Genome-wide analysis of the PYL-PP2C-SnRK2s family in the ABA signaling pathway of pitaya reveals its expression profiles under canker disease stress.

BACKGROUND: Abscisic acid (ABA) plays a crucial role in seed dormancy, germination, and growth, as well as in regulating plant responses to environmental stresses during plant growth and development. However, detailed information about the PYL-PP2C-SnRK2s family, a central component of the ABA signaling pathway, is not known in pitaya. RESULTS: In this study, we identified 19 pyrabactin resistance-likes (PYLs), 70 type 2 C protein phosphatases (PP2Cs), and 14 SNF1-related protein kinase 2s (SnRK2s) from pitaya. In pitaya, tandem duplication was the primary mechanism for amplifying the PYL-PP2C-SnRK2s family. Co-linearity analysis revealed more homologous PYL-PP2C-SnRK2s gene pairs located in collinear blocks between pitaya and Beta vulgaris L. than that between pitaya and Arabidopsis. Transcriptome analysis showed that the PYL-PP2C-SnRK2s gene family plays a role in pitaya's response to infection by N. dimidiatum. By spraying ABA on pitaya and subsequently inoculating it with N. dimidiatum, we conducted qRT-PCR experiments to observe the response of the PYL-PP2C-SnRK2s gene family and disease resistance-related genes to ABA. These treatments significantly enhanced pitaya's resistance to pitaya canker. Further protein interaction network analysis helped us identify five key PYLs genes that were upregulated during the interaction between pitaya and N. dimidiatum, and their expression patterns were verified by qRT-PCR. Subcellular localization analysis revealed that the PYL (Hp1879) gene is primarily distributed in the nucleus. CONCLUSION: This study enhances our understanding of the response of PYL-PP2C-SnRK2s to ABA and also offers a new perspective on pitaya disease resistance.

Host-pathogen interaction between pitaya and Neoscytalidium dimidiatum reveals the mechanisms of immune response associated with defense regulators and metabolic pathways.

BACKGROUND: Understanding how plants and pathogens regulate each other's gene expression during their interactions is key to revealing the mechanisms of disease resistance and controlling the development of pathogens. Despite extensive studies on the molecular and genetic basis of plant immunity against pathogens, the influence of pitaya immunity on N. dimidiatum metabolism to restrict pathogen growth is poorly understood, and how N. dimidiatum breaks through pitaya defenses. In this study, we used the RNA-seq method to assess the expression profiles of pitaya and N. dimidiatum at 4 time periods after interactions to capture the early effects of N. dimidiatum on pitaya processes. RESULTS: The study defined the establishment of an effective method for analyzing transcriptome interactions between pitaya and N. dimidiatum and to obtain global expression profiles. We identified gene expression clusters in both the host pitaya and the pathogen N. dimidiatum. The analysis showed that numerous differentially expressed genes (DEGs) involved in the recognition and defense of pitaya against N. dimidiatum, as well as N. dimidiatum's evasion of recognition and inhibition of pitaya. The major functional groups identified by GO and KEGG enrichment were responsible for plant and pathogen recognition, phytohormone signaling (such as salicylic acid, abscisic acid). Furthermore, the gene expression of 13 candidate genes involved in phytopathogen recognition, phytohormone receptors, and the plant resistance gene (PG), as well as 7 effector genes of N. dimidiatum, including glycoside hydrolases, pectinase, and putative genes, were validated by qPCR. By focusing on gene expression changes during interactions between pitaya and N. dimidiatum, we were able to observe the infection of N. dimidiatum and its effects on the expression of various defense components and host immune receptors. CONCLUSION: Our data show that various regulators of the immune response are modified during interactions between pitaya and N. dimidiatum. Furthermore, the activation and repression of these genes are temporally coordinated. These findings provide a framework for better understanding the pathogenicity of N. dimidiatum and its role as an opportunistic pathogen. This offers the potential for a more effective defense against N. dimidiatum.

Altitudinal variation of dragon fruit metabolite profiles as revealed by UPLC-MS/MS-based widely targeted metabolomics analysis.

BACKGROUND: Geographical factors affect the nutritional, therapeutic and commercial values of fruits. Dragon fruit (Hylocereus spp) is a popular fruit in Asia and a potential functional food with diverse pharmacological attributes. Although it is produced in various localities, the information related to the altitudinal variation of dragon fruit nutrients and active compounds is scarce. Hence, this study aimed to investigate the variations in metabolite profiles of H. polyrhizus (variety Jindu1) fruit pulps from three different altitudes of China, including Wangmo (WM, 650 m), Luodian (LD, 420 m), and Zhenning (ZN, 356 m). Jindu1 is the main cultivated pitaya variety in Guizhou province, China. RESULTS: The LC-MS (liquid chromatography-mass spectroscopy)-based widely targeted metabolic profiling identified 645 metabolites, of which flavonoids (22.64%), lipids (13.80%), phenolic acids (12.40%), amino acids and derivatives (10.39%), alkaloids (8.84%), and organic acids (8.37%) were dominant. Multivariate analyses unveiled that the metabolite profiles of the fruit differed regarding the altitude. Fruits from WM (highest altitude) were prime in quality, with higher levels of flavonoids, alkaloids, nucleotides and derivatives, amino acids and derivatives, and vitamins. Fruits from LD and ZN had the highest relative content of phenolic acids and terpenoids, respectively. We identified 69 significantly differentially accumulated metabolites across the pulps of the fruits from the three locations. KEGG analysis revealed that flavone and flavonol biosynthesis and isoflavonoid biosynthesis were the most differentially regulated. It was noteworthy that most active flavonoid compounds exhibited an increasing accumulation pattern along with the increase in altitude. Vitexin and isovitexin were the major differentially accumulated flavonoids. Furthermore, we identified two potential metabolic biomarkers (vitexin and kaempferol 3-O-[2-O-ß-D-galactose-6-O-a-L-rhamnose]-ß-D-glucoside) to discriminate between dragon fruits from different geographical origins. CONCLUSION: Our findings provide insights into metabolic changes in dragon fruits grown at different altitudes. Furthermore, they show that growing pitaya at high altitudes can produce fruit with higher levels of bioactive compounds, particularly flavonoids.

Neoscytalidium dimidiatum causing stem canker on Hylocereus megalanthus in China.

Hylocereus megalanthus (syn. Selenecereus megalanthus), commonly known as Yanwo fruit (bird's nest fruit), is an important tropical fruit, which is popular and widely planted due to its high nutritional and economic value in southern China. In September 2022, a serious stem and fruit canker was observed on Ecuadorian variety of Yanwo fruit plant in a 0.2 ha orchard in Guangdong (N21°19'1.24" E110°7'28.49"). Almost all plants were infected and disease incidence of fruits and stems was about 80% and 90% respectively. Symptoms on the stem and fruits were small, circular or irregular, sunken, orangish brown spots that developed into cankers (Fig 1 A, B and C). Black pycnidia were embedded under the surface of the cankers at the initial stage, subsequently they became erumpent from the surface, and the infected parts rotted. Five symptomatic stems from five plants were collected, 0.2 cm2 tissues adjacent to cankers were surface sterilized and placed on potato dextrose agar (PDA) to incubate at 25 to 28 ℃. Fungal isolates each with similar morphology grew from 100% of the tissues. Colonies covered with aerial mycelium were grayish white, and then gradually turned to grayish black. Septate hyphae were hyaline to brown and constricted into arthroconidial chains. The arthroconidia were variously shaped and colored, orbicular to rectangular, hyaline to dark brown, thick-walled, and zero- to one- septate, averaging 7.7 × 3.6 µm (n>50) (Fig 1 D, E, F and G). To identify the fungus, the internal transcribed spacer region (ITS), translation elongation factor 1-alpha (tef1), beta-tubulin (tub2), histone H3 (his3) and chitin synthase (chs) gene of isolate ACCC 35488 and ACCC 35489 (Agricultural Culture Collection of China) were amplified and sequenced with primer pairs: ITS1/ITS4 (White et al. 1990), EF1-728F/EF2-rd (Carbone & Kohn 1999; O'Donnell et al.1998), TUB2Fd/ TUB4Rd（Aveskamp et al 2009）, CYLH3F/H3-1b (Crous et al. 2004) and CHS-79F/CHS-345R (Carbone & Kohn 1999) (ITS: OQ381102 and PP488350; tef1: OQ408545 and PP510454; tub2: OQ408546 and PP510455; his3: OQ408544 and PP510453; chs: OQ408543 and PP510452). Sequence Blastn results showed above 99% identical with those of Neoscytalidium dimidiatum ex-type strain CPC38666. Phylogenetic tree inferred from Maximum Likelihood analysis of the combined ITS, tub2 and tef1 sequences revealed two isolates clustered with N. dimidiatum (Fig 2). Pathogenicity was tested on healthy one-year-old cuttings and fruits of Ecuadorian variety at room temperature. Six sites were pin-pricked on each stem and fruit. Both wounded stems and fruits were inoculated with spore suspensions (106 spore/ml) and 6-mm fungal plugs respectively. Sterile water and agar were used as control. The test was repeated twice. Stems and fruits were enclosed in plastic boxes with 80% relative humidity. Symptoms described above were observed on inoculated stems and fruits at five days post inoculation (Fig 1 H and I). No symptoms developed on the controls. Neoscytaliudium dimidiatum was reisolated from the cankers with a frequency of 100% via morphological and molecular analysis. This is first report of stem and fruit canker caused by N. dimidiatum on H. megalanthus in China and this disease represents a serious risk of Yanwo fruit yield losses. This fungus is widespread occurring throughout the world causing diseases on a wide variety of plants. The finding will be helpful for its prevention and control.

First Report of Pitaya Virus X Infecting Lophocereus schottii f. mieckleyanus (Thin-Stemmed Totem Pole Cactus) in the United States.

Lophocereus is a genus of three species of columnar cacti native to Arizona and Mexico (Lodi, 2015). These cacti produce several tall, ascending, columnar stems that branch at the base in a candelabra-like arrangement. The most common species, L. schottii is known as the senita cactus. Several unusual knobby-stemmed spineless forms of senita cactus have been found in nature in Baja California, Mexico, which are collectively known as totem pole cacti. The thin-stemmed totem pole cactus, L. schottii f. mieckleyanus is an important part of landscapes in southern Arizona. Cacti are clonally propagated which makes viral infections of economic importance in the ornamental/nursery industry. In February 2023, virus-like symptoms, such as mosaic and chlorotic spots were observed on the stems of L. schottii f. mieckleyanus grown in a nursery in Phoenix, AZ, USA. Total RNA was extracted from two symptomatic cacti (YPHC-61 A & B) following the protocol by Tzanetakis et al. (2007), and cDNA was synthesized using the Superscript IV Reverse Transcriptase (Invitrogen, Vilnius, Lithuania). Reverse transcription polymerase chain reaction (RT-PCR) performed with cactus virus X specific primers (Kim et al. 2016) targeting the coat protein (CP) gene failed to generate any amplicon, while potexvirus-replicase primers, Potex 2RC and Potex 5 (van der Vlugt and Berendsen 2002) targeting RNA-dependent RNA polymerase (RdRp) gene amplified an expected amplicon of ~580 bp from both the samples. One of the amplicons was Sanger sequenced and showed 90.7% nucleotide (nt) identity with pitaya virus X (PiVX) in the GenBank (MN982522). Sequence was submitted in the GenBank under the accession number OR425049. PiVX is a new species of the genus Potexvirus and is named after its origin from pitaya (Hylocereus spp.). Further, RT-PCR was conducted with PiVX-specific primers, CP 110F/CP 604R targeting CP gene (Bae and Park 2022) and RdRp gene (RdRp F 5' GCGTGGGCCCTGGAAAA-3'/RdRp R 5' CTAAGATTCATCAATTCACCTCTCC-3') (this study). Amplicons of ~500 and 1100 bp were obtained using primers, CP 110F/CP 604R and RdRp F/RdRp R, respectively. A BLAST search revealed 90.5% nt identity to PiVX CP sequences (OM802135 and OM802134) and 87.3% nt identity to RdRp sequences (MN982523 and LC654699) in the GenBank. Sequences of isolates YPHC-61A and YPHC-61B were submitted in the GenBank under accession numbers, OQ915350 and PP182358 (CP gene) and OQ915351 and PP209539 (RdRp gene). Phylogenetic analysis based on the combined sequence datasets of CP and RdRp genes also grouped YPHC-61A and YPHC-61B with PiVX isolates and separated from other potexviruses species. For a bioassay of the virus, sap extract from symptomatic cactus was mechanically inoculated onto indicator plant species, i.e., beans, alfalfa, and melon. Ten days post- inoculation, chlorotic lesions were observed on beans and alfalfa plants, while melon and mock-inoculated plants did not show any symptoms. Similarly, L. schottii f. mieckleyanus plants grafted with infected cactus showed chlorotic spots after 30 days post grafting. Mechanically inoculated beans, alfalfa, and cactus plants were found to be positive for PiVX based on RT-PCR and Sanger sequencing. PiVX has earlier been detected on Notocactus leninghausii f. cristatus (Park et al. 2018) and dragon fruit (Selenicereus undatus) plants in South Korea (Bae and Park 2022). To our knowledge, this is the first report of PiVX on L. schottii f. mieckleyanus in the United States and worldwide.

Light Supplementation in Pitaya Orchards Induces Pitaya Flowering in Winter by Promoting Phytohormone Biosynthesis.

The interaction between light and phytohormones is crucial for plant growth and development. The practice of supplementing light at night during winter to promote pitaya flowering and thereby enhance yield has been shown to be crucial and widely used. However, it remains unclear how supplemental winter light regulates phytohormone levels to promote flowering in pitaya. In this study, through analyzing the transcriptome data of pitaya at four different stages (NL, L0, L1, L2), we observed that differentially expressed genes (DEGs) were mainly enriched in the phytohormone biosynthesis pathway. We further analyzed the data and found that cytokinin (CK) content first increased at the L0 stage and then decreased at the L1 and L2 stages after supplemental light treatment compared to the control (NL). Gibberellin (GA), auxin (IAA), salicylic acid (SA), and jasmonic acid (JA) content increased during the formation of flower buds (L1, L2 stages). In addition, the levels of GA, ethylene (ETH), IAA, and abscisic acid (ABA) increased in flower buds after one week of development (L2f). Our results suggest that winter nighttime supplemental light can interact with endogenous hormone signaling in pitaya, particularly CK, to regulate flower bud formation. These results contribute to a better understanding of the mechanism of phytohormone interactions during the induction of flowering in pitaya under supplemental light in winter.

Pitahaya (Hylocereus ocamponis)-Peel and -Flesh Flour Obtained from Fruit Co-Products-Assessment of Chemical, Techno-Functional and In Vitro Antioxidant Properties.

The aim of this work was to assess the chemical composition and physico-chemical, techno-functional, and in vitro antioxidant properties of flours obtained from the peel and flesh of pitahaya (Hylocereus ocamponis) to determine their potential for use as ingredients for food enrichment. The chemical composition, including total betalains, mineral content, and polyphenolic profile, was determined. The techno-functional properties (water holding, oil holding, and swelling capacities) were also evaluated. For the antioxidant capacity, four different methodologies, namely ferrous ion-chelating ability assay, ferric-reducing antioxidant power assay; 1,1-Diphenyl-2-picrylhydrazyl radical scavenging ability assay, and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) radical assay, were used. Pitahaya-peel flour had higher values for protein (6.72 g/100 g), ash (11.63 g/100 g), and dietary fiber 56.56 g/100 g) than pitahaya-flesh flour, with values of 6.06, 3.63, and 8.22 g/100 g for protein, ash, and dietary fiber, respectively. In the same way, pitahaya peel showed a higher content of minerals, betalains, and polyphenolic compounds than pitahaya-flesh flour, with potassium (4.43 g/100 g), catechin (25.85 mg/g), quercetin-3-rhamnoside (11.66 mg/g) and myricetrin (12.10 mg/g) as principal compounds found in the peel. Again, pitahaya-peel flour showed better techno-functional and antioxidant properties than pitahaya-flesh flour. The results obtained suggest that the flours obtained from the peel and pulp of pitahaya (H. ocamponis) constitute a potential material to be utilized as an ingredient in the food industry due to the high content of bioactive compounds such as betalains, phenolic acids, and flavonoids, with notable antioxidant capacity.

Comparative omics-based characterization, phylogeny and melatonin-mediated expression analyses of GDSL genes in pitaya (Selenicereus undatus L.) against multifactorial abiotic stresses.

The GDSL gene family plays diverse roles in plant growth and development. Despite its significance, the functions of the GDSL in the pitaya plant are still unknown. Pitaya (Selenicereus undatus L.) also called Hylocereus undatus (Hu), belongs to the family Cactaceae and is an important tropical plant that contains high dietary fibers and antioxidants. In the present investigation, we screened 91 HuGDSL genes in the pitaya genome by conducting a comprehensive computational analysis. The phylogenetic tree categorized HuGDSL genes into 9 distinct clades in combination with four other species. Further, 29 duplicate events were identified of which 12 were tandem, and 17 were segmental. The synteny analysis revealed that segmental duplication was more prominent than tandem duplication among these genes. The majority of duplicated gene pairs (95%) indicate their Ka/Ks ratios ranging from 0.1 to 0.3, which shows that maximum HuGDSL genes were under purifying selection pressure. The cis-acting element in the promotor region contains phytohormones such as auxin, gibberellin, jasmonic acid, and abscisic acid abundantly. Finally, the HuGDSL gene expression pattern under single and multiple stresses was analyzed via; RNA-seq. We select ten stress-responsive HuGDSL genes for RT-qPCR validation. After careful investigation, we identified five HuGDSL candidate genes (HuGDSL-1/3/55/59, and HuGDSL-78) based on RNA-seq, and RT-qPCR data that showed enhanced expression in stress and melatonin-applied seedlings. This study represents valuable insights into maintaining pitaya growth and development by preparing stress-resilient pitaya genotypes through modern biotechnological techniques. Supplementary Information: The online version contains supplementary material available at 10.1007/s12298-024-01506-w.

Betalain biosynthesis in red pulp pitaya is regulated via HuMYB132: a R-R type MYB transcription factor.

BACKGROUND: Multiple MYB transcription factors (TFs) are involved in the regulation of plant coloring. Betalain is a kind of natural plant pigment and its biosynthesis is regulated by a number of enzymes. Despite this, little is known about the molecular properties and roles of MYB TFs in pitaya betalain biosynthesis. RESULTS: In the present study, we identified a 1R-MYB gene, HuMYB132, which is preferentially expressed in red-pulp pitaya at the mature stage. It was clustered with Arabidopsis R-R-type genes and had two DNA-binding domains and a histidine-rich region. The expression assays in N. benthamiana and yeast indicated that HuMYB132 is a nucleus-localized protein with transcriptional activation activity. Dual luciferase reporter assay and electrophoretic mobility shift assays (EMSA) demonstrated that HuMYB132 could promote the transcriptional activities of HuADH1, HuCYP76AD1-1, and HuDODA1 by binding to their promoters. Silencing HuMYB132 reduced betalain accumulation and the expression levels of betalain biosynthetic genes in pitaya pulps. CONCLUSIONS: According to our findings, HuMYB132, a R-R type member of 1R-MYB TF subfamily, positively regulates pitaya betalain biosynthesis by regulating the expression of HuADH1, HuCYP76AD1-1, and HuDODA1. The present study provides a new theoretical reference for the management of pitaya betalain biosynthesis and also provides an essential basis for future regulation of betalain biosynthesis in Hylocereus.

Improving red pitaya fruit quality by nano-selenium biofortification to enhance phenylpropanoid and betalain biosynthesis.

Red pitaya, the representative tropical and subtropical fruit, is vulnerable to quality deterioration due to climate or agronomic measures. Nano-selenium (Nano-Se) has shown positive effects on crop biofortification in favour of reversing this situation. In this study, Se could be enriched efficiently in red pitayas via root and foliar application by Nano-Se, which induced higher phenolic acids (16.9-94.2%), total phenols (15.7%), total flavonoids (29.5%) and betacyanins (34.1%) accumulation in flesh. Richer antioxidative features including activities of SOD (25.2%), CAT (33.8%), POD (77.2%), and levels of AsA (25.7%) and DPPH (14.7%) were obtained in Nano-Se-treated pitayas as well as in their 4-8 days shelf-life. The non-targeted metabolomics indicated a boost in amino acids, resulting in the stimulation of phenylpropanoid and betalain biosynthesis. In conclusion, the mechanism of Nano-Se biofortification for red pitaya might be fortifying pigment, as well as the enzymatic and non-enzymatic antioxidant substances formation by regulating primary and secondary metabolism facilitated by Se accumulation.

First Report of the guava root-knot nematode (Meloidogyne enterolobii) on Selenicereus costaricensis in Guangxi, China.

Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67″ N; 108°40'43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 µm, stylet lengths = 15.1 ± 0.9 µm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 µm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 µm, stylet lengths = 14.7 ± 0.5 µm, DGO = 3.5 ± 0.4 µm, tail lengths averaged = 43.6 ± 9.7 µm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.

Pitaya Virus X Coat Protein Acts as an RNA Silencing Suppressor and Can Be Used as a Specific Target for Detection Using RT-LAMP.

Selenicereus undatus (Haworth) D.R. Hunt (pitaya) is a tropical fruit that has been commonly cultivated in Guizhou Province, China, in recent years due to its good taste and high nutritional value. This planting area currently ranks third in China. Viral diseases have increasingly emerged in pitaya cultivation because of the expansion of the pitaya planting area and the characteristics of asexual propagation. The spread of pitaya virus X (PiVX; a Potexvirus) is among the most severe viruses threatening the quality and yield of pitaya fruit. To investigate the occurrence of PiVX in pitaya cultivations in Guizhou Province, we developed a reverse transcription loop-mediated isothermal amplification (RT-LAMP) method that can detect PiVX with high sensitivity and specificity at a low cost and produce a visualized result. Our best RT-LAMP system was significantly more sensitive than RT-PCR and was highly specific to PiVX. Furthermore, PiVX coat protein (CP) can form a homodimer, and PiVX may use its CP as a plant RNA silencing suppressor to enhance infection. To the best of our knowledge, this is the first report of fast detection of PiVX and functional exploration of CP in a Potexvirus. These findings will provide an opportunity for early diagnosis and prevention of viruses in pitaya.

Configurable Pseudo Noise Radar Imaging System Enabling Synchronous MIMO Channel Extension.

In this article, we propose an evolved system design approach to ultra-wideband (UWB) radar based on pseudo-random noise (PRN) sequences, the key features of which are its user-adaptability to meet the demands provided by desired microwave imaging applications and its multichannel scalability. In light of providing a fully synchronized multichannel radar imaging system for short-range imaging as mine detection, non-destructive testing (NDT) or medical imaging, the advanced system architecture is presented with a special focus put on the implemented synchronization mechanism and clocking scheme. The core of the targeted adaptivity is provided by means of hardware, such as variable clock generators and dividers as well as programmable PRN generators. In addition to adaptive hardware, the customization of signal processing is feasible within an extensive open-source framework using the Red Pitaya® data acquisition platform. A system benchmark in terms of signal-to-noise ratio (SNR), jitter, and synchronization stability is conducted to determine the achievable performance of the prototype system put into practice. Furthermore, an outlook on the planned future development and performance improvement is provided.

Identification of HuSWEET Family in Pitaya (Hylocereus undatus) and Key Roles of HuSWEET12a and HuSWEET13d in Sugar Accumulation.

The sugar composition and content of fruit have a significant impact on their flavor and taste. In pitaya, or dragon fruit, sweetness is a crucial determinant of fruit taste and consumer preference. The sugars will eventually be exported transporters (SWEETs), a novel group of sugar transporters that have various physiological functions, including phloem loading, seed filling, nectar secretion, and fruit development. However, the role of SWEETs in sugar accumulation in pitaya fruit is not yet clear. Here, we identified 19 potential members (HuSWEET genes) of the SWEET family in pitaya and analyzed their conserved motifs, physiochemical characteristics, chromosomal distribution, gene structure, and phylogenetic relationship. Seven highly conserved α-helical transmembrane domains (7-TMs) were found, and the HuSWEET proteins can be divided into three clades based on the phylogenetic analysis. Interestingly, we found two HuSWEET genes, HuSWEET12a and HuSWEET13d, that showed strong preferential expressions in fruits and an upward trend during fruit maturation, suggesting they have key roles in sugar accumulation in pitaya. This can be further roughly demonstrated by the fact that transgenic tomato plants overexpressing HuSWEET12a/13d accumulated high levels of sugar in the mature fruit. Together, our result provides new insights into the regulation of sugar accumulation by SWEET family genes in pitaya fruit, which also set a crucial basis for the further functional study of the HuSWEETs.

Pitaya Nutrition, Biology, and Biotechnology: A Review.

Pitaya (Hylocereus spp.) is a member of the cactus family that is native to Central and South America but is now cultivated throughout the sub-tropical and tropical regions of the world. It is of great importance due to its nutritional, ornamental, coloring, medicinal, industrial, and high consumption values. In order to effectively utilize and develop the available genetic resources, it is necessary to appreciate and understand studies pertaining to the usage, origin, nutrition, diversity, evaluation, characterization, conservation, taxonomy, and systematics of the genus Hylocereus. Additionally, to gain a basic understanding of the biology of the plant, this review has also discussed how biotechnological tools, such as cell and tissue culture, micropropagation (i.e., somatic embryogenesis, organogenesis, somaclonal variation, mutagenesis, androgenesis, gynogenesis, and altered ploidy), virus-induced gene silencing, and molecular marker technology, have been used to enhance pitaya germplasm.

Genomic Identification of CCCH-Type Zinc Finger Protein Genes Reveals the Role of HuTZF3 in Tolerance of Heat and Salt Stress of Pitaya (Hylocereus polyrhizus).

Pitaya (Hylocereus polyrhizus) is cultivated in a broad ecological range, due to its tolerance to drought, heat, and poor soil. The zinc finger proteins regulate gene expression at the transcriptional and post-transcriptional levels, by interacting with DNA, RNA, and proteins, to play roles in plant growth and development, and stress response. Here, a total of 81 CCCH-type zinc finger protein genes were identified from the pitaya genome. Transcriptomic analysis showed that nine of them, including HuTZF3, responded to both salt and heat stress. RT-qPCR results showed that HuTZF3 is expressed in all tested organs of pitaya, with a high level in the roots and stems, and confirmed that expression of HuTZF3 is induced by salt and heat stress. Subcellular localization showed that HuTZF3 is targeted in the processing bodies (PBs) and stress granules (SGs). Heterologous expression of HuTZF3 could improve both salt and heat tolerance in Arabidopsis, reduce oxidative stress, and improve the activity of catalase and peroxidase. Therefore, HuTZF3 may be involved in post-transcriptional regulation via localizing to PBs and SGs, contributing to both salt and heat tolerance in pitaya.

The Pitaya Flower Tissue's Gene Differential Expression Analysis between Self-Incompatible and Self-Compatible Varieties for the Identification of Genes Involved in Self-Incompatibility Regulation.

Self-incompatible pitaya varieties have low fruit-setting rates under natural conditions, leading to higher production costs and hindering industrial prosperity. Through transcriptome sequencing, we obtained the 36,900 longest transcripts (including 9167 new transcripts) from 60 samples of flowers. Samples were collected pre- and post-pollination (at 0 h, 0.5 h, 2 h, 4 h, and 12 h) from two varieties of pitaya (self-compatible Jindu No. 1 and self-incompatible Cu Sha). Using the RNA-Seq data and comparison of reference genomes, we annotated 28,817 genes in various databases, and 1740 genes were optimized in their structure for annotation. There were significant differences in the expression of differentially expressed genes (DEGs) in the pitaya stigmas under different pollination types, especially at the late post-pollination stage, where the expression of protease genes increasedal significantly under cross-pollination. We identified DEGs involved in the ribosomal, ubiquitination-mediated, and phyto-signaling pathways that may be involved in pitaya SI regulation. Based on the available transcriptome data and bioinformatics analysis, we tentatively identified HuS-RNase2 as a candidate gynogenetic S gene in the pitaya GSI system.

The Potential Use of Plant Growth Regulators for Modification of the Industrially Valuable Volatile Compounds Synthesis in Hylocreus undatus Stems.

The pitaya (dragon fruit) Hylocereus is a genus which belongs to the Cactaceae family. It is native to Mexico, occurring also in other regions of Central and South America. Pitaya fruit is mainly intended for consumption and for this reason the species is grown commercially. The fruit is a rich source of vitamins, biologically active compounds, and dietary fibre. Using in vitro culture can accelerate the process of reproduction and growth of pitaya plants. Profiling of volatile compounds contained in the stem of Hylocereus undatus was carried out using the SPME-GC-MS technique. The main compounds present were hexanal, 2-hexenal and 1-hexanol. The results showed differences in the occurrence of volatile compounds between plants grown in media with an addition of BA (6-benzylaminopurine) and IAA (indole-3-acetic acid), which have been used as plant growth regulators. Statistically significant differences between the contents of volatile compounds were observed in the case of 2-hexenal and 1-hexanol. The effect of BA on reducing the amount of volatile compounds was observed. However, introduction of IAA to the in vitro medium resulted in more compounds being synthesized. This study is the first to describe the volatile compounds in the pitaya stem. The results indicate that plant hormones are able to modify the profile of volatile compounds.

Measuring System for Determining the Quality of LED Light Sources and an Overview of LED Light Bulbs for Household Use.

Modern LED light sources have many advantages, as well as some disadvantages. One of the disadvantages is the pulsating luminous flux, which, in some cases, affects people's health and well-being negatively. The paper describes the design and making process of a measuring system for determining the quality of LED substitutes for conventional light bulbs and gives an overview of LED light bulbs for household use. The measurement system is controlled using the MATLAB software environment, in which data processing and plotting of the results are also performed. We acquired 59 different LED light bulbs from 37 manufacturers, and performed the measurements. The light bulbs are classified based on the percentage of fluctuations in the luminous flux, and the percentage of deviation of the measured luminous flux compared to the value stated on the packaging by the manufacturer.

Genome-Wide Identification of WRKY Gene Family in Pitaya Reveals the Involvement of HmoWRKY42 in Betalain Biosynthesis.

The WRKY gene family is a plant-specific transcription factor (TF) that regulates many physiological processes and (a) biotic stress responses. Despite this, little is known about the molecular properties and roles of WRKY TFs in pitaya betalain biosynthesis. Here we report the identification of 70 WRKY in Hylocereus undatus, their gene structure, locations on each chromosome, systematic phylogenetic analysis, conserved motif analysis, and synteny of HuWRKY genes. HmoWRKY42 is a Group IIb WRKY protein and contains a coiled-coil motif, a WRKY domain and a C2H2 zinc-finger motif (CX5CX23HXH). Results from yeast one-hybrid and transient dual-luciferase assays showed that HmoWRKY42 was a transcriptional repressor and could repress HmocDOPA5GT1 expression by binding to its promoter. Yeast two-hybrid assays showed that HmoWRKY42 could interact with itself to form homodimers. Knocking out the coiled-coil motif of HmoWRKY42 prevented its self-interaction and prevented it from binding to the HmocDOPA5GT1 promoter. Knocking out the WRKY domain and C2H2 zinc-finger motif sequence of HmoWRKY42 also prevented it from binding to the HmocDOPA5GT1 promoter. The coiled-coil motif, the WRKY domain and the C2H2 zinc finger motif are key motifs for the binding of HmoWRKY42 to the HmocDOPA5GT1 promoter. HmoWRKY42 is localized in the nucleus and possesses trans-activation ability responsible for pitaya betalain biosynthesis by repressing the transcription of HmocDOPA5GT1. As far as we know, no reports are available on the role of HmoWRKY42 in pitaya betalain biosynthesis. The results provide an important foundation for future analyses of the regulation and functions of the HuWRKY gene family.