In Vivo Delivery of Spherical and Cylindrical In Vitro Reconstituted Virus-like Particles Containing the Same Self-Amplifying mRNA.

The dramatic effectiveness of recent mRNA (mRNA)-based COVID vaccines delivered in lipid nanoparticles has highlighted the promise of mRNA therapeutics in general. In this report, we extend our earlier work on self-amplifying mRNAs delivered in spherical in vitro reconstituted virus-like particles (VLPs), and on drug delivery using cylindrical virus particles. In particular, we carry out separate in vitro assemblies of a self-amplifying mRNA gene in two different virus-like particles: one spherical, formed with the capsid protein of cowpea chlorotic mottle virus (CCMV), and the other cylindrical, formed from the capsid protein of tobacco mosaic virus (TMV). The mRNA gene is rendered self-amplifying by genetically fusing it to the RNA-dependent RNA polymerase (RdRp) of Nodamura virus, and the relative efficacies of cell uptake and downstream protein expression resulting from their CCMV- and TMV-packaged forms are compared directly. This comparison is carried out by their transfections into cells in culture: expressions of two self-amplifying genes, enhanced yellow fluorescent protein (EYFP) and Renilla luciferase (Luc), packaged alternately in CCMV and TMV VLPs, are quantified by fluorescence and chemiluminescence levels, respectively, and relative numbers of the delivered mRNAs are measured by quantitative real-time PCR. The cellular uptake of both forms of these VLPs is further confirmed by confocal microscopy of transfected cells. Finally, VLP-mediated delivery of the self-amplifying-mRNA in mice following footpad injection is shown by in vivo fluorescence imaging to result in robust expression of EYFP in the draining lymph nodes, suggesting the potential of these plant virus-like particles as a promising mRNA gene and vaccine delivery modality. These results establish that both CCMV and TMV VLPs can deliver their in vitro packaged mRNA genes to immune cells and that their self-amplifying forms significantly enhance in situ expression. Choice of one VLP (CCMV or TMV) over the other will depend on which geometry of nucleocapsid is self-assembled more efficiently for a given length and sequence of RNA, and suggests that these plant VLP gene delivery systems will prove useful in a wide variety of medical applications, both preventive and therapeutic.

First Report of Tobacco Mosaic Virus Infecting Bidens pilosa in China.

Bidens pilosa is an annual weed in family Asteraceae widely distributed in tropical and subtropical regions worldwide. It is also a natural host for at least five viruses including tomato spotted wilt orthotospovirus, tomato zonate spot orthotospovirus, pepper chlorotic spot orthotospovirus, Bidens mottle virus and Bidens mosaic virus, and therefore serve as a virus reservoir for various field crops (Yin et al. 2013; Xu et al. 2022; Wang et al. 2009). In August 2021, plants of B. pilosa displaying symptoms of chlorosis, mosaic and necrosis were observed surrounding a tobacco field in Kunming, Yunnan Province, China. Leaf samples were collected from four diseased B. pilosa plants and total nucleic acids were extracted using a CTAB based method (Li, R., et al. 2008). RT-PCR was carried out using virus-specific primers designed for the aforementioned five viruses as well as tobacco mosaic virus (TMV). The results indicated that none of the four samples tested positive for the 5 viruses, excepted for one sample, which produced an amplicon of the expected size (700 bp) with the TMV-specific primer pair of TMVF (CGGTCAGTGCCGAACAAGAA) and TMVR (TACGTGCCTGCGGATGTATATG). Cloning and sequencing the amplicon revealed a 717 nt fragment (accession no. OR136480) in the core cp region of TMV, showed the highest nt sequence identity of 99.6% with other TMV isolates (HE818450) in GenBank. TMV infection was also verified by dot-enzyme linked immunosorbent assay (DOT-ELISA) using antisera of TMV (Beijing Green Castle Agricultural Technology Co., Ltd.). To further confirm the TMV infection in B. pilosa plants, a TMV infectious clone (kindly provided by Dr. Fei Yan at Ningbo University, China) was inoculated into twelve healthy 3-week-old B. pilosa seedlings using Agrobacterium-mediated delivery. None of the inoculated B. pilosa plants exhibited distinct symptoms even at 30 days post-inoculation (dpi). Nevertheless, RT-PCR and Sanger sequencing results revealed that 2 of the inoculated B. pilosa plants were infected by TMV. The above results collectively indicate that TMV can infect B. pilosa under both natural and artificial conditions. However, it is possible that the symptoms observed on the diseased B. pilosa plants in the field may not be solely attributed to TMV but rather to the co-infection of TMV with other unidentified virus(es), which were not characterized in this study. TMV is considered one of the economically significant pathogens affecting crops such as tobacco (Nicotiana tabacum), pepper (Capsicum spp.), and tomato (Solanum lycopersicum). It is highly contagious and can be transmitted through various means, including seeds, soil and agricultural practice. B. pilosa is considered one of the most significant alien invasive weeds in China, mainly owing to its robust reproductive capacity. Furthermore, B. pilosa has the potential to act as a reservoir for various viruses that may affect field crops. The presence of TMV on B. pilosa plants may enhance the transmission efficiency of the virus in the field. Although TMV does not induce noticeable symptoms in B. pilosa, its presence on these plants could potentially increase the transmission efficiency of the virus in the field, posing a significant risk to field crops. Therefore, effective weed management and the diligent monitoring of TMV in B. pilosa should be recognized as essential sanitary practices for controlling viral diseases in field crops. To the best of our knowledge, this is the first report of TMV infecting B. pilosa in China.

Novel 1,3,4-Thiadiazole Derivatives: Synthesis, Antiviral Bioassay and Regulation the Photosynthetic Pathway of Tobacco against TMV Infection.

Tobacco mosaic virus (TMV) is a systemic virus that poses a serious threat to crops worldwide. In the present study, a series of novel 1-phenyl-4-(1,3,4-thiadiazole-5-thioether)-1H-pyrazole-5-amine derivatives was designed and synthesized. In vivo antiviral bioassay results indicated that some of these compounds exhibited excellent protective activity against TMV. Among the compounds, E2 (EC50 = 203.5 µg/mL) was superior to the commercial agent ningnanmycin (EC50 = 261.4 µg/mL). Observation of tobacco leaves infected with TMV-GFP revealed that E2 could effectively inhibit the spread of TMV in the host. Further plant tissue morphological observation indicated that E2 could induce the tight arrangement and alignment of the spongy mesophyll and palisade cells while causing stomatal closure to form a defensive barrier to prevent viral infection in the leaves. In addition, the chlorophyll content of tobacco leaves was significantly increased after treatment with E2, and the net photosynthesis (Pn) value was also increased, which demonstrated that the active compound could improve the photosynthetic efficiency of TMV-infected tobacco leaves by maintaining stable chlorophyll content in the leaves, thereby protecting host plants from viral infection. The results of MDA and H2O2 content determination revealed that E2 could effectively reduce the content of peroxides in the infected plants, reducing the damage to the plants caused by oxidation. This work provides an important support for the research and development of antiviral agents in crop protection.

A fungal protease named AsES triggers antiviral immune responses and effectively restricts virus infection in arabidopsis and Nicotiana benthamiana plants.

BACKGROUND AND AIMS: Plants have evolved complex mechanisms to fight against pathogens. Among these mechanisms, pattern-triggered immunity (PTI) relies on the recognition of conserved microbe- or pathogen-associated molecular patterns (MAMPs or PAMPs, respectively) by membrane-bound receptors. Indeed, PTI restricts virus infection in plants and, in addition, BRI1-associated kinase 1 (BAK1), a central regulator of PTI, plays a role in antiviral resistance. However, the compounds that trigger antiviral defences, along with their molecular mechanisms of action, remain mostly elusive. Herein, we explore the role of a fungal extracellular subtilase named AsES in its capacity to trigger antiviral responses. METHODS: In this study, we obtained AsES by recombinant expression, and evaluated and characterized its capacity to trigger antiviral responses against Tobacco mosaic virus (TMV) by performing time course experiments, analysing gene expression, virus movement and callose deposition. KEY RESULTS: The results of this study provide direct evidence that exogenous treatment with recombinant AsES increases a state of resistance against TMV infection, in both arabidopsis and Nicotiana benthamiana plants. Also, the antiviral PTI response exhibited by AsES in arabidopsis is mediated by the BAK1/SERK3 and BKK1/SERK4 co-receptors. Moreover, AsES requires a fully active salicylic acid (SA) signalling pathway to restrict the TMV movement by inducing callose deposition. Additionally, treatment with PSP1, a biostimulant based on AsES as the active compound, showed an increased resistance against TMV in N. benthamiana and tobacco plants. CONCLUSIONS: AsES is a fungal serine protease which triggers antiviral responses relying on a conserved mechanism by means of the SA signalling pathway and could be exploited as an effective and sustainable biotechnology strategy for viral disease management in plants.

First Report of Tobacco Mosaic Virus Infection in Paris polyphylla var. yunnanensis in China.

Paris polyphylla var. yunnanensis is a perennial herb in the family Trilliacea. The plants have immense medicinal and economic importance (Chen et al., 2021). Large-scale artificial planting has led to the emergence of various viral diseases in Paris polyphylla var. yunnanensis, including paris virus 1 (ParV1), paris mosaic necrosis virus (PMNV), paris polyphylla virus X, and pepper mild mottle virus (PMMoV) (Chen et al., 2021; Chen et al., 2022). However, tobacco mosaic virus (TMV) had not been reported as a pathogen on this host. In September 2021, symptoms of leaf shrinking, withering and mottling, and the plants demonstrating dwarfing first observed on Paris polyphylla var. yunnanensis in Qujing Province, Yunnan, China (Suppl Figure 1A). Leaves with these characteristic symptoms were collected from 20 plants. Virus particles in the samples were observed by transmission electron microscopy (TEM) using negative staining (Zhang et al., 2016). These samples revealed the presence of rod-shaped virions, which were approximately 300 nm long with a diameter of approximately 18nm (Suppl Figure 1B). Based on particle morphology these were identified as a putative Tobamovirus. To further identify the exact virus, total RNA was obtained using an RNA-easy Isolation Reagent (TaKaRaBiotech, Dalian, China), cDNA synthesis was performed and RT-PCR assays allowed to amplify a fragment of the CP gene of TMV using specific primers (Suppl table 1). A 480 bp fragment (Suppl Figure 1C) was obtained and cloned into the pMD-18T vector (TaKaRa Biotech, Dalian, China) and sequenced. BLASTn- analysis revealed that the 20 amplicons were identical and shared coat sequence (100%) identity with the TMV isolates Mile-1 (acc. no. MK584554.1) and the diseased P. polyphylla was infected with TMV. The sequence was deposited in the GenBank database with the accession number OM366238 (CP). The sap from infected plants was used as inoculum for transmission of TMV to 10 healthy Nicotiana glutinosa and N. tabacum K326, respectively. 15 days post-inoculation, obvious symptoms of necrosis and chlortisis for viral infection were observed on inoculated and systemic leaves. The systemic leaves of 20 from two species plants were collected, and tested positive for TMV by RT-PCR with the specific primers (Suppl table 1). The sequences of the movement protein (MP) gene (807 bp, OM3662406) and RNA-dependent RNA polymerase (RdRp) gene (3351 bp, OM366242) of TMV were obtained by RT-PCR assays using MP-and RdRp-specific primers (Suppl Table 1). A disease incidence survey was conducted by our team in three Paris polyphylla var. yunnanensis fields in Qujing province and we observed a symptom incidence of 60% across all three fields. To confirm that the symptoms corresponded to TMV infection, leaf samples from 20 plants were collected from per field and all plants tested positive for TMV using RT-PCR assays. To the best of our knowledge, this is the first report of TMV infection in P. polyphylla var. yunnanensis in China. This report, in combination with another recent report of new viruses (Paris mitovirus 1, Paris virus 2) that infects the plants (Chen et al., 2022), points toward a need to intensively monitor the viruses in fields to protect the P. polyphylla var. yunnanensis industry.

First Report of Tobacco Mosaic Virus Infecting Anisomeles indica (L.) Kuntze in China.

Anisomeles indica (L.) Kuntze is a perennial erect herb that belongs to the genus Epimeredi, family Labiatae (Hsieh et al., 2008). This herb is distributed in several southern provinces such as Yunnan, Sichuan and Guizhou in China, and it is also exported to Southeast Asian countries such as Singapore and Malaysia (Li., 2010; Yao et al., 2019). Due to its market potential and broad development prospects, the herb has been cultivated in Yunnan. In August 2021, virus-like symptoms on leaves, including shrinking, mosaic, and yellow mottling(Fig S1. A) appeared on approximately 80% of A. indica in the experimental fields of the Kunming Institute of Botany, Chinese Academy of Science, in Kunming, Yunnan. To unveil the possible viral agents associated with the disease symptoms, leaf samples were collected from 5 plants for transmission electron microscopy (TEM) analysis using negative staining (Zhang et al., 2016). Rhabditiform-shaped particles around 300 × 18 nm (Fig S1. C) were observed, which resemble those of tobamoviruses. To identify the exact virus, total RNA was extracted from the 20 leaf samples using the RNA-easy Isolation Reagent (Vazyme, Nanjing, China), followed by reverse transcription (RT)-PCR with a degenerate tobamovirus primer pair (Li et al., 2014). A 480-bp amplicon was obtained from each sample and cloned into the pMD18-T vector for Sanger sequencing (Takara, Dalian, China). BLASTn-analysis revealed that the 20 amplicons were identical and shared 100% nucleotide sequence identity with tobacco mosaic virus (TMV) isolate Bei Cang Zhu from Atractylodes lancea (acc. no. KU198186) One sequence was deposited in the GenBank under the accession number OK489807. ELISA testing with TMV-specific antibody (Agdia, USA) produced positive results for all of the 20 leaf samples. In order to understand the difference between TMV isolates from A. indica and those form other host plants, the sequences of movement protein (MP, 807 bp) and RNA-dependent RNA polymerase (RdRp, 3351 bp) of TMV were also obtained from one of the TMV infected samples using the target gene special primers (Tab. S1), and submitted to GenBank under the accession number OM3662406 (MP) and OM366242 (RdRp). BLASTn-analysis revealed that the amplicon of MP shared 97.75% nucleotide sequence identity with TMV isolate Henan 9-2-2017 from sweet potato (MN186255.1) and RdRp shared 97.43% nucleotide sequence identity with TMV isolate SXFQ from Solanum lycopersicum (JX993906.1). Phylogenetic analysis indicated that the isolate of A. indica grouped with several TMV isolates (e.g., tomato, AF103779.1 and tobacco, HE818449.1) from Northern China. The virus was successfully transmitted onto healthy A.indica plants (n = 5) upon mechanical inoculation as the plants not only developed foliar distortion symptoms but also tested positive for TMV by RT-PCR with the CP-specific primers (Tab. S1). Taken together, our results demonstrated that the diseased A. indica plants were infected with TMV. To our knowledge, this is the first report of TMV infected A. indica (L.) Kuntze in China. Symptomatic phenotype-based field surveys on some plantations in Yunnan Province indicated that the disease incidence ranged from 70% to 90%, resulting in significant loss of production of A. indica. It is necessary to monitor the viruses in the fields and find effective methods to protect TMV in the A. indica (L.) Kuntze industry.

Penicillium chrysogenum polypeptide extract protects tobacco plants from tobacco mosaic virus infection through modulation of ABA biosynthesis and callose priming.

The polypeptide extract of the dry mycelium of Penicillium chrysogenum (PDMP) can protect tobacco plants from tobacco mosaic virus (TMV), although the mechanism underlying PDMP-mediated TMV resistance remains unknown. In our study, we analysed a potential mechanism via RNA sequencing (RNA-seq) and found that the abscisic acid (ABA) biosynthetic pathway and ß-1,3-glucanase, a callose-degrading enzyme, might play an important role in PDMP-induced priming of resistance to TMV. To test our hypothesis, we successfully generated a Nicotiana benthamiana ABA biosynthesis mutant and evaluated the role of the ABA pathway in PDMP-induced callose deposition during resistance to TMV infection. Our results suggested that PDMP can induce callose priming to defend against TMV movement. PDMP inhibited TMV movement by increasing callose deposition around plasmodesmata, but this phenomenon did not occur in the ABA biosynthesis mutant; moreover, these effects of PDMP on callose deposition could be rescued by treatment with exogenous ABA. Our results suggested that callose deposition around plasmodesmata in wild-type plants is mainly responsible for the restriction of TMV movement during the PDMP-induced defensive response to TMV infection, and that ABA biosynthesis apparently plays a crucial role in PDMP-induced callose priming for enhancing defence against TMV.

Detection of plant virus particles with a capacitive field-effect sensor.

Plant viruses are major contributors to crop losses and induce high economic costs worldwide. For reliable, on-site and early detection of plant viral diseases, portable biosensors are of great interest. In this study, a field-effect SiO2-gate electrolyte-insulator-semiconductor (EIS) sensor was utilized for the label-free electrostatic detection of tobacco mosaic virus (TMV) particles as a model plant pathogen. The capacitive EIS sensor has been characterized regarding its TMV sensitivity by means of constant-capacitance method. The EIS sensor was able to detect biotinylated TMV particles from a solution with a TMV concentration as low as 0.025 nM. A good correlation between the registered EIS sensor signal and the density of adsorbed TMV particles assessed from scanning electron microscopy images of the SiO2-gate chip surface was observed. Additionally, the isoelectric point of the biotinylated TMV particles was determined via zeta potential measurements and the influence of ionic strength of the measurement solution on the TMV-modified EIS sensor signal has been studied.

Nanoscale Wetting of Single Viruses.

The epidemic spread of many viral infections is mediated by the environmental conditions and influenced by the ambient humidity. Single virus particles have been mainly visualized by atomic force microscopy (AFM) in liquid conditions, where the effect of the relative humidity on virus topography and surface cannot be systematically assessed. In this work, we employed multi-frequency AFM, simultaneously with standard topography imaging, to study the nanoscale wetting of individual Tobacco Mosaic virions (TMV) from ambient relative humidity to water condensation (RH > 100%). We recorded amplitude and phase vs. distance curves (APD curves) on top of single virions at various RH and converted them into force vs. distance curves. The high sensitivity of multifrequency AFM to visualize condensed water and sub-micrometer droplets, filling gaps between individual TMV particles at RH > 100%, is demonstrated. Dynamic force spectroscopy allows detecting a thin water layer of thickness ~1 nm, adsorbed on the outer surface of single TMV particles at RH < 60%.

Peroxidase activities of gold nanowires synthesized by TMV as template and their application in detection of cancer cells.

A sensing methodology that combines Au, tobacco mosaic virus (TMV), and folic acid for selective, sensitive, and colorimetric detection of tumor cells based on the peroxidase-like activity was reported in this study. Gold nanowires with a high aspect ratio were synthesized using TMV as a template. Au@TMV nanowire (AT) complex was obtained with diameter of 4 nm and length between 200 and 300 nm. In addition, since TMV was biocompatible and had many amino and carboxyl groups on its surface, AT was conjugated by folate to form a folic acid (FA)-conjugated AT composite (ATF) and tested by FTIR measurements. Furthermore, the peroxidase-like properties were studied and the optimal conditions for mimic enzyme activity were optimized. Finally, HeLa and other tumor cells expressed excessive receptors of folate on the surface, which can specifically bind to folic acid. As the specific binding of ATF with HeLa cells, the peroxidase properties of ATF were used for detection of cancer cells (Scheme 1). The cancer cells were detected not only qualitatively but also quantitatively. In this study, as low as 2000 cancer cells/mL could be detected using the current method.

Naamines and Naamidines as Novel Agents against a Plant Virus and Phytopathogenic Fungi.

Naamines, naamidines and various derivatives of these marine natural products were synthesized and characterized by means of nuclear magnetic resonance (NMR) spectroscopy and mass spectrometry. The activities of these alkaloids against a plant virus and phytopathogenic fungi were evaluated for the first time. A benzyloxy naamine derivative 15d displayed excellent in vivo activity against tobacco mosaic virus at 500 µg/mL (inactivation activity, 46%; curative activity, 49%; and protective activity, 41%); its activities were higher than the corresponding activities of the commercial plant virucide ribavirin (32%, 35%, and 34%, respectively), making it a promising new lead compound for antiviral research. In vitro assays revealed that the test compounds exhibited very good antifungal activity against 14 kinds of phytopathogenic fungi. Again, the benzyloxy naamine derivative 15d exhibited broad-spectrum fungicidal activity, emerging as a new lead compound for fungicidal research. Additional in vivo assays indicated that many of the compounds displayed inhibitory effects >30%.

Elongated Plant Virus-Based Nanoparticles for Enhanced Delivery of Thrombolytic Therapies.

Thrombotic cardiovascular disease, including acute myocardial infarction, ischemic stroke, and venous thromboembolic disease, is the leading cause of morbidity and mortality worldwide. While reperfusion therapy with thrombolytic agents reduces mortality from acute myocardial infarction and disability from stroke, thrombolysis is generally less effective than mechanical reperfusion and is associated with fatal intracerebral hemorrhage in up to 2-5% of patients. To address these limitations, we propose the tobacco mosaic virus (TMV)-based platform technology for targeted delivery of thrombolytic therapies. TMV is a plant virus-based nanoparticle with a high aspect ratio shape measuring 300 × 18 nm. These soft matter nanorods have favorable flow and margination properties allowing the targeting of the diseased vessel wall. We have previously shown that TMV homes to thrombi in a photochemical mouse model of arterial thrombosis. Here we report the synthesis of TMV conjugates loaded with streptokinase (STK). Various TMV-STK formulations were produced through bioconjugation of STK to TMV via intervening PEG linkers. TMV-STK was characterized using SDS-PAGE and Western blot, transmission electron microscopy, cryo-electron microscopy, and cryo-electron tomography. We investigated the thrombolytic activity of TMV-STK in vitro using static phantom clots, and in a physiologically relevant hydrodynamic model of shear-induced thrombosis. Our findings demonstrate that conjugation of STK to the TMV surface does not compromise the activity of STK. Moreover, the nanoparticle conjugate significantly enhances thrombolysis under flow conditions, which can likely be attributed to TMV's shape-mediated flow properties resulting in enhanced thrombus accumulation and dissolution. Together, these data suggest TMV to be a promising platform for the delivery of thrombolytics to enhance clot localization and potentially minimize bleeding risk.

Three new benzolactones from Lavandula angustifolia and their bioactivities.

Three new benzolactones (1-3), together with four known ones (4-7), were isolated from the whole herb of Lavandula angustifolia. Their structures were established on the basis of detailed spectroscopic analysis (1D- and 2D-NMR, HRESIMS, UV, and IR) and comparison with data reported in the literature. New compounds were evaluated for their anti-tobacco mosaic virus (TMV) activities and cytotoxic activities. The results revealed that compounds 1-3 showed obvious anti-TMV activities with inhibition rates of 26.9, 30.2, and 28.4%, which were at the same grade as positive control. Compounds 1-3 also showed weak inhibitory activities against some tested human tumor cell lines with IC50 values in the range of 32.1-7.6 µM.

Phenylpropionamides, Piperidine, and Phenolic Derivatives from the Fruit of Ailanthus altissima.

Four novel compounds-two phenylpropionamides, one piperidine, and one phenolic derivatives-were isolated and identified from the fruit of a medicinal plant, Ailanthus altissima (Mill.) Swingle (Simaroubaceae), together with one known phenylpropionamide, 13 known phenols, and 10 flavonoids. The structures of the new compounds were elucidated as 2-hydroxy-N-[(2-O-ß-d-glucopyranosyl)phenyl]propionamide (1), 2-hydroxy-N-[(2-O-ß-d-glucopyranosyl-(1→6)-ß-d-glucopyranosyl)phenyl]propionamide (2), 2ß-carboxyl-piperidine-4ß-acetic acid methyl ester (4), and 4-hydroxyphenyl-1-O-[6-(hydrogen-3-hydroxy-3-methylpentanedioate)]-ß-d-glucopyranoside (5) based on spectroscopic analysis. All the isolated compounds were evaluated for their inhibitory activity against Tobacco mosaic virus (TMV) using the leaf-disc method. Among the compounds isolated, arbutin (6), ß-d-glucopyranosyl-(1→6)-arbutin (7), 4-methoxyphenylacetic acid (10), and corilagin (18) showed moderate inhibition against TMV with IC50 values of 0.49, 0.51, 0.27, and 0.45 mM, respectively.

Salicylic acid binding of mitochondrial alpha-ketoglutarate dehydrogenase E2 affects mitochondrial oxidative phosphorylation and electron transport chain components and plays a role in basal defense against tobacco mosaic virus in tomato.

Salicylic acid (SA) plays a critical role in plant defense against pathogen invasion. SA-induced viral defense in plants is distinct from the pathways mediating bacterial and fungal defense and involves a specific pathway mediated by mitochondria; however, the underlying mechanisms remain largely unknown. The SA-binding activity of the recombinant tomato (Solanum lycopersicum) alpha-ketoglutarate dehydrogenase (Slα-kGDH) E2 subunit of the tricarboxylic acid (TCA) cycle was characterized. The biological role of this binding in plant defenses against tobacco mosaic virus (TMV) was further investigated via Slα-kGDH E2 silencing and transient overexpression in plants. Slα-kGDH E2 was found to bind SA in two independent assays. SA treatment, as well as Slα-kGDH E2 silencing, increased resistance to TMV. SA did not further enhance TMV defense in Slα-kGDH E2-silenced tomato plants but did reduce TMV susceptibility in Nicotiana benthamiana plants transiently overexpressing Slα-kGDH E2. Furthermore, Slα-kGDH E2-silencing-induced TMV resistance was fully blocked by bongkrekic acid application and alternative oxidase 1a silencing. These results indicated that binding by Slα-kGDH E2 of SA acts upstream of and affects the mitochondrial electron transport chain, which plays an important role in basal defense against TMV. The findings of this study help to elucidate the mechanisms of SA-induced viral defense.

Antagonism between phytohormone signalling underlies the variation in disease susceptibility of tomato plants under elevated CO2.

Increasing CO2 concentrations ([CO2]) have the potential to disrupt plant-pathogen interactions in natural and agricultural ecosystems, but the research in this area has often produced conflicting results. Variations in phytohormone salicylic acid (SA) and jasmonic acid (JA) signalling could be associated with variations in the responses of pathogens to plants grown under elevated [CO2]. In this study, interactions between tomato plants and three pathogens with different infection strategies were compared. Elevated [CO2] generally favoured SA biosynthesis and signalling but repressed the JA pathway. The exposure of plants to elevated [CO2] revealed a lower incidence and severity of disease caused by tobacco mosaic virus (TMV) and by Pseudomonas syringae, whereas plant susceptibility to necrotrophic Botrytis cinerea increased. The elevated [CO2]-induced and basal resistance to TMV and P. syringae were completely abolished in plants in which the SA signalling pathway nonexpressor of pathogenesis-related genes 1 (NPR1) had been silenced or in transgenic plants defective in SA biosynthesis. In contrast, under both ambient and elevated [CO2], the susceptibility to B. cinerea highly increased in plants in which the JA signalling pathway proteinase inhibitors (PI) gene had been silenced or in a mutant affected in JA biosynthesis. However, plants affected in SA signalling remained less susceptible to this disease. These findings highlight the modulated antagonistic relationship between SA and JA that contributes to the variation in disease susceptibility under elevated [CO2]. This information will be critical for investigating how elevated CO2 may affect plant defence and the dynamics between plants and pathogens in both agricultural and natural ecosystems.

Getting Hold of the Tobamovirus Particle-Why and How? Purification Routes over Time and a New Customizable Approach.

This article develops a multi-perspective view on motivations and methods for tobamovirus purification through the ages and presents a novel, efficient, easy-to-use approach that can be well-adapted to different species of native and functionalized virions. We survey the various driving forces prompting researchers to enrich tobamoviruses, from the search for the causative agents of mosaic diseases in plants to their increasing recognition as versatile nanocarriers in biomedical and engineering applications. The best practices and rarely applied options for the serial processing steps required for successful isolation of tobamoviruses are then reviewed. Adaptations for distinct particle species, pitfalls, and 'forgotten' or underrepresented technologies are considered as well. The article is topped off with our own development of a method for virion preparation, rooted in historical protocols. It combines selective re-solubilization of polyethylene glycol (PEG) virion raw precipitates with density step gradient centrifugation in biocompatible iodixanol formulations, yielding ready-to-use particle suspensions. This newly established protocol and some considerations for perhaps worthwhile further developments could serve as putative stepping stones towards preparation procedures appropriate for routine practical uses of these multivalent soft-matter nanorods.

Nanoparticle-dsRNA Treatment of Pollen and Root Systems of Diseased Plants Effectively Reduces the Rate of Tobacco Mosaic Virus in Contemporary Seeds.

Most crop viruses are carried and spread by seeds. Virus-infected seeds are seed-borne viral disease infections, and thus, reducing the rate of seed infection is an urgent problem in the seed-production industry. The objective of this study was to use nanoparticles (NPs) to directly deliver dsRNA into plants or pollen to initiate RNA interference (RNAi) to reduce viral carryover in seeds. Chitosan quaternary ammonium salt (HACC), complexed with dsRNAs, was selected for targeting the genes for the tobacco mosaic virus (TMV) coat protein (CP) and TMV RNA-dependent RNA polymerase (RdRP) to form HACC-dsRNA NPs. These NP-based dsRNAs were delivered to the plants using four different methods, including infiltration, spraying, root soaking, and pollen internalization. All four methods were able to reduce the seed-carrying rate of offspring seeds of the TMV-infected plants, with pollen internalization being the most effective in reducing the TMV-carrying rate from 95.1 to 61.1% in the control group. By measuring the plant uptake of fluorescence-labeled NPs and dsRNAs, the transportation of the HACC-dsRNA NPs into the plants was observed, and the uptake of dsRNA in combination with small RNA sequencing was further confirmed, resulting in the silencing of homologous RNA molecules during the topical application. The results demonstrated that the incidence of TMV infection was reduced by various degrees via RNAi induction without the need to develop transgenic plants. These results demonstrate the advantages of NP-based RNAi technology in breeding for disease resistance and developing a new strategy for virus-resistant breeding in plants.

Facile Purification and Use of Tobamoviral Nanocarriers for Antibody-Mediated Display of a Two-Enzyme System.

Immunosorbent turnip vein clearing virus (TVCV) particles displaying the IgG-binding domains D and E of Staphylococcus aureus protein A (PA) on every coat protein (CP) subunit (TVCVPA) were purified from plants via optimized and new protocols. The latter used polyethylene glycol (PEG) raw precipitates, from which virions were selectively re-solubilized in reverse PEG concentration gradients. This procedure improved the integrity of both TVCVPA and the wild-type subgroup 3 tobamovirus. TVCVPA could be loaded with more than 500 IgGs per virion, which mediated the immunocapture of fluorescent dyes, GFP, and active enzymes. Bi-enzyme ensembles of cooperating glucose oxidase and horseradish peroxidase were tethered together on the TVCVPA carriers via a single antibody type, with one enzyme conjugated chemically to its Fc region, and the other one bound as a target, yielding synthetic multi-enzyme complexes. In microtiter plates, the TVCVPA-displayed sugar-sensing system possessed a considerably increased reusability upon repeated testing, compared to the IgG-bound enzyme pair in the absence of the virus. A high coverage of the viral adapters was also achieved on Ta2O5 sensor chip surfaces coated with a polyelectrolyte interlayer, as a prerequisite for durable TVCVPA-assisted electrochemical biosensing via modularly IgG-assembled sensor enzymes.

Towards Multi-Analyte Detection with Field-Effect Capacitors Modified with Tobacco Mosaic Virus Bioparticles as Enzyme Nanocarriers.

Utilizing an appropriate enzyme immobilization strategy is crucial for designing enzyme-based biosensors. Plant virus-like particles represent ideal nanoscaffolds for an extremely dense and precise immobilization of enzymes, due to their regular shape, high surface-to-volume ratio and high density of surface binding sites. In the present work, tobacco mosaic virus (TMV) particles were applied for the co-immobilization of penicillinase and urease onto the gate surface of a field-effect electrolyte-insulator-semiconductor capacitor (EISCAP) with a p-Si-SiO2-Ta2O5 layer structure for the sequential detection of penicillin and urea. The TMV-assisted bi-enzyme EISCAP biosensor exhibited a high urea and penicillin sensitivity of 54 and 85 mV/dec, respectively, in the concentration range of 0.1-3 mM. For comparison, the characteristics of single-enzyme EISCAP biosensors modified with TMV particles immobilized with either penicillinase or urease were also investigated. The surface morphology of the TMV-modified Ta2O5-gate was analyzed by scanning electron microscopy. Additionally, the bi-enzyme EISCAP was applied to mimic an XOR (Exclusive OR) enzyme logic gate.