Anillin and the microtubule bundler PRC1 maintain myosin in the contractile ring to ensure completion of cytokinesis.

Cytokinesis is the last step of cell division, when one cell physically divides into two cells. Cytokinesis is driven by an equatorial contractile ring and signals from antiparallel microtubule bundles (the central spindle) that form between the two masses of segregating chromosomes. Bundling of central spindle microtubules is essential for cytokinesis in cultured cells. Using a temperature-sensitive mutant of SPD-1, the homolog of the microtubule bundler PRC1, we demonstrate that SPD-1 is required for robust cytokinesis in the Caenorhabditis elegans early embryo. SPD-1 inhibition results in broadening of the contractile ring, creating an elongated intercellular bridge between sister cells at the last stages of ring constriction that fails to seal. Moreover, depleting anillin/ANI-1 in SPD-1-inhibited cells results in myosin loss from the contractile ring during the second half of furrow ingression, which in turn results in furrow regression and cytokinesis failure. Our results thus reveal a mechanism involving the joint action of anillin and PRC1, which operates during the later stages of furrow ingression to ensure continued functioning of the contractile ring until cytokinesis is complete.

Engineering a HER2-CAR-NK Cell Secreting Soluble Programmed Cell Death Protein with Superior Antitumor Efficacy.

A new therapy strategy for relapsing patients who have received trastuzumab treatment urgently needs to be explored. HER2-specific chimeric antigen receptor (CAR)-expressing NK cells are being rapidly developed for solid tumor therapy, as they have many advantages over HER2-CAR-T cells. Endogenous soluble PD-1 (sPD-1) from the PD-1 extracellular domain blocks PD-1/PD-L1 interaction to promote cancer immunology. Herein, we engineered a new HER2-CAR-NK cell that co-expresses sPD-1 (designed as sPD-1-CAR-NK cells) and assessed its cytotoxic activities toward various cancer cells, activation of immunity and sPD-1 release in vitro and in mouse models bearing breast cancer cells with high HER2 expression, with or without trastuzumab resistance. We demonstrated that sPD-1-CAR-NK cells were able to release bioactive sPD-1, thereby enhancing the cytolytic activities of HER2-CAR-NK cells against HER2 and PD-L1 highly expressing target cells accompanied by increases in the secretion of perforin, granzyme B and IFN-γ. In vivo, sPD-1-CAR-NK cells had superior immunological anticancer efficacy compared to HER2-CAR-NK cells, and they had advantages over HER2-CAR-NK cells in the intraperitoneal injection of sPD-1. Moreover, the infiltration and activation of NK and T cells into tumor tissue were increased in mice with sPD-1-CAR-NK cells. There was no significant change in the body temperature, organ tissue and body weight in all groups except for the group with the PD-1 injection. Together, these data indicate that HER2-specific sPD-1-CAR-NK cells can transport sPD-1 into cancer tissues with high HER2 expression, further improving the efficacy of HER-CAR-NK cells without obvious side effects. sPD-1-CAR-NK is a promising cytotherapeutic agent for patients bearing HER2-positive breast cancer, including those with trastuzumab resistance.

Disease Progression in Patients With Nontuberculous Mycobacterial Lung Disease of Nodular Bronchiectatic (NB) Pattern: The Roles of Cavitary NB and Soluble Programmed Death Protein-1.

BACKGROUND: In patients with nodular bronchiectatic (NB) nontuberculous mycobacterial lung disease (NTM-LD), risk factors for disease progression have not been clearly investigated. The roles of cavitary NB and soluble programmed death protein-1 (sPD-1), an immune-related biomarker, in the disease course of NB NTM-LD remain unknown. METHODS: Patients with NB NTM-LD were enrolled from 2 medical centers in 2014-2020. We identified cavitary NB, measured sPD-1 levels, and analyzed factors associated with cavitary NB and predictors for disease progression of NB NTM-LD. RESULTS: Of 120 cases of NB NTM-LD, 87 (72.5%) were caused by Mycobacterium avium complex. sPD-1 levels were lower in 13 (10.8%) patients with cavitary NB than in noncavitary patients (P = .020). Over 1.41 ± 1.43 years of follow-up, 12 (92.3%) patients in the cavitary and 66 (61.7%) in the noncavitary group developed disease progression (P = .032). In multivariable analysis, body mass index (BMI [kg/m2]; adjusted hazard ratio [aHR], .895 [95% confidence interval, .811-.988]), sputum smear grade (aHR, 1.247 [1.014-1.534]), cavitary NB (aHR, 2.008 [1.052-3.834]), and sPD-1 (per 10-pg/mL increase; aHR, .889 [.816-.967]) were predictive for disease progression. Notably, sPD-1 showed a dose-dependent association with disease progression (sPD-1 ≤23.5 pg/mL; aHR, 3.306 [1.664-6.567]; sPD-1: 23.6-53.7 pg/mL; aHR, 2.496 [1.390-4.483]) compared with the reference (sPD-1 >53.7 pg/mL). CONCLUSIONS: Patients with NB NTM-LD and low sPD-1, low BMI, high smear grade, and cavitary NB were at high risk for disease progression. sPD-1 was low in patients with cavitary NB phenotype and dose-responsively associated with disease progression.

Prognostic value of soluble programmed cell death-1 (sPD-1) and soluble programmed cell death ligand-1 (sPD-L1) for hepatocellular carcinoma: a systematic review and meta-analysis.

BACKGROUND: Preliminary studies have suggested that soluble programmed death-1 (sPD-1) and soluble programmed cell death ligand-1 (sPD-L1) have prognostic implications in many malignant tumors. However, the correlation between sPD-1/sPD-L1 level and prognosis of hepatocellular carcinoma (HCC) is still unclear. METHODS: We searched several electronic databases from database inception to October 7, 2021. Meta-analyses were performed separately for overall survival (OS), disease-free survival (DFS), recurrence-free survival (RFS), time to progression (TTP), and tumor-free survival (TFS). Random effects were introduced to this meta-analysis. The correlation between sPD-1/sPD-L1 level and prognosis was evaluated using hazard ratios (HRs) with 95% confidence intervals (95%CIs). RESULTS: A total of 11 studies (1291 patients) were incorporated into this meta-analysis, including seven on sPD-L1, two on sPD-1, and two about both factors. The pooled results showed that high sPD-L1 level was associated with worse OS (HR = 2.46, 95%CI 1.74-3.49, P < 0.001; I2 = 31.4, P = 0.177) and poorer DFS/RFS/TTP/TFS of patients with HCC (HR = 2.22, 95%CI 1.47-3.35, P < 0.001; I2 = 66.1, P = 0.011), irrespective of method of detection, study type, treatment, cut-off value and follow-up time. In contrast, the level of sPD-1 was not correlated to the OS (HR = 1.19, 95%CI 0.55-2.56, P = 0.657) and DFS/TFS of patients with HCC (HR = 0.94, 95%CI 0.36-2.49, P = 0.906). CONCLUSION: sPD-L1 rather than sPD-1 could be a good predictor for recurrence and survival after treatment for HCC. More high-quality prospective studies are warranted to assess the prognostic value of sPD-1 or sPD-L1 for HCC.

Cellular and soluble immune checkpoint signaling forms PD-L1 and PD-1 in renal tumor tissue and in blood.

Immune checkpoint blockade therapy is a treatment option of various metastatic cancer diseases including renal cell carcinoma (RCC). Approved antibody drugs target the co-inhibitory signaling of Programmed Cell Death Ligand-1 (PD-L1) and its receptor Programmed Cell Death-1 (PD-1). The combined evaluation of PD-L1 and PD-1 at the mRNA and protein levels in tumor tissue with differentiation of tumor and immune cells as well as of soluble forms (sPD-L1) and (sPD-1) in blood is of basic interest in assessing biomarker surrogates. Here, we demonstrate that PD-L1 determined as fraction of stained tumor cells (TPS-score) correlates with PD-L1-mRNA in tumor tissue, reflecting the predominant expression of PD-L1 in tumor cells. Conversely, PD-1 in immune cells of tumor tissue (IC-score) correlated with PD-1-mRNA tissue levels reflecting the typical PD-1 expression in immune cells. Of note, sPD-L1 in blood did not correlate with either the TPS-score of PD-L1 or with PD-L1-mRNA in tumor tissue. sPD-L1 released into the supernatant of cultured RCC cells closely followed the cellular PD-L1 expression as tested by interferon γ (IFNG) induction and siRNA knockdown of PD-L1. Further analysis in patients revealed that sPD-L1 significantly increased in blood following renal tumor resection. In addition, sPD-L1 correlated significantly with inflammation marker C-reactive protein (CRP) and with PD-L1 mRNA level in whole blood. These results indicate that the major source of sPD-L1 in blood may be peripheral blood cells and not primarily tumor tissue PD-L1.

An automated, rapid fluorescent immunoassay to quantify serum soluble programmed death-1 (PD-1) protein using testing-on-a-probe biosensors.

OBJECTIVES: Soluble programmed death-1 (sPD-1) plays an essential role in the pathogenesis and progression of various diseases, including chronic hepatitis B (CHB) and hepatocellular carcinoma (HCC). Currently, there is no Food and Drug Administration-approved sPD-1 immunoassay available for routine clinical testing. Most sPD-1 detections employed enzyme-linked immunosorbent assay (ELISA) method for research purpose, which is complicated by intensive manual operation and cannot achieve automatic detection. Therefore, we aimed to develop an automated, rapid immunoassay for sPD-1 measurement based on testing-on-a-probe (TOP) biosensors and evaluate its performance in patients with hepatic diseases. METHODS: We developed an automatic fluorescent immunoassay using TOP biosensors using a pair of mouse anti-PD-1 monoclonal antibodies (mAbs), which were evaluated by biolayer interferometry. The sensitivity, linearity, and repeatability of the novel immunoassay were analyzed, and its compatibility with an established ELISA kit was evaluated. Further, we quantified sPD-1 level in healthy individuals as well as patients with CHB, hepatic cirrhosis, and HCC. RESULTS: The TOP assay to quantify sPD-1 was developed and performed on an automatic fluorescent analyzer within 20 min, which showed good precision with coefficients of variation less than 10% and good linearity ranging from 2 to 3,000 pg/mL. The results tested by our TOP assay correlated well with the established ELISA assay (r=0.92, p<0.0001). Using our TOP assay, sPD-1 was significantly elevated in patients with chronic hepatitis, hepatic cirrhosis and hepatocarcinoma if compared to healthy control, respectively (p<0.0001). CONCLUSIONS: An automated, rapid fluorescent immunoassay to quantify serological sPD-1 protein using TOP biosensors was developed and showed acceptable analytical performance including precision, linearity, and good correlation with the established ELISA assay, with the great potential in clinical practice.

The correlation of serum sPD-1 and sPD-L1 levels with clinical, pathological characteristics and lymph node metastasis in nonsmall cell lung cancer patients.

BACKGROUND: Significant advances have been achieved in immunotherapy for the treatment of lung cancer. It is known that tumor cells and cells in the tumor microenvironment express high amounts of programmed cell death ligand 1 (PD-L1). These PD-L1s interact with programmed cell death protein 1 (PD-1), causing immunosuppression. The aim of our study is to examine the correlation between the serum sPD-1 and sPD-L1 levels and clinicopathological characteristics in patients with nonsmall cell lung cancer. We also compared our results with the healthy population (control group). METHODS: Thirthy-seven nonsmall cell lung cancer (NSCLC) patients who were operated in our clinic were included in our study. The control group included fifteen healthy patients. The sPD-1 and sPD-L1 levels were measured in serum samples by using the ELISA method. RESULTS: The preoperative sPD-1 and sPD-L1 levels were significantly higher in the study group compared to the control group (44.12 ± 22.25 pg/mL vs. 18.54 ± 6.56 pg/mL; p = 0.001 and 26.15 ± 18.03 pg/mL vs. 10.29 ± 3.08 pg/mL; p = 0.001, respectively). There was a statistically significant decline in serum sPD-1 and sPD-L1 levels at the preoperative and postoperative 1st, 7th, and 30th days following surgical resection (44.12 ± 22.25 pg/mL, 37.86 ± 18.02 pg/mL, 36.33 ± 18.36 pg/mL, 34.14 ± 13.71 pg/mL; p = 0.007 and 26.15 ± 18.03 pg/mL, 20.60 ± 15.50 pg/mL, 18.31 ± 14.04 pg/mL, 13.64 ± 10.60 pg/mL; p = 0.001, respectively).There was a positive correlation between the preoperative and postoperative 30th day serum sPD-1 levels and the tumor size (p = 0.031, r = 0.352; p = 0.024, r = 0.371; respectively). We also found a positive correlation between the preoperative and postoperative 30th day serum sPD-L1 levels and pleural invasion (p = 0.001, p = 0.001; respectively), and the N category (p = 0.015, p = 0.013; respectively). DISCUSSION: We think that sPD-1 and sPD-L1 levels may be used as a potential biomarker for lung cancer screening, prediction of the stage, and besides to detect recurrences and/or metastases following resection in NSCLC following validation with multicenter and larger-scale prospective trials.

Soluble forms of PD-1/PD-L immune checkpoint receptor and ligand in blood serum of breast cancer patients: association with clinical pathologic factors and molecular type of the tumor.

Results of enzyme-linked immunosorbent assay of the soluble forms of PD-1/PD-L immune checkpoint receptor and ligand (sPD-1 and sPD-L1) in pretreatment blood serum of 88 breast cancer patients at various disease stages aged 30-83 years are presented. The control group included 55 practically healthy women aged 19-82 years. Serum sPD-1 and sPD-L1 levels in breast cancer patients highly significantly (p<0.0001) differ from control and these changes are opposite: soluble receptor level is more than 6-fold decreased, while soluble ligand concentration - 5.5 fold increased. Both markers separately, as well as their ratio demonstrate very high sensitivity (94-100%) and specificity (95-100%) in relation to healthy control. No statistically significant associations of sPD-1 and sPD-L1 levels with clinical stage, individual TNM system criteria, tumor histological structure, grade, receptor status, and molecular type were established. In particular, no significant peculiarities of the markers' levels in triple negative breast cancer successfully treated with anti-PD-1/PD-L1 preparations were revealed. Long-term follow-up and dynamic studies of sPD-1 and sPD-L1serum levels in the course of treatment are required for evaluation of their independent from clinical and morphological factors prognostic significance and the possibility of application as low invasive tests for prediction and monitoring of corresponding targeted therapy efficiency.

Soluble programmed death molecule 1 (sPD-1) as a predictor of interstitial lung disease in rheumatoid arthritis.

BACKGROUND: Previous studies have indicated that the programmed death molecule 1 (PD-1) signaling pathway may play a key role in rheumatoid arthritis (RA). However, the pathogenesis of rheumatoid arthritis-related interstitial lung disease (RA-ILD) is not clear. We examined the serum levels of soluble PD-1 in patients with RA and its relationship with RA-ILD. METHODS: Blood samples were obtained from 87 patients with RA (58 with ILD and 29 without ILD) and 45 healthy controls. Serum sPD-1 was measured by Enzyme-Linked Immunosorbent Assay. The pulmonary interstitial disease score was completed by a pulmonary physician and a radiologist through chest high-resolution computed tomography. Patients with RA-ILD were tested for lung function [e.g., forced vital capacity (FVC%), diffusing capacity of lungs for carbon monoxide (DLCO%)]. Associations between ILD and various markers, including sPD-1 and confounding factors, were investigated by logistic regression analysis. Diagnostic values of sPD-1 for the presence of ILD were investigated using receiver operating characteristic curve analysis. RESULTS: Serum sPD-1 levels were higher in RA patients with ILD than in RA patients without ILD and healthy controls (185.1 ± 109.0 pg/ml vs. 119.1 ± 77.5 pg/ml vs. 52.1 ± 21.7 pg/ml, P < 0.05). Serum sPD-1 levels were positively correlated with RF titer (P = 0.02, r = 0.249), anti-cyclic citrullinated peptide antibody status (P = 0.02, r = 0.243), and serum IgG levels (P < 0.001, r = 0.368), negatively associated with FVC% (P = 0.02, r = - 0.344), forced expiratory volume (FEV1%) (P = 0.01, r = - 0.354), total lung capacity (TLC%) (P = 0.046, r = - 0.302), and was independently associated with the presence of ILD in RA patients by multivariate logistic regression analysis. The sensitivity and specificity of sPD-1 levels for the detection of ILD in RA patients were 58.6% and 75.9%, respectively. The area under the curve was 0.689. CONCLUSION: Serum sPD-1 levels were increased in RA patients with ILD. Increased sPD-1 may be a valuable biomarker to predict the presence of ILD in patients with RA.

Unbalanced expression of membrane-bound and soluble programmed cell death 1 and programmed cell death ligand 1 in systemic juvenile idiopathic arthritis.

The study aimed to investigate the soluble programmed death-1 (sPD-1) and its ligand (sPD-L1) levels in systemic juvenile idiopathic arthritis (sJIA) patients and elucidate its underlying immunomodulatory mechanisms. Plasma levels of sPD-1, sPD-L1 and related cytokines and proteins were detected using an enzyme-linked immunosorbent assay (ELISA) and Luminex. The effects of PD-1/PD-L1 signal on mDC (myeloid dendritic cell) and IL-6 secretion were measured using flow cytometry. The results revealed decreased levels of sPD-1 in sJIA patients negatively correlated with JADAS-27, PGA, PtGA and CRP. sJIA patients had lower CD86 and MHC-II expression on mDC. When blocking PD-1/PD-L1 signal, IL-6 secretion of DC were increased. Our finding displayed downregulated sPD-1 was related with clinical indicators and could be a new biomarker for sJIA diagnosis. The reduced membrane and soluble forms of PD-1/PD-L1 might take part in sJIA pathogenesis by enhancing mDC proliferation and IL-6 secretion.

Soluble programmed death-1 (sPD-1) as predictor of early surgical outcomes of paediatric cystic echinococcosis.

AIMS: Following treatment, cystic echinococcosis (CE) exhibits a relatively high relapse rate. Here, we evaluated the value of soluble programmed death-1 (sPD-1), sPD-1 ligand (sPD-L1) and anti-recP29 antibody concentrations, as predictors of early surgical treatment outcomes in young CE-affected patients. METHODS AND RESULTS: This prospective study included 59 Tunisian children (177 plasmas), where CE was surgically treated and monitored for 3 post-operative years. Based on CE post-surgical development, patients were clustered into a 'No relapsed' CE (NRCE; n = 39) and a 'Relapsed' CE (RCE; n = 20) group. Plasma levels of sPD-1, sPD-L1 and anti-recP29 IgG were measured using ELISA. In the NRCE group, sPD-1, sPD-L1 and anti-recP29 IgG concentrations were significantly lower at D365 than at D30. By contrast, in the RCE group, no significant difference was observed between D0, D30 and D365. When considering individual variations, the probability to be 'relapse-free' was 67% and 73% when anti-recP29 IgG and sPD-L1 level, respectively, decreased between D30 and D365. The probability to be 'relapse-free' was 86% when the sPD-1 level decreased between D30 and D365 (P = .003; chi-square test). CONCLUSION: sPD-1 may be a useful biomaker for the early evaluation of surgical procedure efficacy in paediatric CE cases.

Prognostic significance of soluble forms of immune checkpoint PD-1/PDL1 receptor and ligand in blood plasma of gastric cancer patients.

Analysis of long-term treatment results of 101 primary gastric cancer patients at various stages of the tumor process followed during 1 - 41 months (median - 6,4 months) from the onset of specific treatment are presented depending on the levels of soluble forms (s) of PD-1 receptor and its ligand PD-L1 in blood plasma. Overall survival assessed by Kaplan-Meyer analysis and with the help of Cox multiparametric regression model was applied as the criterion of prognostic value. It was found that at high (≥ 35 pg/ml) sPD-L1 levels in blood plasma, the overall survival of patients with gastric cancer was statistically significantly lower than at the marker's levels below 35 pg / ml (p <0.045): 1-year survival comprised 78 and 96%, 2-year - 52 and 78%; 3-year - 40 and 61% at high and low sPD-L1 respectively. Median survival of patients with high plasma sPD-L1 comprised 29 months, of those with low sPD-L1 was not achieved during the whole follow-up period. This trend was observed not only in the total group of stage I-IV gastric cancer patients, but also in patients at the early stages of the disease, though sPD-L1 did not show an independent prognostic value in multiparametric model. At the same time, the overall survival of patients with gastric cancer did not depend on the baseline levels sPD-1 in blood plasma. Thus, soluble ligand sPD-L1 can be considered as a potentially valuable factor for prognosis of gastric cancer patients' survival, and, probably, of anti-PD-1/PD-L1 treatment efficiency, but further studies and patients' monitoring are required to prove this statement.

Soluble forms of immune checkpoints in ovarian cancer.

The data of a complex immunoassay comparative study of the content of soluble forms of sPD-1, sPD-L1, sNKG2D, sNKG2DL1, sB7-H3 and sHLA-G in the blood plasma of 75 patients with epithelial ovarian cancer and 20 healthy donors of the control group are presented. The diagnostic significance of the studied proteins was determined. The study showed that the profile of soluble immunity checkpoints differs when malignant ovarian pathology occurs. There was a statistically significant decrease in the content of sPD-L1, sNKG2DL1, sB7-H3, and sHLA-G in the blood plasma of patients compared with the control group. Differences were found in the content of the studied markers depending on the histological type of tumors. Correlations between the soluble forms of some of the studied proteins are shown, indicating the presence of independent mechanisms of immune regulation in ovarian cancer, which may explain the insufficient effectiveness of the existing immunotherapy for this type of tumor. The results obtained will undoubtedly facilitate the development of new effective methods for the diagnostics and therapy of ovarian cancer.

Serum levels of soluble programmed death-1 (sPD-1) and soluble programmed death ligand 1(sPD-L1) in systemic lupus erythematosus: Association with activity and severity.

The programmed cell death-1 (PD-1)/programmed cell death ligand 1 (PD-L1) pathway is an important host immunosuppression mechanism. Soluble PD-1 (sPD-1) and PD-L1 (sPD-L1) expression regulates co-inhibitory signals in autoimmune disorders. Here, we evaluated whether serum sPD-1 and sPD-L1 are involved in immune dysfunction and assessed its relationship with SLE. Blood samples were obtained from 130 patients with SLE and 44 healthy controls. Serum sPD-1 and sPD-L1 were tested by enzyme-linked immunosorbent assay (ELISA). Relevant immune parameters were analysed. Both serum sPD-1 and sPD-L1 were significantly higher in the SLE patients than in the controls. A series of severe disease clinical manifestations and laboratory features such as presence of decreased complement component 3, complement component 4 and SLEDAI >8 were associated with elevated sPD-1 and sPD-L1. Our study suggests that abnormal sPD-1 and sPD-L1 expression may be involved in the imbalance of immune regulation in SLE.

Key Immune Checkpoint PD-1/PD-L1 Signaling Pathway Components in the Blood Serum from Patients with Bone Tumors.

The levels of sPD-1 and sPD-L1 were analyzed in blood serum of 132 patients (age 14-70 years) with primary bone tumors: osteosarcoma (N=39), chondrosarcoma (N=42), Ewing sarcoma (N=9), chordoma (N=12), giant-cell bone tumor (GCBT) (N=16), benign neoplasms (N=14) and in and practically healthy subjects (age 19-58 years; N=27). sPD-L1 levels in all studied bone neoplasms were significantly higher than in the control. Serum sPD-1 level in GCBT patients was significantly higher than in the control, benign neoplasms, chondrosarcoma, and chordoma patients, but did not differ from osteosarcoma group. sPD-1 concentration in Ewing sarcoma was significantly higher than in chordoma and chondrosarcoma, but did not differ from the control. sPD-1 level in chondrosarcoma patients was also lower than in osteosarcoma, Ewing sarcoma, and in the control. Both sPD-1 and sPD-L1 concentrations were not significantly associated with the type of affected bone, process localization, disease stage, tumor histological grade, patients' age and sex. These results suggest the possibility of using these biological markers for preliminary assessment of the character of the process in the bone.

[The content of the soluble forms PD-1 and PD-L1 in blood serum of patients with gastric cancer and their relationship with clinical and morphological characteristics of the disease.]

Results of comparative ELISA investigation of pretreatment sPD-1 and sPD-L1 content in blood plasma of 100 gastric cancer patients at various disease stages aged 25 to 81 years are presented. Control group included 60 practically healthy donors aged 18 - 68 years. Plasma sPD-L1 concentrations did not differ between gastric cancer patients and control group, and sPD-1 levels were statistically significantly lower in patients than in healthy donors (p<0.0001). Positive correlation (R=0.38; p=0.003) was revealed between plasma sPD-1 и sPD-L1 levels in control group and negative (R= -0.26; p=0,009) - in gastric cancer patients. ROC curve revealed the best sPD-1 cut-off level (< 21 pg/ml) with 77% sensitivity and 63.3% specificity, which is not sufficient for its application as diagnostic marker. Statistically significant increase of plasma sPD-L1 from stage I to stage IIIC (R=0.50; p=0.000011) was found. Analysis of associations between the evaluated markers' levels and indices of gastric cancer expansion according to TNM system revealed statistically significant positive associations of plasma sPD -L1 levels with T (tumor invasiondepth) and N (number of affected lymph nodes) indices: R=0.33; p=0.00093, and R=0.27; p=0.0099 respectively. sPD-L1 level was significantly increased in patients with low differentiated adenocarcinoma and cricoid-cell cancer as compared to highly differentiated adenocarcinoma (p=0.02 and p=0.004 respectively); in patients with cricoid-cell cancer it was also higher than in those with moderately differentiated adenocarcinoma (p=0.043) and undifferentiated cancer (p=0.049). Plasma sPD-1 level did not depend on disease stage, TNM system indices and tumor histological structure. Thus, soluble ligand sPD-L1, but not its receptor sPD-1, plasma level is increased in patients with unfavorable clinical and morphological characteristics, may be regarded as potentially valuable prognostic factor for gastric cancer patients' survival, and probably as a predictor of anti - PD-1/PD-L1 treatment efficiency.

Comparative analysis of the levels of soluble forms of receptor and ligand of the immunity control point PD-1/PD-L1 in the blood serum of patients with typical bone osteosarcoma and chondrosarcoma.

Results of ELISA investigation of the pretreatment sPD-1 and sPD-L1 content in blood serum of 133 bone neoplasms patients aged 6-70 years and 57 practically healthy control persons aged 12-70 years are described. In 14 patients the neoplasms were of a benign character, in 16 - borderline giant-cell bone tumor was diagnosed, and in 103 - malignant bone lesions including 39 osteosarcomas and 42 chondrosarcomas were revealed. The sPD-1 receptor concentrations in blood serum did not differ between control healthy persons and primary bone tumor patients, while serum sPD-L1 level in bone tumor patients was statistically significantly increased (p<0.0000001). By means of ROC curve construction a cut-off sPD-L1 level of 16.5 pg/ml was found that imposed 75,9% sensitivity and 75,4% specificity in relation to healthy control. However, the frequency of sPD-L1 levels exceeding 16.5 pg/ml was approximately similar in benign, borderline and malignant bone tumor patients. Analysis of the pattern of sPD-1 and sPD-L1 circulation in the peripheral blood of patients with the most prevalent malignant bone tumors - osteosarcoma and chondrosarcoma - demonstrated that in both sarcoma types sPD-L1 level was significantly higher than in control, but in patients with chondrogenic tumors the soluble ligand sPD-L1 dominates in the circulation, while in those with osteogenic tumors - sPD-1 receptor prevails. In particular, sPD-1 level is statistically significantly higher in patients with typical osteosarcoma than in those with typical chondrosarcoma (p=0.002437), and sPD-L1/sPD-1 concentration ratio in chondrosarcoma is highly significantly more than 2-fold higher than in osteosarcoma (0.81 and 0.35 respectively; p=0.000284). The sensitivity of sPD-L1 ≥16.5 pg/ml test in typical osteosarcoma patients' group comprised only 70.2%, and in those with typical chondrosarcoma - 84.6%. Serum sPD-1 and sPD-L1 concentrations in osteosarcoma and chondrosarcoma patients were not associated with the indices of tumor advancement, its histological grade, localization in the osseous system, and type of affected bone. Thus, it can be concluded that the ratio between circulating soluble forms of the receptor and the ligand of PD-1/PD-L signaling pathway differs between patients with chondrogenic and those with osteogenic tumors, sPD-L1 being diagnostically valuable mostly for chondrogenic bone neoplasms.

Unbalanced expression of membrane-bound and soluble inducible costimulator and programmed cell death 1 in patients with myasthenia gravis.

This study aimed to investigate the possible functions and mechanisms of positive and negative costimulatory molecules in the pathological process of myasthenia gravis (MG). The expression levels of membrane-bound inducible costimulator (ICOS) and programmed cell death 1 (PD-1) in peripheral blood T cells, their corresponding ligands ICOSL and PDL-1 on B cells, and their soluble forms (sICOS, sPD-1, sICOSL, and sPDL-1) in plasma were detected in patients with untreated-stage MG (USMG) and remission-stage MG (RSMG). The results showed that the expression levels of membrane-bound ICOS and PD-1 in the peripheral blood T cells of the USMG group and their corresponding ligands ICOSL and PD-L1 on B cells were significantly increased compared to those in the RSMG group and healthy controls (HCs). The levels of sICOSL and sPD-1 were significantly upregulated in USMG patients compared to those in the RSMG and HC groups, while the levels of sICOS and sPD-L1 were not different. The expression of PD-L1 on CD19+ B cells was positively correlated with the concentrations of AchR Ab in the USMG group. The expression of ICOS and PD-1 in CD4+ T cells and the expression of ICOSL and PD-L1 on CD19+ B cells were positively correlated with the quantitative myasthenia gravis (QMG) scores in the USMG group. Also, in the USMG group, the plasma levels of sICOSL and sPD-1 were positively correlated with the QMG scores. In addition, the percentage of peripheral blood follicular helper T (Tfh) cells in the USMG group was positively correlated with ICOS and PD-1 expression on CD4+ T cells and ICOSL and PD-L1 expression on CD19+ B cells. There were positive correlations between sICOSL and sPD-1 levels and the percentage of peripheral blood Tfh cells and plasma interleukin-21 (IL-21) levels in the USMG group. The results suggest that the positive ICOS/ICOSL and negative PD-1/PD-L1 costimulatory molecule pairs participate in the pathological process of MG. Abnormal sICOSL and sPD-1 expression might interfere with the normal signal transduction of ICOS and PD-1 on Tfh cells, causing excessive activation of Tfh cells and promotion of disease progression. sICOSL and sPD-1 have potential value in monitoring MG disease states.

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family.

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Increased antitumor activities of glypican-3-specific chimeric antigen receptor-modified T cells by coexpression of a soluble PD1-CH3 fusion protein.

Our recent clinical study demonstrated that glypican-3 (GPC3)-specific chimeric antigen receptor-modified T (CAR-T) cells are a promising treatment for hepatocellular carcinoma (HCC). However, the interaction of programmed cell death 1 (PD-1) and PD-L1-mediated T-cell inhibition is involved in immune evasion in a wide range of solid tumors, including HCC. To overcome this problem, we introduced a fusion protein composed of a PD-1 extracellular domain and CH3 from IgG4 into GPC3-specific CAR-T cells (GPC3-28Z) to block the PD-1/PD-L1 pathway. GPC3-specific CAR-T cells carrying the PD-1-CH3 fusion protein (sPD1) specifically recognized and lysed GPC3-positive HCC cells. The proliferation capacity of GPC3-28Z-sPD1 T cells after weekly stimulation with target cells was much higher than that of control GPC3-28Z T cells. Additionally, the coexpression of sPD1 could protect CAR-T cells from exhaustion when incubated with target cells, as phosphorylated AKT and Bcl-xL expression levels were higher in GPC3-28Z-sPD1 T cells than in GPC3-28Z cells. Importantly, in two HCC tumor xenograft models, GPC3-28Z-sPD1 T cells displayed a significantly higher tumor suppression capacity than GPC3-28Z T cells. In addition, an increased number of CD3+ T cells in the circulation and tumors and increased granzyme B levels and decreased Ki67 expression levels in the tumors were observed in the mice treated with GPC3-28Z-sPD1 T cells. Together, these data indicated that GPC3-specific CAR-T cells carrying sPD1 show promise as a treatment for patients with HCC.