areas. The leaf spot symptoms manifested as frog-eye-like lesions, leading to complete leaf desiccation and significantly reducing the palms ornamental value. The pathogen exhibited the highest radial growth (90.00 mm) and prominent sporulation on oat meal agar, whereas Richard's synthetic agar resulted in the lowest radial growth (38.00 mm) with no sporulation. Morphological and multilocus phylogenetic analyses confirmed the pathogen as Bipolaris heliconiae. Pathogenicity tests fulfilled Koch's postulates, confirming that Bipolaris heliconiae is the causative agent of leaf spot disease in Dypsis lutescens in India. This novel finding underscores the emergence of a new disease and highlights the urgent need for effective management strategies.

First report of Helicotylenchus dihystera parasitizing Lady Tankerville orchids (Phaius tankervilleae) in Vietnam.

Lady Tankerville, a rare orchid species (Phaius tankervilleae (Banks ex L'Hér.) Blume) in Vietnam, not only enhances the aesthetic value of the surroundings with its enchanting blooms but also holds high economic value (Aver'janov & Averyanova, 2003). Investigating the necrosis symptom on the root system and declined Lady Tankerville in the market in Hai Duong province in Vietnam from 11/2020 to 12/2021, we discovered a substantial infestation (24/24 plants were infected) of a spiral nematode, Helicotylenchus sp. The nematode population was extracted from the rhizosphere soil, roots, and stems of a single orchid using the modified Baermann tray technique (Whitehead & Hemming, 1965), for thorough characterization. The average nematode density was measured at 525±85 (350-670) nematodes/250 cm3 of soil, 202±56 (198-264) nematodes/15 g of roots, and 80±15 (72-95) nematodes/15 g of stem. Two hundred nematodes from the same population were inoculated into another healthy orchid for preservation and further infection tests. This species was morphologically identified as Helicotylenchus dihystera according to the key of Fotedar and Kaul (1985) and the description of Sher (1966). Morphometric measurements of the females (n = 12) are as follows: body length = 632-725 (681 ± 32) µm; a = 24-34 (28 ± 3); b = 5.1-7.2 (6.0 ± 0.6); b' = 4.3-6.4 (5.3 ± 0.6); c = 33-46 (39 ± 5); c' = 1.1-1.4 (1.2 ± 0.1); V = 62-78 (65 ± 4)%; O = 30 -49 (39 ± 6); stylet length = 21-26 (24 ± 2) µm; DGO = 9.2-12.4 (10.8 ± 1.1) µm. To validate morphological observations, molecular analyses of the ITS (Vrain et al., 1992) and the D2-D3 of 28S rRNA (Subbotin et al., 2006) were conducted. The ITS and D2-D3 sequences from this study (accession number: PP060444 and PP033748) exhibited the highest similarity of 99.8% and 100% to the sequence of H. dihystera in GenBank (KM506885 and MW023215), respectively. The infection test took place in a greenhouse at 28 ± 2℃. Three-month-old Phaius tankervilleae (n=8) were individually grown in 15 x 15 cm deep pots filled with sterilized sand and inoculated with 500 gravid females of H. dihystera (Rashid & Azad, 2013). Two noninoculated plants served as controls. After 60 days of inoculation, symptoms such as sunspots and root necrosis, observed in the market, appeared in the tested plants (Fig. S1). The presence and diagnosis of H. dihystera infestation in soil, roots, and stems across growth stages of orchids indicates the nematode to be an obligate parasite. The nematodes penetrate the roots, causing characteristic necrotic lesions initially yellow, then turn reddish-brown to black, along with brown root flecks in discolored tissues. Heavy infestations post-flowering led to extensive necrosis, distortion, and decay of the roots. The average reproduction factor (final population/initial population) of H. dihystera in this study was 22.2. Control plants remained symptom-free. Notably, 100% of tested plants were infected, highlighting the severe impact of H. dihystera. The nematodes were successfully reisolated and identified as H. dihystera through molecular analyses (accession number: PP060615 (ITS) and PP033748 (D2-D3)), reaffirming its identity. In addition to 32 host plants in Vietnam (Nguyen et al., 2023), our study reveals a strain of H. dihystera parasitizing Lady Tankerville orchids with a relatively high reproduction factor and infection rate. This marks the first reported instance of H. dihystera parasitizing Lady Tankerville orchids in Vietnam, emphasizing the need for proactive measures to protect this plant.

First report of Lasiodiplodia pseudotheobromae causing soft rot of plum in China.

Plum (Prunus salicina) is one of the most important fruit tree species worldwide (Valderrama-Soto et al. 2021). In June 2023, the postharvest soft rot symptoms were observed on plum fruits in several fruit markets of Guiyang city, Guizhou province, China. The disease incidence in these markets ranged from 20 to 25% with 70% disease severity. Plum fruits showed rotting, which was characterized by water soaked fruit tissue, softening and presence of whitish mycelia four days post inoculation. In severe conditions, whole fruits become rotted and were covered with white fungal mycelia. Small sections (5 × 3 mm) from 6 diseased plum fruits were surface sterilized by using 75% ethanol for 30 s followed by 0.1% mercuric chloride solution for 5 min, rinsed three times with ddH2O, and then transferred onto potato dextrose agar (PDA) and incubated at 25 ± 2°C for three days. Three pure cultures (GUCC23-0001 to GUCC23-0003) were obtained by transferring a single hyphal tip to new PDA plates. Colonies of these isolates were grayish-white initially, gradually turning to whitish brown with fluffy aerial mycelia and uneven edges and finally turned to a dark gray colony after five days of inoculation. The pseudoparaphyses were hyaline, cylindrical, aseptate, and rounded at apex. Conidia were ellipsoidal, hyaline, unicellular, and 24.2 to 28.6 × 12.3 to 15.5 µm in size (n = 30) (Fig. S1), which were similar to the morphology of Lasiodiplodia pseudotheobromae (Alves et al. 2008). Furthermore, fungal DNA was extracted from fresh mycelia of PDA after seven days by using fungus genomic DNA extraction kit (Biomiga, USA). Partial DNA sequences from four loci including internal transcribed spacer (ITS), translation elongation factor 1-alpha (tef1), beta-tubulin (tub2), and polymerase II second largest subunit (rpb2) were amplified with ITS1 and ITS4 (White et al. 1990), EF1-688F and EF1-1251R (Alves et al. 2008), Bt2a and Bt2b (Glass and Donaldson 1995), and RPB2-LasF and RPB2-LasR, respectively (Cruywagen et al. 2017). GenBank accession numbers are OR361680, OR361681, OR361682 for ITS, OR423394, OR423395, OR423396 for tef1, OR423397, OR423398, OR423399 for tub2, and OR423391, OR423392, OR423393 for rpb2, and gene sequencing showed 99.6 to 100% identity with ex-type strain of L. pseudotheobromae (CBS 116459). Phylogenetic analysis also placed our isolates in a highly supported clade with the reference isolate of L. pseudotheobromae (Fig. S2). Another experiment was designed to confirm the pathogenicity test for additional confirmation. Five mm mycelial plugs of L. pseudotheobromae from a three day old culture on PDA were placed on five surface-sterilized and non-wounded plum fruits for 12 hours and incubated at 25°C ± 2°C for four days. Sterilized fungus free PDA plugs were used as a negative control. Mycelial plugs were removed after 12 hours following which whole fruits were incubated in plastic boxes at 25°C ± 2°C. The experiment was repeated twice. The pathogenicity was evaluated under control conditions in laboratory (relative humidity, 70 ± 5% and temperature 25 ± 5˚C). Plum fruits showed rotting, which was characterized by water soaked fruit tissue, softening and presence of whitish mycelia four days post inoculation. These symptoms and signs were similar to the initially observed symptoms on plums in the markets. No disease symptoms were observed on the control fruits. The re-isolated fungus obtained from inoculated plum fruits was very similar to those isolated from diseased samples in morphology, fulfilling Koch's postulates. To the best of our knowledge, this is the first report of L. pseudotheobromae causing postharvest fruit rot of plum in China. In 2022, the total planting area of plum was 1946.5 thousand hectares, which produces approximately 6626300 tons of plum (Food and Agriculture Organization of the United Nations, 2022). Based on the disease incidence and severity reported in the current study, soft rot of plum may be responsible for nearly 35% of yield losses under severe. Therefore, our study laid a theoretical foundation for the prevention and control of this post-harvest disease of plum.

First Report of Rhizoctonia solani AG1-IB Causing Tobacco Target Spot in China.

Tobacco target spot, caused by Rhizoctonia solani Kühn, induces shot-hole lesions on leaves that that significantly reduce yield and quality of tobacco. In July 2022, samples (n=5) with target spot were collected from three tobacco fields, one each in Puer (22.63°N, 100.72°E, cv. Yunyan87) and Mengzi (23.26°N, 103.36°E, cv. Yunyan87) of Yunnan province and one in Dandong (40.63°N, 124.18°E, cv. Liaoyan17) of Liaoning province, China; disease incidence in these fields was approximately 30%~40%. Initial symptoms (2- to 3-mm-diameter lesions) appeared on the middle to lower leaves, then expanded to 2 to 3 cm in diameter and developed the shot-hole appearance. Pieces of tissue (5×5 mm) were cut from the edge of lesions, surface sterilized, rinsed in sterile water, then placed on the surface of water agar (WA) and incubated at 25℃ for 2 days in the dark. Single hyphal tips were taken from fungal isolates identified as R. solani based on the morphological traits (Tsror 2010), then transferred onto potato dextrose agar (PDA) and cultured for 3 d as described above. A total of 15 pure cultures were obtained. With the exception of YN-3 (isolated from Puer), YN-62 (isolated from Mengzi) and LN-95(isolated from Dandong) strains, which exhibited hyphal fusion reaction with AG1-IB standard strain, all the other strains demonstrated hyphal fusion with AG-3 standard strain (Ogoshi 1987). Genomic DNA of these three strains were extracted by the CTAB method and ITS regions of rDNA were sequenced (White et al. 1990). The sequences were deposited in GenBank with accession No. OR770079, OR770080 and OR770082. All the three rDNA-ITS sequences exhibited 99.85% similar to AG1-IB found in GenBank, and a phylogenetic tree using a neighbor-joining method grouped the three strains within the R. solani AG-1 IB clade. Therefore, based on the hyphal fusion reaction and molecular methods, these isolates were identified as R. solani AG1-IB. To determine pathogenicity of the isolates, the healthy leaves of tobacco plants (cv. Yunyan 87) were used. Five-mm-diameter mycelial plugs of the strain on PDA were inoculated on leaves that had been previously wounded with a sterile needle, and cotton balls moistened with sterile water were used for moisturizing the inoculation sites. Ten leaves were inoculated for each strain and leaves inoculated with PDA plugs were as control. The experiment was conducted twice. All plants were incubated for 2 d at 15℃ to 25℃ and 90% relative humidity with a 12 h photoperiod/day. Irregularly shaped lesions appeared on the leaves around each of the inoculated sites, but not on control leaves. The pathogens were reisolated and confirmed be R. solani AG1-IB by hyphal fusion and molecular identification tests as previously described, thereby fulfilling Koch's postulates. It has been reported that AG-3, AG-2 (Mercado Cardenas et al. 2012), AG-5 (Wang et al. 2023) and AG-6 (Sun et al. 2022) of R. solani could cause tobacco target spot, but AG-3 is considered the main causal agent (Marleny Gonzalez et al. 2011). To our knowledge, this is the first report of AG1-IB causing tobacco target spot in China and worldwide. The AG1-IB strain has a wide host range including cabbage, mint, lettuce, beans, and rice (Gonzalez et al. 2006). The discovery poses a new challenge for the prevention and control of tobacco target spot, especially when contemplating disease management strategies such as crop rotation and fungicide treatments.

First report of Fusarium culmorum (W.G. Sm.) Sacc causing crown rot on wheat in Jordan.

Fusarium crown rot (FCR) is a disease caused by numerous Fusarium species, primarily F. culmorum (W. G. Sm.) Sacc., F. pseudograminearum (O'Donnell & T. Aoki), and F. graminearum Schwabe (Paulitz et al., 200). FCR on wheat is a worldwide distributed disease that causes significant yield losses. In the Middle East, FCR was reported in Iraq (Motallebi et al., 2015; Matny et al., 2019) and Syria (Motallebi et al., 2015). In Jordan, Fusarium occurrence on wheat was documented in a checklist publication in 1984 (Mamluk et al., 1984) without further identification of the causative species and its pathogenicity level. There have been no other reports of Fusarium on wheat in Jordan since then. Symptoms of Fusarium crown rot were observed in 2016-2022 (Alananbeh et al., 2018) across Jordan through annual surveys of wheat diseases. The disease severity was higher in the dry seasons such as that of 2017 and 2021. Very severe symptoms were noted on wheat planted at the University of Jordan experimental wheat plots (n=4) in 2016-2022. A total of 40 symptomatic plants were randomly collected from these plots. Roots and stems of the 40 plants were then cut into small sections, disinfected in 0.5% hypochlorite for 5 minutes, 70% ethanol for one minute, and finally rinsed in sterile distilled water three times. The sections were dried under the laminar flow, plated on potato dextrose agar (PDA), and incubated for 10 -14 days at 25 ℃. The fungal cultures were purified by hyphal tipping. At least one pure isolate exhibited a typical morphology of F. culmorum was recovered from each plant. The colonies of pure cultures grew rapidly on PDA with fluffy floccose aerial mycelium and dark red to reddish brown pigment diffused in the agar. The isolates produced monophialidic conidiogenous cells. The formed marcoconidia were slightly curved, with pointed apical and foot cells, 3-5 septated, on average 28.5 - 46.5 X 4.5-7.0 µm, indication the cultures as Fusarium spp. (Figure 1). Chlamydospores were intercalary in hyphae and microconidia were absent. Two representative isolates (Iso-1 and Iso-2) identified putatively as F. culmorum, based on their morphological features, were sent to Macrogen Inc., South Korea to Sanger sequence a portion of the translation elongation factor 1-α gene using the EF1/EF2 primers (Geiser et al. 2004). Raw sequences were used to create consensus sequences using the BioEdit sequence alignment editor. The consensus sequences for the two representatives isolates were used to conduct BLASTn queries of NCBI (https://www.ncbi.nlm.nih.gov) which revealed they are 99.67% and 100% identical to MW233082.1, a TEF11-α sequence of the ex-epitype of F. culmorum (NRRL 25475, Crous et al. 2021). The two sequences generated herein were accessioned in GenBank (accession numbers: OQ785278 and OQ785279). Combined with the morphological and molecular analysis, the Iso-1 and Iso-2 were identified as Fusarium culmorum. The pathogenicity of the isolates was tested on two wheat cultivars using two methods: in vitro on seeds grown in sterile dishes and on seedlings. A 4 X 104 macroconidia suspension was prepared from 10 day-old culture of the isolate grown on PDA at 28 ºC. Seeds of two wheat cultivars, Hourani and Norsi were surface sterilized in 1% (v/v) bleach and rinsed in sterile distilled water three times. For the first method, seeds were soaked in the F. culmorum conidia suspension for 15 min and then dried using filter paper. The seeds were plated onto sterile paper towels in sterile plastic boxes and placed in a growth chamber. Three replicates with 10 seeds/replicate were used. Control Mock treatments used seeds treated with sterile distilled water. The germination percentage, coleoptile length, radicle length, longest seminal root length, and number of seminal roots were measured after 5 days. For the seedling-based pathogenicity test, seeds were planted in seedlings trays filled with sterilized 1:1:1 peat moss: sand: soil. 5 mL conidia suspension was drenched following seedling emergence. Ten replicates with one seed/replicate were used. Plants were watered when necessary to maintain appropriate soil growth conditions. The control seedlings were drenched with sterile distilled water. Disease symptoms were rated by the disease severity index (CRI) described by Mitter et al. (2006) after 35 days of inoculation. The in vitro test showed a reduction of germination and other seeds measurements in the presence of F. culmorum as compared to the control (Table 1 and Table 2, Figure 2). Similarly, the seedling's height, length of discoloration, disease score, disease severity index and germination percentage were all reduced in F. culmorum treated seedlings compared to the control. The two experiments showed that Cv. Norsi was more susceptible to FCR than Hourani (Table 1, Figure 2). F. culmorum was re-isolated from the roots of inoculated plants of both cultivars. The present study is the first report of the crown rot pathogen, F. culmorum on Jordanian wheat. Fusarium culmorum can cause significant economic losses and current research is ongoing to survey FCR-associated Fusarium spp. in Jordan, their genetic diversity, and QTL mapping for resistance genes in wheat landraces.

First report of black leaf streak disease in bananas caused by Pseudocercospora fijiensis on Mauritius island.

Pseudocercospora fijiensis, the causal agent of the black leaf streak disease of bananas (plants in the genus Musa) (BLSD), is considered to be the major economic threat to export-banana cultivation (de Bellaire, Fouré, Abadie, & Carlier, 2010). The disease has a worldwide distribution throughout the humid tropical regions and has been previously reported in the Southwestndian Ocean (SWIO) area: in 1993 in Mayotte and Comoros islands (DR Jones & Mourichon, 1993), in 2000 in Madagascar (Jones, 2003; Rivas, Zapater, Abadie, & Carlier, 2004) and in 2018 in Reunion Island (Rieux et al., 2019). In Mauritius, the presence of Pseudocercospora fijiensis was suspected in 1996 (Soomary & Benimadhu, 1998) but has never been confirmed, as symptoms could have been confounded with Pseudocercospora musae or Pseudocercospora eumusae, two causal agents of others leaf spot diseases of banana which were previously described in Mauritius in 1959 (Orieux & Felix, 1968) and 2000 (Carlier, Zapater, Lapeyre, Jones, & Mourichon, 2000), respectively. In March 2022, typical BLSD symptoms were observed at relatively low prevalence in a Cavendish crop located in the "Balance John" area (site S1 on Fig. S1-A) of Mauritius island. Typical early symptoms (stages 2) were 1- to 4-mm long brown streaks at the abaxial leaf surface, and typical older streaks (stages 3 and 4) were also observed (Fig. S1-B). These symptoms were mixed with symptoms of ELSD caused by P. eumusae. Since both species cannot be clearly distinguished only on the description of symptoms, conidial sporulation on stages 2 was checked in the laboratory (Ngando et al., 2015) since P. eumusae does not produce conidia on these young stages. In April 2022, banana leaves bearing symptoms of leaf spot diseases were collected in 7 different sites (Fig. S1-A). All leaf fragments were sent to the CIRAD laboratories where molecular diagnosis was performed following the protocol developed by Arzanlou et al. (2007). In brief, genomic DNA was extracted from ground leaf fragments displaying symptoms using the DNeasy® Plant Mini Kit (Qiagen®, Courtaboeuf, France). At each site, a total of 6 lesions cut from 6 different leaves were pooled. The DNA extracts were added as templates for real-time PCR assay designed to specifically detect the presence of P. fijiensis, P. musae and P. eumusae using MFbf/MFbrtaq/MFbp, MEbf/MEbrtaq/FMep and MMbf/Mmbrtaq/FMep primers and probes, respectively (Arzanlou et al., 2007). Both positive and negative controls were included in the assay and every sample reaction was duplicated. P. fijiensis was detected from 2 out of 7 sites (S2 and S7, see Fig.S2-B). P. eumusae was detected at all sites while P. musae was found in one site only (S6). Interestingly, our results also showed coinfection by P. fijiensis - P. eumusae & P. musae - P. eumusae on several sites. The presence of P. fijiensis was further confirmed by several investigations performed on conidia isolated from S2 samples including i) morphological observations of conidia displaying P. fijiensis type description (Pérez-Vicente, Carreel, Roussel, Carlier, & Abadie (2021), Fig. S2-A), ii) DNA sequencing of 16S ribosomal gene with ITS1 & ITS4 primers (GenBank accessions Nos. OR515818-OR515810) with BLAST results displaying percentages of identity > 99.70% with type strains and iii) Koch's postulates were fulfilled by artificial inoculation of detached leaf pieces as described in Pérez-Vicente, Carreel, Roussel, Carlier, & Abadie (2021) (Fig. S2-D). In brief, for the artificial inoculation, symptoms obtained after inoculation of both a strain isolated in Mauritius (S2-MAU) and a positive control (T+) were compared and shown to be typical of P. fijiensis species for the 3 replicates. To the best of our knowledge, this is the first official report of P. fijiensis and BLSD in Mauritius Island. This revelation holds significant importance for both the agricultural and scientific communities, shedding light on the potential spread and impact of this devastating pathogen in previously unaffected regions. From a global perspective, this discovery underscores the interconnectedness of agricultural ecosystems and the need for vigilance in monitoring and responding to emerging plant diseases in an increasingly interconnected world (Vega et al. 2022). Future investigations will be required to monitor the spread of BLSD on the island, describe the genetic structure of populations and identify routes of invasion at the SWOI scale.

First Report of Leaf Spot on Zanthoxylum bungeanum Caused by Nigrospora sphaerica in China.

Zanthoxylum bungeanum Maxim., a deciduous shrub in Zanthoxylum genus of the Rutaceae family, has not only highly economical values as condiment and medicine, but also significantly ecological values in soil and water conservation. In March 2023, a typical leaf spot disease on Z. bungeanum (Variety "Xiao Qingjiao") was observed in the field with an area of 26.68 ha with 35% incidence and 25.4% disease intensity in Zhenfeng County (25°38'57.60″ N, 105°64'98.64″ E, 1,156 m), Guizhou Province, China. The symptom leaves showed as irregularly shaped necrotic lesions, brown to dark brown with black margin. 30 samples with typical symptoms were collected and cut into 0.5 cm × 0.5 cm pieces. Their surfaces were disinfected with 1.5% NaClO for 2 min followed by 75% ethanol for 35 s, rinsed three times with sterile distilled water, finally incubated on PDA plates at 27°C. A total of 36 isolates were obtained through single-spore cultivation. The colonies on PDA were fluffy with abundant aerial mycelia and covered the whole plates (diameter 90 mm) in 7 days. Conidia were brown to black, single-celled, smooth, spherical or oblate, 12.0-17.0 × 12.5-18.5 µm (av. = 14.5 × 15.5 µm, n = 50) and grew on a colorless transparent vesicle at the apical cell of conidiophores. The morphological characteristics were similar with N. sphaerica (Wang et al. 2017). The 5.8S DNA (ITS), translation elongation factor 1-alpha (TEF1-α) and ß-tubulin (TUB2) genes were amplified with primers ITS4/ITS5, EF1-728F/EF2, and BT2A/BT2B, respectively (White et al. 1990; Carbone and Kohn 1999, O'Donnell et al. 1998; Glass and Donaldson 1995). The ITS, TEF1-α and TUB2 sequences of two randomly selected isolates, GUCC 21-187 and GUCC 21-235, had > 99% nucleotide identities (ITS: 99.60% (504/506 bp, OR646539) and 99.61% (506/508 bp, OR640300); TEF: 100% (470/470 bp, OR654285) and 100.00% (471/471 bp, OR654286); TUB: 100.00% (408/408 bp, OR661269) and 99.52% (411/413 bp, OR661270), respectively) with those sequences of N. sphaerica (LC 7294) in GenBank (KX985932, KY019397 and KY019602, respectively). The phylogenetic tree based on sequences of ITS, TEF1-α and TUB2 indicated that GUCC 21-187 and GUCC 21-235 were most closely related to N. sphaerica (LC 7294), supported with 100%/100%/1 bootstraps. Based on morphological characteristics and molecular datasets analyses, the isolates were identified as N. sphaerica. 10 healthy 2-years-old Z. bungeanum plants were sprayed with conidial suspensions (1 × 106 conidia/mL) of the isolates and the other 5ere sprayed with sterile water as the controls, all the treated plants were cultivated in a glasshouse at 25°C under 85% relative humidity. Typical leaf spot symptoms appeared on inoculated Z. bungeanum plants after 8 days, while the control plants remained asymptomatic. N. sphaerica was re-isolated from the lesions of inoculated plants and identified by morphological and molecular identification. Pathogenicity test was performed three times with analogous results, fulfilling Koch's postulates. N. sphaerica had been reported as a common pathogen on a variety of plants including sugarcane, kiwifruit and blueberry (Cui et al. 2018; Chen et al. 2016; Wright et al. 2008). To our knowledge, this is the first report of leaf spot disease caused by N. sphaerica on Z. bungeanum in China. Our report would be helpful to Z. bungeanum growers to recognize this leaf spot disease, and corresponding measures could be taken to minimize or avoid the economic losses caused by it.

First report of wheat dwarf bunt caused by Tilletia controversa Kühn in Pakistan.

Wheat (Triticum aestivum L.) is critical to food security worldwide. Wheat dwarf bunt is caused by Tilletia controversa Kühn and can cause 70-80% losses under severe condition (Trione et al. 1989; Xu et al., 2021). In May 2022, we observed dwarf bunt disease in six fields grown with spring cultivar (Glaxy-13) in District Swat, KPK-Pakistan. Infected plants had mottling and flecking on leaves, a greater number of tillers and were smaller than healthy plants. Diseased wheat head spikes were larger, wider and thicker, had bunted kernels (sori) filled with brown-black teliospores and a strong odor like that of rotten fish. Individual fields showed 10% infected plants while no dwarf bunt was recorded in nearby fields. About 150 heads exhibiting bunted kernels were collected among the six fields. Kernels were surface sterilized with 30% NaClO for 5 min after crushing by a centrifuge machine and washed with ddH20 three times. The teliospore suspension (1×106 spores/mL) was spread on 2% soil agar plates in a growth chamber (MLR 352 H, Panasonic, USA) and incubated at 5°C with 60% relative humidity for 60 days to test for T. controversa germination or at 16°C and 60% relative humidity for 15 days (MLR 352 H, Panasonic, USA) to test for T. caries and T. laevis germination. Teliospores germinated only on plates kept at 5°C. Teliospores were morphologically identified as a T. controversa from the infected samples. They ranged in size from 15.0 to 20.5 µm diam. and the walls had deep reticulations surrounded by a transparent sheath, differing from T. laevis which has smooth teliospores and T. caries which has no sheath and reticulations on the surface (Mathre 1996). To further confirm Tilletia spp. identification, genomic DNA of our two isolates (gmd123 and gmd1234) was obtained using an extraction kit (TransGen, Beijing, China). The internal transcribed spacer (ITS) region was amplified by using ITS1/4 (White et al. 1990). A BLAST search with GenBank accession no. OR366448 and OR366450 provided additional evidence the isolates belong to the complex of species that includes the three bunt species causing diseases on wheat, with 100% matches to verified sequences for T. controversa (eg. EU257561) but also to T. laevis and T. caries. Based on disease symptoms, teliospore morphology, germination at 5°C but not at 16°C, the bunt fungus was identified as T. controversa. To fulfill Koch's postulates, 10 mL (106 spores/mL) of germinated teliospores were injected into rhizosphere soil of Galaxy-13 cultivar at 2 leaves unfolded growth stage (Zadoks 12) and 2 mL (106 spores/mL) were injected into heads of same plants at growth stages Zadoks 61-65 with a syringe. Plants injected with sterile ddH2O were used as a control. Inoculated plants were grown in a growth chamber at 8°C with 50% humidity and 24 h light. After one month at the ripening stage, the bunted kernels of the inoculated plants were filled with black teliospores releasing a fishy smell, and the control plants did not have bunted kernels. Under an optical microscope, teliospores from the inoculated plants had reticulation surface and were measured 15 to 20.5 µm in diameter, similar to the teliospores of bunt heads from the fields. To the best of our knowledge, this is the first report of T. controversa causing dwarf bunt in district Swat, KPK-Pakistan. Because the pathogen is seedborne and soilborne, the disease may become a high risk to wheat production in Pakistan. Therefore, detection of this pathogen is very important to control the disease on time.

First report of root rot caused by Fusarium commune on American ginseng (Panax quinquefolium L.) in China.

American ginseng (Panax quinquefolium L.) is one of the most valuable herb crops because of its unique pharmacological effects. In 2019, American ginseng plants withered and root rot with incidences of 20-45% were observed in about 70000m2 of ginseng production field located in mountainous valley of Benxi city (41º23'32" N, 124º04'27" E), Liaoning Province in China. Disease symptoms included chlorotic leaves with dark brown discoloration extending gradually from the basal to the apical part of the leaves. Water-soaked, irregular lesions appeared on the surface of roots and rotten at later stage. Twenty-five symptomatic roots were surface-sterilized by immersion in 2% sodium hypochlorite (NaOCl) for 3 min, followed by rinsing three times in sterilized water. The sections healthy tissues bordered rotten tissues, i.e. the leading edge, were cut into 4-5 mm pieces with a sterile scalpel and 4 pieces were placed on each PDA plate. After 5 days incubation at 26°C, total of 68 single spores were obtained from the colonies with an inoculation needle under stereomicroscope. Colonies from single conidia were white to greyish white, densely floccose to fluffy, and the reverse grayish yellow with dull violet pigmentation. Single-celled and ovoid microconidia in false heads were borne on aerial monophialidic or polyphialidic conidiophores on Carnation Leaf Agar (CLA) media, and measured 5.0 -14.5 × 3.0 -4.8 µm (n=25). Macroconidia were two to four septa, slightly curved, apical and basal cells were also curved, and they measured 22.5 - 45.5 × 4.5 - 6.3 µm (n=25). Chlamydospores were singly or in pairs, circular or subcircular, smooth, and measuring 5 - 10.5 µm (n=25) in diameter. Morphologically, the isolates were identified as Fusarium commune (Skovgaard et al. 2003; Leslie and Summerell 2006 ). To confirm the identity, the rDNA partial translation elongation factor1 alpha (TEF-a) gene and the internal transcribed spacer (ITS) region of ten isolates were amplified and sequenced (O'Donnell et al. 2015; White et al. 1990). Identical sequences were obtained, and one representative sequence of isolate BGL68 was submitted to GenBank. BLASTn analysis of both the TEF-α (MW589548) and the ITS (MW584396) sequences, revealed 100% and 99.46 % sequence identity to F. commune MZ416741 and KU341322, respectively. The pathogenicity test was conducted under greenhouse conditions. The surface of healthy 2-year-old American ginseng roots was washed and disinfested in 2% NaOCl for 3 min before rinsing in sterilized water. Twenty roots were wounded with a toothpick, resulting in tiny perforations (1.0 × 1.0×3.0 mm), 3 perforations were wounded on each root. Inoculums was prepared from the culture of isolate BGL68 incubate in potato dextrose broth (PD) for 5 days at 26°C,140 rpm. Ten wounded roots were immersed in a conidial suspension (2 × 105 conidia/ml) for four hours in a plastic bucket, and planted in five containers (two roots per container) filled with sterile soil. Another ten wounded roots were immersed in sterilized distilled water and planted in five containers as controls. The containers were incubated for four weeks in a greenhouse at temperature between 23°C and 26°C, under a 12-hr light and dark regime, and irrigate with sterile water every 4 days. Three weeks after inoculation, all inoculated plants exhibited chlorotic leaves, wilting and root rot. The taproot and the fibrous roots showed brown to black root rot and no symptoms in non-inoculated controls. The fungus was reisolated from the inoculated plants, but not from any of the control plants. The experiment was repeated two times with similar results. This is the first report of root rot caused by F. commune on American ginseng in China. The disease might bring a threat to this ginseng production and should be implemented effective control measures to reduce losses.

First Report of Neofusicoccum australe Causing Branch Dieback of English Walnut cv. Chandler in Central Chile.

The English walnut (Juglans regia L.) is the second most important fruit crop of importance in Chile, with 43,700 hectares mainly in the Central Valley (www.odepa.cl, 2022). For several seasons symptoms of a branch dieback have been observed in walnut orchards with 3 to 50% of trees incidence levels. During the 2020 winter season (July) a total of 150 symptomatic spurs of 15 trees were sampled from an 8-year-old walnut cv. Chandler orchard located in Buin (33°42' S, 70° 42' W). The collected spurs showed external and internal brown necroses, starting from the tip with well-defined margins. The symptomatic tissue was cut in to small pieces (5 x 4 x 2 mm), surface disinfected by dipping in a 10% solution made from a commercial bleach solution (4,9% NaOHCl), rinsed twice in sterile water and plated on APDA (PDA Difco laboratories acidified with lactic acid (2,5 ml of 25% (vol/vol) per liter of medium). After five days at 20 °C in darkness, fast-growing, white-grey turning to black colonies were obtained, tentatively classified as a member of the Botryosphaeraceae family and two single-spore isolates (SS1, SS2) were selected for identification. Colony mycelia were first white and turned to light grey, dark grey or black, with tufts of mouse gray aerial mycelia. The pycnidia and conidia production was induced by inoculating autoclaved pine needles placed on APDA an incubation for 25 to 30 days at 20 °C in darkness. Black pycnidia solitary and globose were obtained producing hyaline, aseptate, fusiform to obovoid conidia with truncated ends with dimensions of (22.6-) 19.1 ± 1.4 (-13.3) x (6.7-) 5.5 ± 0.5 (-3.7) µm and 3.5 length/width ratio (n=100). Both isolates were identified using dichotomous keys confirming the description of Crous et al, 2006 as Neofusicoccum australe. The identification was molecularly confirmed by amplifying the nuclear ribosomal gene 5,8S (ITS1-5.8S-ITS2) using the ITS1/ITS4 primers, a partial region of ß-tubulin gene (Bt2a/Bt2b), and the translation elongation factor 1-α gene (TEF1) with TEF1-728F/TEF1-986R primers. The BLASTn search revealed 100% of identity for ITS and TEF according to sequences of N. australe reference strains MT587467.1 and MK759852.1, respectively; and over 99% for ß-tubulin compared to N. australe strain KX464929.1. The DNA sequences were submitted to the GenBank (ITS, OP142414, OP142416; BT, OP209981, OP209978; and TEF OP209979, OP209980) for SS1 and SS2 isolates, respectively, and deposited in the fungal collection of CChRGM - INIA, Chillán, Chile (RGM 3409 and 3410). Pathogenicity of both isolates was tested in 8-year-old asymtomatic English walnut cv. Chandler in the field during 2020 spring season, by cutting transversally 15 twigs of different tress and inoculating with a 5 day-old PDA plug. An equal number of wounded twigs were inoculated with a sterile PDA plug and served as control. After six months, all inoculated twigs developed the same necrotic lesions observed in field of 2.0 to 10.1 cm (SS1) and 1.9 to 10.8 cm (SS2) in length while control twigs showed only a scar without any dieback tissues. The inoculated pathogens of N. australe were recovered from the diseased tissues, thus fulfilling Koch's postulates. A similar dieback of walnut was reported in Chile, which caused Diplodia mutila (Díaz et al, 2018), and N. parvum (Luna et al, 2022) while N. australe has been reported in other hosts (Auger et al, 2013, Besoain et al, 2013). To the best of our knowledge, this is the first report of N. australe associated with walnut branch dieback in Chile.

First Report of Root Rot Caused by Pleiocarpon algeriense on peony (Paeonia suffruticosa) in China.

Peony (Paeonia suffruticosa Andr.) is a perennial plant of Ranunculaceae. Its root bark (Danpi in Chinese) is a traditional Chinese medicine, which has the effects of clearing heat and cooling blood, promoting blood circulation to resolve blood stasis. Peony is mainly planted in the provinces of Anhui, Gansu, Henan and Shandong. Peony is also called Fengdan in the Fenghuang Mountain of Tongling, Anhui Province. In November 2021, a root rot-like disease was observed on the root of peony in several fields located in Tongling county, Anhui Province, China (118°0'51" N, 30°48'11" E). Approximately 20-40% of the peony plants were affected in the fields. The roots of the diseased plants were rotten and blackened, the bark of the roots was detached, and the leaves were withered, causing the whole plants to die. To isolate the pathogen, the symptomatic roots were sampled, and small pieces (5 × 5 mm) of diseased tissues were surface sterilized with 0.5% NaClO solution and 75% ethanol for 5 min, rinsed with sterile distilled water three times, and finally incubated on potato dextrose agar (PDA) at 28°C in the dark for 7 days. A total of 16 isolates were obtained from the infected tissues. Among isolates, six isolates were morphologically similar to B4. Colonies were passaged multiple times on fresh PDA medium, and pure isolate B4 exhibiting cinnamon-to-honey coloration on PDA with pale yellow aerial hyphae, was then selected. Microscopic observations revealed that microconidia were straight to curved, ellipsoid or subcylindrical, and ranged from 7.14 to 14.29 × 2.85 to 5.00 µm (n = 20). The morphological characteristics were similar to the description of Pleiocarpon algeriense by Aigoun-Mouhous et al. (2019). To further identify the taxonomic status of B4 strain, three genes of the internal transcribed spacer (ITS) region of rDNA, beta-tubulin (TUB2), and the RNA polymerase II second subunit (RPB2) were respectively amplified and sequenced using primers ITS1/ITS4 (White et al. 1990), T1/Bt-2b (O'Donnell and Cigelnik 1997), and 5F2/7cR (O'Donnell et al. 2007). Sequences for the isolate B4 were deposited in GenBenk (OP810684, ITS; OP882301, TUB2; OP863337, RPB2). BLAST analysis showed the ITS, TUB2, RPB2 sequences of B4 were 99.80% (505/506), 99.51% (609/612) and 100.00% (854/854) homology with those of P. algeriense Di3A-AP52 (MT613337, ITS; MT597145, TUB2; MT635004, RPB2). A phylogenetic tree was built using MEGA11 based on sequences of three genes showing that B4 strain was closely clustered with reference strain of P. algeriense, which has not been reported in peony in China. The pathogenicity test of the isolates was performed by inoculating 50 mL of conidial suspension (1 × 108 conidia/mL) on the roots of ten healthy peonies, ten peonies inoculated with 50 mL of sterile water were used as a control group. After one-month, typical symptoms of root rot appeared on the inoculated plants and the control plants were asymptomatic. The fungus (P. algeriense) was reisolated from the diseased roots and identified by sequencing of ITS gene, conforming to Koch's postulates. Pleiocarpon algeriense has been reported to cause stem and crown rot in avocado (Aiello et al. 2020). To the best of our knowledge, this is the first report of P. algeriense causing root rot in peony. Control methods of P. algeriense on peony fields will be studied in-depth in the future.

Development of a Molecular Tool for Identification of a New Neopestalotiopsis sp. Associated with Disease Outbreaks on Strawberry.

A new Neopestalotiopsis sp. was recently reported causing outbreaks of leaf spot and fruit rot on strawberry in Florida, Georgia, and South Carolina. In contrast to other Pestalotiopsis pathogens, the new species appears more aggressive and destructive on strawberry. Current chemical options for management are disease suppressive at best, and affected growers have been experiencing major yield losses. In this study, we developed a molecular method based on polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) for identification of the new Neopestalotiopsis sp. from strawberry. Isolates of the new Neopestalotiopsis sp. collected in Florida; isolates of N. rosae, N. honoluluana, N. ellipsopora, N. saprophytica, N. samarangensis, and P. rhododendri; and isolates from South Carolina suspected to be the new Neopestalotiopsis sp. were included in this study. This method is based on PCR amplification of a ß-tubulin gene fragment using a previously published set of primers (Bt2a and Bt2b), followed by use of the restriction enzyme BsaWI. The enzyme cuts the PCR product from the new Neopestalotiopsis sp. twice, yielding fragments of 290 base pairs (bp) and 130 and 20 bp in size, whereas fragments from other species are only cut once, yielding fragments of 420 and 20 bp. This method will aid research labs and diagnostic clinics in the accurate and fast identification of the aggressive Neopestalotiopsis sp. variant from strawberry.

First report of Fusarium commune causing root rot of soybean seedlings in Indiana.

In the summer of 2020, 127 soybean [Glycine max (L.) Merr] seedlings (V1-V3 stage) with reduced growth vigor were sampled as part of a bulk collection of seedling pathogens from Purdue's Agronomy Center for Research and Education in West Lafayette, Indiana. After rinsing off soil, one plant displayed prominent necrotic lesions on both cotyledons and the hypocotyl and rot of the roots. Root tissue segments measuring roughly 5 mm in length and adjacent to lesions were excised and surface sterilized in 0.6% NaOCl for 10 min, then in 70% ethanol for 2 min, rinsed thrice in sterile distilled H2O, and plated on dichloran-chloramphenicol-peptone agar (Andrews and Pitt 1986). Single-spore cultures were produced and grown on potato dextrose agar. The isolate (AC101) developed white aerial mycelium, rings of magenta coloration in the media, and pale orange sporodochia with age. Microscopic observation of two-week-old cultures grown on synthetic low-nutrient agar (NRRL Medium No. 4) in the dark at 28°C revealed 2-3 septate falcate macroconidia measuring 17.1 - 43.9 × 2.8 - 3.5 µm (avg. 29.4 × 3.1 µm, n=20); 0-1 septate straight to slightly curved microconidia measuring 3.9 - 8.6 × 1.9 - 2.5 µm (avg. 7.0 × 2.2 µm, n=20); and round chlamydospores borne singly or doubly with diameter measuring 6.1 - 14.2 µm (avg. 8.9 µm, n=20). These characteristics were consistent with descriptions of Fusarium commune K. Skovg., O'Donnell & Nirenberg (Skovgaard et al. 2003). DNA was extracted from aerial mycelium and the internal transcribed spacer (ITS) region using ITS1/ITS4 primers (White et al. 1990) (GenBank accession MW463361), the mitochondrial small subunit (mtSSU) rDNA using MS1/MS2 primers (White et al. 1990) (MW466537), and the translation elongation factor 1-alpha (TEF1α) gene using 983F/1567R primers (Rehner and Buckley 2005) (MW475296) were amplified and sequenced. Blast searches in GenBank showed that these sequences had 100% identity with corresponding sequences of F. commune (ITS: MN452698; mtSSU: AF362277; and TEF1α: KU171720). The matching mtSSU sequence was an accession from the original species description (Skovgaard et al. 2003). A pathogenicity test was conducted under greenhouse conditions (20-29°C, avg. 24°C) following the infested soil protocol of Ellis et al. (2013a). Ten seeds (cv. Williams) each were used in inoculated and mock-inoculated control treatments with one seed per foam cup. Root rot symptoms similar to, but more destructive than those observed in the field, were observed 14 days after planting on all inoculated plants but not on controls. Inoculated plants reached VE stage compared to controls which reached VC. Disease symptoms included severe necrotic lesions on the cotyledons, dark brown rot of the developing tap root, and brown hypocotyl lesions similar to field symptoms. F. commune was successfully reisolated from inoculated plants, but not from controls, as described above. F. commune has been reported to cause soybean root rot in China (Chang et al. 2018), Korea (Choi et al. 2020), as well as Iowa (Ellis et al. 2013b). To our knowledge this is the first report of F. commune infecting soybean seedlings in the state of Indiana. The expanded distribution of this soybean pathogen warrants heightened attention for its control.

First Report of Plasmodiophora brassicae causing clubroot on Thlaspi arvense L. in Sichuan Province of China.

Pennycress (Thlaspi arvense L.), an annual herb of the mustard family Brassicacae, is native to Eurasia and now widely distributed throughout temperate North America. This species is currently being developed as a medicinal herb used to treat nephritis in China and an oilseed crop for biofuel production (Roque et al.2012). In November 2020, stunt and wilt symptoms were observed on above ground parts and swollen club-shaped galls were observed on the roots of T. arvense in most of the Chinese cabbage growing area in Kangding (30°03'"N,102°02'"E), Sichuan Province of China. The average disease incidence of swollen roots on T. arvense was 91.2% ( n=80). To identify the causal agent of this disease, the swollen roots of T. arvense were collected, crushed and observed under microscope (Fei et al.2017). Abundant resting spores were found in the root galls, which were spherical and 2.0 to 3.1 µm in diameter with an average length of 2.7 nm (n=100). The healthy roots and the root galls of T. arvense plants were further evaluated by PCR with P. brassicae-specific primers TC2F/TC2R (Cao et al. 2007). The results showed that a DNA fragment with an estimated size of 520 bp, as expected for that of P. brassicae, was consistently amplified in diseased roots, No PCR amplification occurred in the healthy roots with the TC2F/TC2R primers. Blast analysis of the 520 bp segment (GenBankMZ040496) showed the highest identity with the sequence of small subunit ribosomal RNA gene of P. brassicae (GenBankMH762161, 97.7%, E value=0). These results confirmed that the pathogen in the galled roots of T. arvense was P. brassicae. The pathogenicity of isolated P. brassicae was tested on both T. arvense and Chinese cabbage (B. campestris ssp. pekinensis). Resting spores were isolated from the diseased roots (Castlkbury et al. 1994) of T. arvense and suspended in Hoagland's solution to the final concentration of 1 × 107 spores per milliliter. Fifteen plastic pots (10 cm bottom diameter, 16 cm upper diameter, 13 cm high) were filled with soil (1 kg per pot) that was sterilized twice with high-temperature (121℃), high pressure (19 PSI) for 1.5 hours with a time interval of 2 days between. Inoculated pots received 100 mL spore suspension each. Fifteen control pots with sterilized field soil were treated with 100 mL Hoagland's solution each. Seeds of T. arvense and B. campestris were pre-germinated at 20°C on moist filter paper for 7 days and transplanted into the pots, five seedlings each and five pots per treatment. The pots were maintained in a greenhouse with 16 hours photoperiod at 24°C/16°C day/night temperature. After 7 weeks, plants in each pot were uprooted and the roots cleaned in running water and inspected for clubroot symptoms. Plants of T. arvense and Chinese cabbage in pots inoculated with resting spores showed clubroot symptoms while no disease symptoms were observed on any control plants. The disease incidence rate was 95.4% on T. arvense and 81.2% on B. campestris. Therefore, it was confirmed that P. brassicae could cause clubroot disease on T. arvense. To our knowledge, this is the first published report of clubroot disease on T. arvense in China. This finding is helpful for the management of clubroot on herbs and plants of biological origin in the cruciferous family.

First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.

Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.

First Report of Phelipanche aegyptiaca on Plectranthus scutellarioides in Xinjiang, China.

Coleus (Plectranthus scutellarioides [L.] R.Br.[syn.: Solenostemon scutellarioides]) is a perennial plant in the Lamiaceae family. It produces variegated leaves of various colors. It is commonly cultivated as an ornamental plant or grown in commercial greenhouses (Garibaldi et al. 2019). Phelipanche aegyptiaca Pers. is a dicotyledonous holoparasitic flowering plant that parasitizes more than 30 food crops (e.g., tomato, sunflower, and chickpea), ornamental crops, and others in different parts of the world, causing heavy economic losses (Nosratti et al. 2020). In 2016 and 2017, broomrape was observed parasitizing coleus in the greenhouse (86° 3' 36" E, 44° 18' 36" N, 500 m elevation) in Shihezi, Xinjiang, China (Supplementary Figure 1A-D). A single coleus plant could be parasitized by average 6-10 broomrape plants, and 20% of coleus plants were infested. The infection was confirmed by verifying the attachment of the broomrape to the coleus root. The inflorescences of the broomrape were normal and healthy and produced germinable seeds (germination rate: 80-90%). The morphological characteristics of the coleus are shown in Supplementary Figures 6 and 7. The main botanical features of the broomrape are as follows: (i) stem 20.65±7.07 cm tall, erect, branched, frail, rather hairy, bulbous at the base with secondary roots; (ii) inflorescence usually many-flowered, lax and cylindrical; (iii) bracts 6.87±0.93 mm long, ovate to lanceolate; (iv) calyx 1.09±0.09 cm long, shortly campanulate; (v) corolla 3.38±0.19 cm long, erect to suberect, white at the base, blue-purple in the upper part, sparsely glandular-villous; (vi) stamens 4, filaments inserted 5-6 mm from the base of the corolla, 1.26±0.11 cm long, anthers with villous; (vii) pistil 2.9±0.15 cm long, ovary glabrous, style with short glandular hairs, stigma bilobed, white (Supplementary Figure 2) (Teimoury et al. 2012; Piwowarczyk et al. 2019). For molecular identification, total genomic DNA was extracted from the flowers of the broomrape (found parasitizing coleus plants), and the ribosomal protein S2 (rps2) and ribosomal DNA internal transcribed spacer (ITS) region were amplified by PCR using the primer pairs rps2F/rps2R, ITS1/ITS4 (Table 1) (Park et al. 2007; Anderson et al. 2004). Two sequences with 580 bp (ITS) and 443 bp (rps2) were obtained (GenBank accession No. MW811482 and MW883573). BLAST analysis showed that the ITS sequence was most similar (identity 100%) to P. aegyptiaca (KC811171) and the rps2 sequence (identity 99%) also matched that of P. aegyptiaca (KC814957). Phylogenetic analysis of the ITS regions and rps2 genes showed that broomrape was fallen into P. aegyptiaca groups (Supplementary Figure 3). Morphological and molecular findings strongly support the conclusion that the broomrape on coleus was P. aegyptiaca. In order to verify that coleus was a host of P. aegyptiaca, coleus seedlings were collected and moved to 1.5-L pots containing a mixture of compost-vermiculite-sand (1:1:1 v:v:v) and seeds of P. aegyptiaca harvested from the host coleus (50 mg of P. aegyptiaca seeds per 1 kg of the substrate). Another three coleus seedlings were transplanted into pots of the same size containing the same mixture as above without P. aegyptiaca seeds. These served as controls. After 90 days of inoculation, the leaves of the infected hosts were lighter in color than those of uninfected hosts (Supplementary Figures 4A, 6). The roots of coleus and P. aegyptiaca were carefully washed with water, and an average of 3-4 emerged broomrape shoots and 50-60 underground attachments were observed on coleus roots (Supplementary Figure 4B). P. aegyptiaca can develop normally in the root of the coleus plant, from germination through attachment to host roots and development of tubercles (Supplementary Figure 5 A-E). Longitudinal and transverse sections of the parasite and host roots at the tubercle stage revealed that the endophytic tissues of P. aegyptiaca had reached and connected to the host vascular bundle (Supplementary Figure 5F-I), confirming the normal biological development and function of P. aegyptiaca haustoria. To the best of our knowledge, this is the first report of P. aegyptiaca parasitizing coleus in Xinjiang, China. Coleus is a very widely cultivated horticultural ornamental plant, and it grows in the same environments favored by P. aegyptiaca; so, the plant can aid the transmission of P. aegyptiaca to previously clear regions. It is necessary to improve the management of coleus in places where P. aegyptiaca is prevalent so as to reduce its spread. References: Garibaldi, A., et al. 2019. Plant Dis. 104:590. https://doi.org/10.1094/PDIS-07-19-1399-PDN Crossref, ISI, Google Scholar Nosratti, I., et al. 2020. Weed Sci. 68:555-564. https://doi.org/10.1017/wsc.2020.61 Crossref, ISI, Google Scholar Teimoury, M., et al. 2012. Plant Dis. 96:1232. https://doi.org/10.1094/PDIS-01-12-0068-PDN Crossref, ISI, Google Scholar Piwowarczyk, R., et al. 2019. Phytotaxa. 386:001-106. https://doi.org/10.11646/phytotaxa.386.1.1 Crossref, ISI, Google Scholar Park, J. M., et al. 2007. Mol. Phylogenet. Evol. 43: 974-985. https://doi.org/10.1016/j.ympev.2006.10.011 Crossref, ISI, Google Scholar Anderson, I. C., et al. 2004. Environ. Microbiol. 6: 769-779. https://doi.org/10.1111/j.1462-2920.2004.00675.x Crossref, ISI, Google Scholar.

First report of Impatiens necrotic spot orthotospovirus infecting Tulbaghia violacia Harv. in China.

Tulbaghia violacea Harv. indigenous to southern African countries, is an herbaceous perennial bulbous plant belonging to the family Amaryllidaceae. It is a popular garden plant in China. This attractive plant is traditionally used as medicine and repellent (Kubec et al. 2002; Moodley et al. 2015). In June 2021, T. violacea plants showing typical tospovirus-like symptoms of chlorotic rings patterns, were found at the campus of Yunnan University of Chinese Medicine (Fig.S1). Disease incidence was about 11.0% during the field survey. Total RNA was extracted from symptomatic leaves of T. violacea plants using the TRIzol reagent (ambio, Carlsbad, CA). Reverse transcription (RT)-PCR was conducted to identify the virus using RNA extract as the template. The degenerate primers (dTospo-F2 and dTospo-R2) (Huang et al. 2018) were used to amplify the conserved regions of the orthotospoviral L RNA sequences. No amplification was obtained from extracts of two asymptomatic plants. The amplicons from four symptomatic samples were cloned into the pMD19-T vector (TaKaRa) and sequenced (three clones for each amplicon) by Tsingke (Shanghai, China). The obtained DNA fragments were determined to be 312 bp. The sequences from four symptomatic samples were identical (GenBank acc.no. OK258285) and shared the highest nucleotide identities (98.0%) with a corresponding sequence of segment L of impatiens necrotic spot virus (INSV) isolated (GQ336991) from Phalaenopsis amabilis in Yunnan province, China. To further confirm the INSV infection to T. violacea, the samples were analyzed with the specific primers for the N, NSs and NSm genes of INSV (Table S1), respectively. Amplicons of the expected size, 789 bp, 1344 bp and 912 bp, were produced, respectively. Amplicons were cloned and sequenced. The 789-bp N (ON529554) and 1344-bp NSs (ON529554) gene sequences had 99.1% and 99.3% nucleotide identities with the corresponding region of previously described INSV Phalenopsis isolate (GQ336989), respectively. The 912-bp NSm (ON529553) gene sequence shared 99.5% nucleotide identity with the corresponding region of INSV Phalenopsis isolate (GQ336990). Metavirome and Sanger sequencing were used to complete the genome of INSV from T. violacea. The leaves of the symptomatic sample were used to construct an rRNA-depleted library using Nextera XT reagents (Illumina, San Diego, CA). The library was subjected to RNA-Seq a NovaSeq 6000 platform (Illumina, San Diego, CA). A total of 33,193,233 quality-filtered reads were obtained using BBMAP (https://github.com/BioInfoTools/BBMapBBMap - Bushnell B. - sourceforge.net/projects/bbmap/). Among 161052 reads mapped to virus sequences, 151407 reads (read ratios 94.0%) were mapped to INSV. Three complete segments of INSV genome were determined to 8,778 nt (L segment, Acc. No. ON529552), 4,958 nt (M segment, Acc. No. ON529553), and 2,983 nt (S segment, Acc. No. ON529554) in length. These segments were validated by RT-PCR and Sanger sequencing. Three segments share nucleotide sequence identities of 99.6%, 99.3% and 98.9% with the L (GQ336991), M (GQ336990) and S segments (GQ336989) of INSV Phalenopsis isolate, respectively. The results of sequence comparisons showed no evidence of reassortment between INSV and another orthotospovirus. There was a report of tomato spotted wilt virus infecting T. violacea in Florida, USA (Dey et al. 2019). No other virus infecting T. violacea was reported. INSV has been reported to infect several economically important crops including Phalenopsis, pepper etc. in China (Chen et al. 2016). INSV-infected T. violacea not only losses landscaping value but also plays an important intermedia host role in the spread of INSV. Additional surveys and evaluation will be needed to understand the potential medicinal effect of this virus on this plant. To our knowledge, this is first report of INSV in T. violacea.

First Report of Black Scurf Caused by Rhizoctonia solani AG 2-2IV on Potato tubers in Heilongjiang Province, China.

Black scurf and stem canker on potato (Solanum tuberosum L.), caused by Rhizoctonia solani, is one of the most important soil-borne diseases throughout the world. Isolates of R. solani anastomosis group (AG) 3-PT have been reported as the predominant cause of the disease on potato (Carling 1996) and the same results were also obtained in Heilongjiang Province, China (Yang et al. 2017). In October 2020, 14 diseased potato tubers (cv. Youjin-885) with symptoms typically associated with black scurf were found in Hegang City of Heilongjiang in Northeast China, where potatoes are grown for propagation in the breeding nursery. Pieces of sclerotia were removed from the surface of the potato and were surface sterilized with 70% ethanol for 30 s and 0.5% NaClO for 1 min, then rinsed three times with sterile distilled water and placed on potato dextrose agar (PDA) at 25°C in the dark. After incubation for 48 to 72 h, mycelia resembling Rhizoctonia were microscopically examined for morphological characteristics, and hyphal tips transferred to fresh plates of PDA. The characteristics of the observed isolate were typical of R. solani Kühn, which include hyphal branching at right angles, a septum near the branching point and a slight constriction at the branch base (Yang et al. 2015). Hyphal cells were also determined to be multinucleate by staining with 1% safranin O and 3% KOH solution (Bandoni 1979). PCR amplification and DNA sequencing of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA) was performed by using the universal primers ITS4/ITS5 (White et al. 1990). The resulting sequence of 700 bp (GenBank accession no. OL770460) showed more than 99% identity to AG 2-2IV isolates present in GenBank (e.g. AB911322; KR259910). On the basis of morphological characteristics and molecular analysis, the isolate was identified as R. solani AG 2-2IV. Pathogenicity of the isolate was tested in greenhouse conditions. Pathogen-free minitubers (cv. Favorita) of approximately the same size (10 to 20 g) were allowed to sprout at room temperature for 10 days. The minitubers were then planted in autoclaved soil in a plastic pot (4 L capacity), placed in a greenhouse at 18 - 27°C (night-day) with 50% relative humidity and watered as required. The pots were inoculated with 7-mm-diameter mycelial plugs (from one PDA petri plate) near the minituber, which was then covered with potting mix. The control pots were inoculated with sterile plugs of PDA. Each treatment consisted of 10 plants, and the experiment was repeated three times. Two months after stems emerged, plants and progeny tubers were harvested and assessed for disease. Stem cankers typical of R. solani infection and black scurf were observed on plants grown in pots inoculated the mycelial plugs, but the control plants remained disease free. Fungi reisolated from symptomatic stems and tubers were identified as R. solani AG 2-2IV using morphological characters and ITS sequences.Sclerotia were observed on PDA by incubating at 25oC in the dark. Although eight AGs have been previously shown to cause black scurf and stem canker in Heilongjiang (Li et al. 2014; Yang et al. 2015; Yang et al. 2017; Yang et al. 2019; Yang et al. 2020), to our knowledge, this is the first report of AG 2-2IV causing disease on potatoes in Heilongjiang Province, the main potato seed production area of China. Early detection of R. solani AG 2-2IV during potato seed production is necessary to prevent its dispersal via infected tubers to other fields across China. The information of which AG is present will assist in developing management strategies for this disease.

First Report of Leaf Spot on Ipomoea nil Caused by Alternaria alternata in China.

Ipomoea nil (Linnaeus) Roth, belonging to the Convolvulaceae family, is an ornamental and medicinal plant in China, which has the function of diuretic and expectorant, and it is also a common weed in the field. In October 2021, a leaf spot disease was observed on I. nil in a field as weed in Jingzhou (N 30° 21', E 112° 19'), Hubei Province, China. Symptoms began as small brown blotches, then developed into oval or irregularly shaped brown necrotic lesions. In severe cases, the leaves were completely necrotic and detached. In the surveyed area, the incidence was between 30% - 40%. To isolate the pathogen, twenty-one leaf pieces (5×5 mm) were cut from the lesion edges of seven symptomatic leaves, disinfected with 70% ethanol and 2% sodium hypochlorite (NaOCl), rinsed with sterile water five times, then placed on three potato dextrose agar (PDA) modified with 50 µg/mL kanamycin, and incubated at 25 °C in dark for 5 days. The isolates were subcultured by transferring mycelium tips. Sixteen fungal strains were isolated from the tissues, and nine of them showed similar morphological characteristics. After cultured 7 days on PDA at 25 °C, the nine colonies were initially white, then turned greenish brown to black in the center and had abundant fine villous aerial mycelia up to 61.5 mm in average diameter. To examine its conidial morphology, the fungi were cultured for 7 days on potato carrot agar (PCA) at 22°C with a light/dark period of 8/16 h. On PCA, conidia were brown or olive-brown, obclavate to obpyriform, with a short beak, one to five transverse and zero to three longitudinal septa. They formed chains of 1 - 8 conidia, with branches. Conidia were 16 - 46 µm long and 8 - 14 µm wide (n=50). These morphological features were similar to those described in Alternaria spp. (Simmons 2007). A single isolate "Q2" was selected for molecular identification because it was the most aggressive in preliminary leaf pathogenicity assays. The internal transcribed spacer (ITS) region of rDNA and histone 3 (H3) gene were amplified and sequenced using primers ITS1/ITS4 (White et al. 1990) and H3-1a/H3-1b (Zheng et al. 2015). BLAST analysis revealed that the sequences (ITS, ON360984; H3, ON375577) were 100% identical to Alternaria alternata (ITS, MK396607; H3, MN840996), respectively. Maximum likelihood analysis based on combined two gene sequences was conducted with an evolutionary model of GTR+I+G under 1000 bootstrap replicates. Phylogenetic tree showed that Q2 and Alternaria alternata 21-5 and BLH-YB-11 located in one clade supported with 99% bootstrap values. The pathogen was identified as A. alternata. To fulfill Koch's postulate, 10 ml conidia (106 spores/ml) of Q2 was sprayed on five healthy seedlings, with sterile distilled water as a control. All leaves were rinsed three times with sterile water before inoculation. All seedlings were placed in sealed plastic bags with air valves, and grown in a greenhouse (25 ± 2 ˚C, RH 65%). The test was repeated twice. After 10 days, symptoms typical of brown blotches similar to those observed in the field were observed on leaves of inoculated plants, while control remained healthy. A. alternata was re-isolated from the inoculated symptomatic leaves with a frequency of 100% based on morphological and molecular characters, thus Koch's postulate was confirmed. To the best of our knowledge, this is the first report of A. alternata causing leaf spot on I. nil in China. Our findings extended the host range of the pathogen A. alternata on characteristic plants.

First Report of Powdery Mildew Caused by Podosphaera xanthii on Cosmos bipinnata in Northeastern China.

Cosmos bipinnata (Cav.) is a common garden flowering plant with high ornamental value in China, and which is also widely distributed as a landscaping plant in northeastern China. During the summer of 2020, powdery mildew on C. bipinnata was observed in the garden of Best West Fortune Hotel, Harbin, Heilongjiang Province, China. More than 70% of plants in the garden were affected but at low severity, with only a few older leaves showing yellowing and wilting. Powdery mildew colonies began as small white spots on the upper surface of both young and mature leaves, and then spread to entire leaves. Conidia collected from infected plant tissues were ellipsoid-ovoid to barrel-shaped, with distinct fibrosin bodies visible in their cytoplasm, and measured 20 to 28 × 14 to 19 µm with a length/width ratio of 1.5 to 2.0 (n = 30). Conidiophores were unbranched, straight, 92 to 230 × 9 to 15 µm in size, and produced four to six immature conidia in chains (n = 30). Foot cells of conidiophores were cylindrical and 40 to 70 µm long, with light constriction at the basal septum, and followed by one to three short cells. Fungal hyphae were septate, branched, flexuous to straight, and up to 5 µm wide with indistinct to slightly nipple-shaped appressoria. Chasmothecia were absent in the collected infected samples. The morphological characteristics were consistent with Podosphaera xanthii reported by Braun and Cook (2012). For molecular identification, total gDNA was extracted from fungal colonies on infected leaves of three collections separately. For each DNA sample, the part of LSU and ITS regions were amplified using primers LSU1/LSU2 and ITS1/ITS4 (Scholin et al. 1994; White et al. 1990), respectively. BLASTn analysis of the 617bp (OP218411) and 563bp (MW166865) amplicons revealed 99.67% to 100% sequence identity with respective rDNA sequences of P. xanthii isolates present in GenBank (LSU: KY860729 and MK439610; ITS: MT242593 and MK439611). The phylogenetic trees were constructed using the neighbor-joining method in MEGA 5.0. Based on the ITS rDNA phylogenetic tree, the sequences retrieved from the specimens clustered within a strongly supported clade with P. xanthii. On the basis of morphological characteristics and molecular analysis, the isolate was identified as P. xanthii. Koch's postulates were carried out to prove the pathogenicity of the isolate. A pathogenicity test was performed by dusting conidia from an infected leaf onto young leaves of five healthy C. bipinnata plants in the greenhouse with five non-inoculated plants as a control. Powdery mildew symptoms were observed on inoculated leaves after 7 days of inoculation at 20/25°C (night/day) and 75% relative humidity, whereas control plants remained asymptomatic. The fungus on inoculated leaves was morphologically identified as that observed on the original diseased leaves. P. xanthii has been reported on several hosts in China, such as Zinnia elegans, Verbena bonariensis and Melothria indica (Fan et al. 2022; Hong et al. 2021; Zhong et al. 2022). To our knowledge, this is the first report of P. xanthii infecting C. bipinnata in northeastern China, and the information presented in this note will assist the horticultural industry on developing management strategies for this disease in China.