First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state's economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5'TCCACAAGCTTGATGGA- GGG3') and WCLaV-1RP (5'TCCCGAGTGAGGAAGCTAGT3'). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.

Insights Into the Etiology of Polerovirus-Induced Pepper Yellows Disease.

The study of an emerging yellows disease of pepper crops (pepper yellows disease [PYD]) in Greece led to the identification of a polerovirus closely related to Pepper vein yellows virus (PeVYV). Recovery of its full genome sequence by next-generation sequencing of small interfering RNAs allowed its characterization as a new poleroviruses, which was provisionally named Pepper yellows virus (PeYV). Transmission experiments revealed its association with the disease. Sequence similarity and phylogenetic analysis highlighted the common ancestry of the three poleroviruses (PeVYV, PeYV, and Pepper yellow leaf curl virus [PYLCV]) currently reported to be associated with PYD, even though significant genetic differences were identified among them, especially in the C-terminal region of P5 and the 3' noncoding region. Most of the differences observed can be attributed to a modular type of evolution, which produces mosaic-like variants giving rise to these different poleroviruses Overall, similar to other polerovirus-related diseases, PYD is caused by at least three species (PeVYV, PeYV, and PYLCV) belonging to this group of closely related pepper-infecting viruses.

Molecular Characterization of 'Candidatus Phytoplasma prunorum' in the Czech Republic and Susceptibility of Apricot Rootstocks to the Two Most Abundant Haplotypes.

'Candidatus Phytoplasma prunorum' is one of the most destructive pathogens of Prunus species, where susceptible species render unproductive several years after infection. In epidemiology, the molecular characterization of phytoplasmas is based on sequence analysis of variable nonribosomal genes. In this study aceF, pnp, imp and secY genes were used for characterization of the 'Ca. P. prunorum' genotypes present in the Czech Republic. In total, 56 plant and 33 vector (Cacopsylla pruni) samples positive to 'Ca. P. prunorum' collected in seven localities were used in the study. Based on sequence analysis, four aceF, two pnp, six imp, and three secY genotypes were identified in analyzed samples. The most abundant in both plant and insect samples were the A6, P2, I4, and S2 genotypes. Most of the Czech 'Ca. P. prunorum' haplotypes clustered together in the haplotype network analysis. Next, two isolates representing the two most abundant Czech haplotypes (A6-P2-I4-S2 and A5-P2-I4-S2) were used in the susceptibility test of three apricot rootstock types (St. Julien A, M-VA-1, GF-305). Susceptibility was analyzed by phytoplasma quantification using quantitative real-time PCR and evaluation of symptom manifestation. Based on the results, the influence of the rootstock type on the phytoplasma titer and symptom manifestation was greater than of the phytoplasma isolate, while the year of analysis had no influence on the results. The results also showed that the phytoplasma titer is increasing in plant tissues during the vegetation period.

Characterization of a novel psyllid-transmitted waikavirus in carrots.

Carrots collected from the Western Negev region in Israel during the winter of 2019 showed disease symptoms of chlorosis, leaf curling, a loss of apical dominance, and multiple lateral roots that were not associated with known pathogens of the carrot yellows disease. Symptomatic carrots were studied for a possible involvement of plant viruses in disease manifestations using high throughput sequencing analyses. The results revealed the presence of a waikavirus, sharing a ∼70% nucleotide sequence identity with Waikavirus genus members. Virions purified from waikavirus-positive carrots were visualized by transmission electron microscopy, showing icosahedral particle diameter of ∼28 nm. The genome sequence was validated by overlapping amplicons by designed 12 primer sets. A complete genome sequence was achieved by rapid amplification of cDNA ends (RACE) for sequencing the 5' end, and RT-PCR with oligo dT for sequencing the 3' end. The genome encodes a single large ORF, characteristic of waikaviruses. Aligning the waikavirus-deduced amino-acid sequence with other waikavirus species at the Pro-Pol region, a conserved sequence between the putative proteinase and the RNA-dependent RNA polymerase, showed a ∼40% identity, indicating the identification of a new waikavirus species. The amino-acid sequence of the three coat proteins and cleavage sites were experimentally determined by liquid chromatography-mass spectrometry. A phylogenetic analysis based on the Pro-Pol region revealed that the new waikavirus clusters with persimmon waikavirus and actinidia yellowing virus 1. The new waikavirus genome was localized in the phloem of waikavirus-infected carrots. The virus was transmitted to carrot and coriander plants by the psyllid Bactericera trigonica Hodkinson (Hemiptera: Triozidae).

Antimicrobial Activity of Metabolites Secreted by the Endophytic Bacterium Frateuria defendens.

Candidatus Phytoplasma, the causative agent of yellows disease, inflicts substantial damage on several hundred plant species including perennials and annual plants. The endophytic bacterium Frateuria defendens reduces the symptoms of yellows disease in a number of agricultural crops. One possible mode of action is that the bacterium secretes antimicrobial metabolites. To test this hypothesis, the substances secreted by the endophyte during 10 days of growth in an artificial medium were identified by GC-MS (gas chromatography-mass spectrometry). Synthetic analogues to these substances were then used on periwinkle, a nurse culture plant infected by phytoplasma. Phytoplasma quantities were evaluated by quantitative PCR, and disease symptoms were monitored and recorded. It was found that specific compounds identified by the biochemical analysis caused a significant reduction in both the titer of phytoplasma and the disease symptoms in periwinkle when compared to untreated infected plants. Further research is required to examine the potential of these compounds as an effective treatment against yellows disease.

Epidemiology and genetic diversity of criniviruses associated with tomato yellows disease in Greece.

Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV) are two whitefly transmitted viruses which are classified in the genus Crinivirus of the family Closteroviridae. Both induce similar yellowing symptoms in tomato and are responsible for severe economic losses. ToCV is transmitted by Bemisia tabaci Gennadious, Trialeurodes vaporariorum Westwood and Trialeurodes abutilonea Haldeman, whereas TICV is transmitted only by T. vaporariorum. An extensive study was conducted during 2009-2012 in order to identify the virus species involved in tomato yellowing disease in Greece. Samples from tomato, other crops and weeds belonging to 44 species from 26 families were collected and analyzed using molecular methods. In addition, adult whiteflies were collected and analyzed using morphological characters and DNA markers. Results showed that TICV prevailed in tomato crops (62.5%), while ToCV incidence was lower (20.5%) and confined in southern Greece. ToCV was also detected in lettuce plants showing mild yellowing symptoms for the first time in Greece. Approximately 13% of the tested weeds were found to be infected, with TICV being the predominant virus with an incidence of 10.8%, whereas ToCV was detected only in 2.2% of the analyzed samples. These results indicate that the host range of TICV and ToCV in Greece is far more extensive than previously believed. T. vaporariorum was the most widespread whitefly species in Greece (80%), followed by B. tabaci (biotypes B and Q) (20%). Sequence analysis of the CP and CPm genes from Greek tomato and weed isolates of ToCV and TICV showed that even though both viruses have very wide host ranges their populations show very low molecular divergence.