RESUMO
Direct RNA sequencing with a commercial nanopore platform was used to sequence RNA containing uridine (U), pseudouridine (Ψ) or N1-methylpseudouridine (m1Ψ) in >100 different 5-nucleotide contexts. The base calling data for Ψ or m1Ψ were similar but different from U allowing their detection. Understanding the nanopore signatures for Ψ and m1Ψ enabled a running start T7 RNA polymerase assay to study the selection of UTP versus ΨTP or m1ΨTP competing mixtures in all possible adjacent sequence contexts. A significant sequence context dependency was observed for T7 RNA polymerase with insertion yields for ΨTP versus UTP spanning a range of 20-65%, and m1ΨTP versus UTP producing variable yields that differ by 15-70%. Experiments with SP6 RNA polymerase, as well as chemically-modified triphosphates and DNA templates provide insight to explain the observations. The SP6 polymerase introduced m1ΨTP when competed with UTP with a smaller window of yields (15-30%) across all sequence contexts studied. These results may aid in future efforts that employ RNA polymerases to make therapeutic mRNAs with sub-stoichiometric amounts of m1Ψ.
Assuntos
Sequenciamento por Nanoporos , Análise de Sequência de RNA , Transcrição Gênica , RNA Polimerases Dirigidas por DNA/metabolismo , Nucleotídeos , Pseudouridina , Uridina TrifosfatoRESUMO
Respiratory viruses stimulate the release of antiviral IFNs from the airway epithelium. Previous studies have shown that asthmatic patients show diminished release of type I and type III IFNs from bronchial epithelia. However, the mechanism of this suppression is not understood. In this study, we report that extracellular nucleotides and histamine, which are elevated in asthmatic airways, strongly inhibit release of type I and type III IFNs from human bronchial airway epithelial cells (AECs). Specifically, ATP, UTP, and histamine all inhibited the release of type I and type III IFNs from AECs induced by activation of TLR3, retinoic acid-inducible gene I (RIG-I), or cyclic GMP-AMP synthase-STING. This inhibition was at least partly mediated by Gq signaling through purinergic P2Y2 and H1 receptors, but it did not involve store-operated calcium entry. Pharmacological blockade of protein kinase C partially reversed inhibition of IFN production. Conversely, direct activation of protein kinase C with phorbol esters strongly inhibited TLR3- and RIG-I-mediated IFN production. Inhibition of type I and type III IFNs by ATP, UTP, histamine, and the proteinase-activated receptor 2 (PAR2) receptor agonist SLIGKV also occurred in differentiated AECs grown at an air-liquid interface, indicating that the suppression is conserved following mucociliary differentiation. Importantly, histamine and, more strikingly, ATP inhibited type I IFN release from human airway cells infected with live influenza A virus or rhinovirus 1B. These results reveal an important role for extracellular nucleotides and histamine in attenuating the induction of type I and III IFNs from AECs and help explain the molecular basis of the suppression of IFN responses in asthmatic patients.
Assuntos
Proteína DEAD-box 58 , Histamina , Interferons , Nucleotídeos , Receptores Imunológicos , Mucosa Respiratória , Receptor 3 Toll-Like , Trifosfato de Adenosina/imunologia , Proteína DEAD-box 58/imunologia , Células Epiteliais/imunologia , Histamina/imunologia , Humanos , Interferons/imunologia , Nucleotídeos/imunologia , Proteína Quinase C/imunologia , Receptores Imunológicos/imunologia , Mucosa Respiratória/imunologia , Receptor 3 Toll-Like/imunologia , Uridina Trifosfato/metabolismo , Uridina Trifosfato/farmacologiaRESUMO
Immunomodulatory (IM) metabolic reprogramming in macrophages (MÏs) is fundamental to immune function. However, limited information is available for human MÏs, particularly in response plasticity, which is critical to understanding the variable efficacy of immunotherapies in cancer patients. We carried out an in-depth analysis by combining multiplex stable isotope-resolved metabolomics with reversed phase protein array to map the dynamic changes of the IM metabolic network and key protein regulators in four human donors' MÏs in response to differential polarization and M1 repolarizer ß-glucan (whole glucan particles [WGPs]). These responses were compared with those of WGP-treated ex vivo organotypic tissue cultures (OTCs) of human non-small cell lung cancer. We found consistently enhanced tryptophan catabolism with blocked NAD+ and UTP synthesis in M1-type MÏs (M1-MÏs), which was associated with immune activation evidenced by increased release of IL-1ß/CXCL10/IFN-γ/TNF-α and reduced phagocytosis. In M2a-MÏs, WGP treatment of M2a-MÏs robustly increased glucose utilization via the glycolysis/oxidative branch of the pentose phosphate pathway while enhancing UDP-N-acetyl-glucosamine turnover and glutamine-fueled gluconeogenesis, which was accompanied by the release of proinflammatory IL-1ß/TNF-α to above M1-MÏ's levels, anti-inflammatory IL-10 to above M2a-MÏ's levels, and attenuated phagocytosis. These IM metabolic responses could underlie the opposing effects of WGP, i.e., reverting M2- to M1-type immune functions but also boosting anti-inflammation. Variable reprogrammed Krebs cycle and glutamine-fueled synthesis of UTP in WGP-treated OTCs of human non-small cell lung cancer were observed, reflecting variable M1 repolarization of tumor-associated MÏs. This was supported by correlation with IL-1ß/TNF-α release and compromised tumor status, making patient-derived OTCs unique models for studying variable immunotherapeutic efficacy in cancer patients.
Assuntos
Carcinoma Pulmonar de Células não Pequenas , Neoplasias Pulmonares , beta-Glucanas , Carcinoma Pulmonar de Células não Pequenas/metabolismo , Glucosamina/metabolismo , Glucose/metabolismo , Glutamina/metabolismo , Humanos , Interleucina-10 , Neoplasias Pulmonares/metabolismo , Macrófagos , NAD/metabolismo , Fagocitose , Triptofano/metabolismo , Fator de Necrose Tumoral alfa/metabolismo , Difosfato de Uridina/metabolismo , Uridina Trifosfato/metabolismo , beta-Glucanas/metabolismoRESUMO
Type I interferons (IFNs) are important for antiviral and autoimmune responses. Retinoic acid-induced gene I (RIG-I) and mitochondrial antiviral signaling (MAVS) proteins mediate IFN production in response to cytosolic double-stranded RNA or single-stranded RNA containing 5'-triphosphate (5'-ppp). Cytosolic B form double-stranded DNA, such as poly(dA-dT)*poly(dA-dT) [poly(dA-dT)], can also induce IFN-beta, but the underlying mechanism is unknown. Here, we show that the cytosolic poly(dA-dT) DNA is converted into 5'-ppp RNA to induce IFN-beta through the RIG-I pathway. Biochemical purification led to the identification of DNA-dependent RNA polymerase III (Pol-III) as the enzyme responsible for synthesizing 5'-ppp RNA from the poly(dA-dT) template. Inhibition of RNA Pol-III prevents IFN-beta induction by transfection of DNA or infection with DNA viruses. Furthermore, Pol-III inhibition abrogates IFN-beta induction by the intracellular bacterium Legionella pneumophila and promotes the bacterial growth. These results suggest that RNA Pol-III is a cytosolic DNA sensor involved in innate immune responses.
Assuntos
Citosol/imunologia , DNA/imunologia , Imunidade Inata , Interferon beta/imunologia , RNA Polimerase III/imunologia , Transdução de Sinais , Trifosfato de Adenosina/metabolismo , Animais , Autoimunidade , Linhagem Celular , Sistema Livre de Células , Vírus de DNA/imunologia , Humanos , Interleucina-1beta/imunologia , Legionella pneumophila/imunologia , Camundongos , Polifosfatos/metabolismo , RNA/química , RNA/imunologia , RNA/metabolismo , RNA Polimerase III/metabolismo , RNA de Cadeia Dupla/metabolismo , Uridina Trifosfato/metabolismoRESUMO
OBJECTIVE: The LIFT-YA (leveraging intensive follow-up treatment in young adults) quality improvement program was developed to address clinical and social barriers in young adults (YA) with type 1 diabetes (T1D), using telehealth visits to promote clinic attendance and improve diabetes care. METHODS: LIFT-YA enrolled YA aged 18-30 with T1D and HbA1c >8% (64 mmol/mol) who had established adult care in our diabetes clinic. The 6-month, 7-visit hybrid program was facilitated by a case manager serving as the liaison between participants and the care team. The primary end-points were within-group and between-group changes from the baseline in HbA1c at the last visit and adoption of continuous glucose monitoring (CGM). RESULTS: Of the 57 eligible YA, 24 were enrolled and 33 were unable to participate (UTP). Thirteen of the enrolled participants attended at least 4/7 visits ("completers", C), whereas 11 were noncompleters (NC). HbA1c at the end of the program was significantly lower in the C versus UTP group [median -1.0; IQR (-0.6, -2.5) vs -0.25 (0.2, -1.0) in UTP; P < .05]. The percentage of CGM users significantly increased by 70% in the C group (P < .05), but did not change in the NC and UTP groups. Limited access to telehealth and the high cost of frequent visits were the main hurdles preventing enrollment into or completion of the program. CONCLUSIONS: The LIFT-YA pathway was associated with a significant HbA1c reduction and an increase in the adoption of CGM. Policy changes are necessary to expand access to LIFT-YA and other programs for high-risk YA with T1D in underserved communities and across all backgrounds.
Assuntos
Diabetes Mellitus Tipo 1 , Telemedicina , Humanos , Adulto Jovem , Diabetes Mellitus Tipo 1/tratamento farmacológico , Glicemia , Projetos Piloto , Hemoglobinas Glicadas , Automonitorização da Glicemia , Uridina Trifosfato/uso terapêuticoRESUMO
In Arabidopsis, HESO1 and URT1 act cooperatively on unmethylated miRNA and mRNA uridylation to induce their degradation. Their collaboration significantly impacts RNA metabolism in plants. However, the molecular mechanism determining the functional difference and complementarity of these two enzymes remains unclear. We previously solved the three-dimensional structure of URT1 in the absence and presence of UTP. In this study, we further determined the structure of URT1 in complex with a 5'-AAAU-3' RNA stretch that mimics the post-catalytic state of the mRNA poly(A) tail after the addition of the first uridine. Structural analysis and enzymatic assays revealed that L527 and Y592 endow URT1 with a preference to interact with purine over pyrimidine at the -1 RNA binding position, thus controlling the optimal number of uridine added to the 3' extremity of poly(A) as two. In addition, we observed that a large-scale conformational rearrangement in URT1 occurs upon binding with RNA from an 'open' to a 'closed' state. Molecular dynamic simulation supports an open-closed conformational selection mechanism employed by URT1 to interact with RNA substrates and maintain distributive enzymatic activity. Based on the above results, a model regarding the catalytic cycle of URT1 is proposed to explain its di-uridylation activity.
Assuntos
Proteínas de Arabidopsis , Arabidopsis , RNA Nucleotidiltransferases/metabolismo , Arabidopsis/metabolismo , Proteínas de Arabidopsis/genética , Proteínas de Arabidopsis/metabolismo , MicroRNAs/genética , MicroRNAs/metabolismo , Purinas/metabolismo , RNA Mensageiro/metabolismo , Uridina Trifosfato/metabolismoRESUMO
Cytidine triphosphate synthase (CTPS), which comprises an ammonia ligase domain and a glutamine amidotransferase domain, catalyzes the final step of de novo CTP biosynthesis. The activity of CTPS is regulated by the binding of four nucleotides and glutamine. While glutamine serves as an ammonia donor for the ATP-dependent conversion of UTP to CTP, the fourth nucleotide GTP acts as an allosteric activator. Models have been proposed to explain the mechanisms of action at the active site of the ammonia ligase domain and the conformational changes derived by GTP binding. However, actual GTP/ATP/UTP binding modes and relevant conformational changes have not been revealed fully. Here, we report the discovery of binding modes of four nucleotides and a glutamine analog 6-diazo-5-oxo-L-norleucine in Drosophila CTPS by cryo-electron microscopy with near-atomic resolution. Interactions between GTP and surrounding residues indicate that GTP acts to coordinate reactions at both domains by directly blocking ammonia leakage and stabilizing the ammonia tunnel. Additionally, we observe the ATP-dependent UTP phosphorylation intermediate and determine interacting residues at the ammonia ligase. A noncanonical CTP binding at the ATP binding site suggests another layer of feedback inhibition. Our findings not only delineate the structure of CTPS in the presence of all substrates but also complete our understanding of the underlying mechanisms of the allosteric regulation and CTP synthesis.
Assuntos
Trifosfato de Adenosina/metabolismo , Amônia/metabolismo , Carbono-Nitrogênio Ligases/química , Carbono-Nitrogênio Ligases/metabolismo , Drosophila melanogaster/enzimologia , Glutamina/metabolismo , Uridina Trifosfato/metabolismo , Regulação Alostérica , Animais , Sítios de Ligação , Catálise , Microscopia Crioeletrônica , Hidrólise , Cinética , Ligantes , Conformação ProteicaRESUMO
Numerous studies suggest the involvement of adenosine-5'-triphosphate (ATP) and similar nucleotides in the pathophysiology of asthma. Androgens, such as testosterone (TES), are proposed to alleviate asthma symptoms in young men. ATP and uridine-5'-triphosphate (UTP) relax the airway smooth muscle (ASM) via purinergic P2Y2 and P2Y4 receptors and K+ channel opening. We previously demonstrated that TES increased the expression of voltage-dependent K+ (KV) channels in ASM. This study investigates how TES may potentiate ASM relaxation induced by ATP and UTP. Tracheal tissues treated with or without TES (control group) from young male guinea pigs were used. In organ baths, tracheas exposed to TES (40 nM for 48 h) showed enhanced ATP- and UTP-evoked relaxation. Tetraethylammonium, a K+ channel blocker, annulled this effect. Patch-clamp experiments in tracheal myocytes showed that TES also increased ATP- and UTP-induced K+ currents, and this effect was abolished with flutamide (an androgen receptor antagonist). KV channels were involved in this phenomenon, which was demonstrated by inhibition with 4-aminopyridine. RB2 (an antagonist of almost all P2Y receptors except for P2Y2), as well as N-ethylmaleimide and SQ 22,536 (inhibitors of G proteins and adenylyl cyclase, respectively), attenuated the enhancement of the K+ currents induced by TES. Immunofluorescence and immunohistochemistry studies revealed that TES did not modify the expression of P2Y4 receptors or COX-1 and COX-2, while we have demonstrated that this androgen augmented the expression of KV1.2 and KV1.5 channels in ASM. Thus, TES leads to the upregulation of P2Y4 signaling and KV channels in guinea pig ASM, enhancing ATP and UTP relaxation responses, which likely limits the severity of bronchospasm in young males.
Assuntos
Trifosfato de Adenosina , Adenilil Ciclases , Relaxamento Muscular , Músculo Liso , Testosterona , Traqueia , Uridina Trifosfato , Animais , Uridina Trifosfato/farmacologia , Uridina Trifosfato/metabolismo , Cobaias , Relaxamento Muscular/efeitos dos fármacos , Masculino , Trifosfato de Adenosina/metabolismo , Traqueia/metabolismo , Traqueia/efeitos dos fármacos , Testosterona/farmacologia , Testosterona/metabolismo , Adenilil Ciclases/metabolismo , Músculo Liso/metabolismo , Músculo Liso/efeitos dos fármacos , Canais de Potássio de Abertura Dependente da Tensão da Membrana/metabolismo , Transdução de Sinais/efeitos dos fármacos , Receptores Purinérgicos P2/metabolismoRESUMO
BACKGROUND: Black older-teenaged women have disproportionately high rates of sexually transmitted infections (STI) and unintended pregnancy (UTP). Internet-based interventions can be delivered to large groups of people in a relatively inexpensive manner. In this randomized trial, we examine the efficacy of an evidence-based STI/UTP prevention intervention adapted for older teens and for Internet delivery. METHODS: Black women aged 18-19 years who were not pregnant/seeking to become pregnant were enrolled (n = 637) and randomized to an 8-session intervention or attention control and were followed up at 6/12 months postintervention. The primary outcome was defined as uptake of reliable contraceptives. Other secondary outcomes were examined, including intention to use condoms, intention to use reliable contraception, and STI or pregnancy rates. RESULTS: Overall, at baseline, reliable contraception was 54.8% and dual protection was 29.4%, and the prevalence of STI was 11.1%. Participants were similar by arm for most factors considered. Participation and follow-up rates were excellent (60.9% and 80.3%). There was no statistically significant difference in uptake of reliable contraception for intervention versus controls at 6 months (1.45 [0.99-2.12]) or 12 months (1.33 [0.92-1.91]). At 6 months, several secondary outcomes were improved/trended toward improvement in intervention compared with control, but this effect waned by 12 months, except for intention to use condoms which remained improved. CONCLUSION AND RELEVANCE: The intervention was efficacious for increasing some self-reported UTP and STI prevention behaviors, which waned over time, and the intervention had minimal impact on STI or pregnancy rates suggesting that this type of online intervention may need additional components.
Assuntos
Gravidez na Adolescência , Infecções Sexualmente Transmissíveis , Adolescente , Gravidez , Feminino , Humanos , Gravidez na Adolescência/prevenção & controle , Uridina Trifosfato , Infecções Sexualmente Transmissíveis/epidemiologia , Infecções Sexualmente Transmissíveis/prevenção & controle , Anticoncepção , Preservativos , InternetRESUMO
Several purinergic receptors have been identified on platelets which are involved in hemostatic and thrombotic processes. The aim of the present study was to investigate the effects of uridine and its nucleotides on platelet aggregation and hemostasis in platelet-rich plasma (PRP) and whole blood. The effects of uridine, UMP, UDP, and UTP at different final concentrations (1 to 1000 µM) on platelet aggregation were studied using an aggregometer. In PRP samples, platelet aggregation was induced by ADP, collagen and epinephrine 3 min after addition of uridine, UMP, UDP, UTP and saline (as a control). All thromboelastogram experiments were performed at 1000 µM final concentrations of uridine and its nucleotides in whole blood. UDP and UTP were also tested in thromboelastogram with PRP. Our results showed that UDP, and especially UTP, inhibited ADP- and collagen-induced aggregation in a concentration-dependent manner. In whole blood thromboelastogram experiments, UDP stimulated clot formation while UTP suppressed clot formation. When thromboelastogram experiments were repeated with PRP, UTP's inhibitory effect on platelets was confirmed, while UDP's stimulated clot forming effect disappeared. Collectively, our data showed that UTP inhibited platelet aggregation in a concentration-dependent manner and suppressed clot formation. On the other hand, UDP exhibited distinct effects on whole blood or PRP in thromboelastogram. These data suggest that the difference on effects of UTP and UDP might have arisen from the different receptors that they stimulate and warrant further investigation with regard to their in vivo actions on platelet aggregation and hemostasis.
Assuntos
Trifosfato de Adenosina , Nucleotídeos , Humanos , Nucleotídeos/farmacologia , Uridina/farmacologia , Uridina Trifosfato/farmacologia , Trifosfato de Adenosina/farmacologia , Agregação Plaquetária , Difosfato de Uridina/farmacologia , Colágeno/farmacologia , Uridina Monofosfato/farmacologiaRESUMO
BACKGROUND: IgA nephropathy (IgAN) is a major cause of chronic kidney disease (CKD). Renal interstitial fibrosis is a hallmark of CKD progression. Non-invasive biomarkers are needed to dynamically evaluate renal fibrosis. Data independent acquisition (DIA)-based liquid chromatography-mass spectrometry (DIA-MS) was used to identify candidate urinary biomarkers in IgAN patients with different renal interstitial fibrosis degrees. METHODS: Eighteen biopsy-proven IgAN patients and six healthy controls were recruited in a discovery cohort. Interstitial fibrosis changes were evaluated according to Oxford MEST-C scores. Urinary samples were analyzed with DIA-MS to identify hub proteins. Hub proteins were then confirmed by enzyme-linked immunosorbent assay (ELISA) in a validation cohort and the associated gene mRNA expression was analyzed using public gene expression omnibus (GEO) datasets. RESULTS: Complement and coagulation cascades pathway was the main KEGG pathway related to the over-expressed proteins. Fibrinogen γ-Chain (FGG) was selected as the potential urinary marker for further validation. Urinary FGG to creatinine ratio (uFGG/Cr) levels were higher in both disease controls and IgAN group than in healthy controls, but were not significantly different between IgAN and disease groups. uFGG/Cr was confirmed to be increased with the extent of renal fibrosis and presented moderate correlations with T score (r = 0.614, p < 0.01) and eGFR (r = -0.682, p < 0.01), and a mild correlation with UTP (r = 0.497, p < 0.01) in IgAN group. In disease control group, uFGG/Cr was higher in patients with T1 + 2 compared to those with T0. uFGG/Cr had a good discriminatory power to distinguish different fibrosis stages in IgAN: interstitial fibrosis ≤ 5% (minimal fibrosis) vs. interstitial fibrosis (mild fibrosis) > 5%, AUC 0.743; T0 vs. T1 + 2, AUC 0.839; T0 + 1 vs. T2, AUC 0.854. In disease control group, uFGG/Cr showed better performance of AUC than UTP between minimal and mild fibrosis (p = 0.038 for Delong's test). Moreover, GSE104954 dataset showed that FGG mRNA expression was up-regulated (fold change 1.20, p = 0.009) in tubulointerstitium of IgAN patients when compared to healthy living kidney donors. CONCLUSION: Urinary FGG is associated with renal interstitial fibrosis and could be used as a noninvasive biomarker for renal fibrosis in IgAN.
Assuntos
Glomerulonefrite por IGA , Insuficiência Renal Crônica , Humanos , Glomerulonefrite por IGA/complicações , Rim/patologia , Uridina Trifosfato , Insuficiência Renal Crônica/complicações , Biomarcadores/urina , Fibrose , RNA MensageiroRESUMO
The catalytic subunit of SARS-CoV-2 RNA-dependent RNA polymerase (RdRp) contains two active sites that catalyze nucleotidyl-monophosphate transfer (NMPylation). Mechanistic studies and drug discovery have focused on RNA synthesis by the highly conserved RdRp. The second active site, which resides in a Nidovirus RdRp-Associated Nucleotidyl transferase (NiRAN) domain, is poorly characterized, but both catalytic reactions are essential for viral replication. One study showed that NiRAN transfers NMP to the first residue of RNA-binding protein nsp9; another reported a structure of nsp9 containing two additional N-terminal residues bound to the NiRAN active site but observed NMP transfer to RNA instead. We show that SARS-CoV-2 RdRp NMPylates the native but not the extended nsp9. Substitutions of the invariant NiRAN residues abolish NMPylation, whereas substitution of a catalytic RdRp Asp residue does not. NMPylation can utilize diverse nucleotide triphosphates, including remdesivir triphosphate, is reversible in the presence of pyrophosphate, and is inhibited by nucleotide analogs and bisphosphonates, suggesting a path for rational design of NiRAN inhibitors. We reconcile these and existing findings using a new model in which nsp9 remodels both active sites to alternately support initiation of RNA synthesis by RdRp or subsequent capping of the product RNA by the NiRAN domain.
Assuntos
Nidovirales/enzimologia , Nucleotídeos/metabolismo , Domínios Proteicos , Proteínas de Ligação a RNA/química , Proteínas de Ligação a RNA/metabolismo , RNA Polimerase Dependente de RNA/química , RNA Polimerase Dependente de RNA/metabolismo , SARS-CoV-2/enzimologia , Proteínas não Estruturais Virais/química , Proteínas não Estruturais Virais/metabolismo , Sequência de Aminoácidos , Domínio Catalítico , Coenzimas/metabolismo , RNA-Polimerase RNA-Dependente de Coronavírus/metabolismo , Difosfatos/farmacologia , Difosfonatos/farmacologia , Guanosina Trifosfato/metabolismo , Manganês , Modelos Moleculares , Nidovirales/química , RNA Polimerase Dependente de RNA/antagonistas & inibidores , Uridina Trifosfato/metabolismoRESUMO
INTRODUCTION: Neutrophils are a pivotal cell type in the K/BxN mouse model of rheumatoid arthritis and play an essential role in the progression of the arthritis. They are readily activated by immune complexes (ICs) via their FcγRs to release IL-1ß in addition to other cytokines, which are inducing cartilage destruction. Neutrophils also release neutrophil-active chemokines to recruit themselves in an autocrine manner to perpetuate tissue destruction. FcγR-expression on neutrophils is of crucial importance for the recognition of ICs. METHODS: In this study, due to its high avidity for binding to FcγRs, we investigated the potential anti-inflammatory effect of a recombinant IgG1 Fc hexamer (rFc-µTP-L309C) on neutrophils in the K/BxN mouse model of endogenously generated chronic arthritis. 200 mg/kg rFc-µTP-L309C and human serum albumin (HSA), used as controls, were administered subcutaneously every other day. Mouse ankle joints were monitored daily to generate a clinical score. Immunohistology was used to evaluate neutrophil infiltration and TUNEL to assess apoptosis. ELISA was used to measure IL-1ß. RESULTS: Treatment with rFc-µTP-L309C, but not HSA, was able to significantly ameliorate the arthritis in the K/BxN mice. Significant neutrophil infiltration into the ankle joint was found, but treatment with rFc-µTP-L309C resulted in significantly less neutrophil infiltration. There was no significant influence of rFc-µTP-L309C on neutrophil death or apoptosis. Less neutrophil infiltration could not be correlated to chemokine-mediated migration. Significantly less IL-1ß was measured in mice treated with rFc-µTP-L309C. CONCLUSION: In the endogenous K/BxN mouse model of rheumatoid arthritis, amelioration can be explained in part by inhibition of neutrophil infiltration into the joints as well as inhibition of IL-1ß production. Given the observed inhibitory properties on neutrophils, rFc-µTP-L309C may be a potential therapeutic candidate to treat autoimmune and inflammatory conditions in which neutrophils are the predominant cell type involved in pathogenesis.
Assuntos
Artrite Experimental , Artrite Reumatoide , Humanos , Camundongos , Animais , Imunoglobulina G/metabolismo , Neutrófilos/metabolismo , Neutrófilos/patologia , Uridina Trifosfato/metabolismo , Artrite Reumatoide/patologia , Modelos Animais de Doenças , Fatores Imunológicos , Camundongos Endogâmicos C57BLRESUMO
Studies in human colonic cell lines and murine intestine suggest the presence of a Ca2+-activated anion channel, presumably TMEM16a. Is there a potential for fluid secretion in patients with severe cystic fibrosis transmembrane conductance regulator (CFTR) mutations by activating this alternative pathway? Two-dimensional nondifferentiated colonoid-myofibroblast cocultures resembling transit amplifying/progenitor (TA/PE) cells, as well as differentiated monolayer (DM) cultures resembling near-surface cells, were established from both healthy controls (HLs) and patients with severe functional defects in the CFTR gene (PwCF). F508del mutant and CFTR knockout (null) mice ileal and colonic mucosa was also studied. HL TA/PE monolayers displayed a robust short-circuit current response (ΔIeq) to UTP (100 µM), forskolin (Fsk, 10 µM) and carbachol (CCH, 100 µM), while ΔIeq was much smaller in differentiated monolayers. The selective TMEM16a inhibitor Ani9 (up to 30 µM) did not alter the response to luminal UTP, significantly decreased Fsk-induced ΔIeq, and significantly increased CCH-induced ΔIeq in HL TA/PE colonoid monolayers. The PwCF TA/PE and the PwCF differentiated monolayers displayed negligible agonist-induced ΔIeq, without a significant effect of Ani9. When TMEM16a was localized in intracellular structures, a staining in the apical membrane was not detected. TMEM16a is highly expressed in human colonoid monolayers resembling transit amplifying cells of the colonic cryptal neck zone, from both HL and PwCF. While it may play a role in modulating agonist-induced CFTR-mediated anion currents, it is not localized in the apical membrane, and it has no function as an apical anion channel in cystic fibrosis (CF) and healthy human colonic epithelium.
Assuntos
Fibrose Cística , Animais , Humanos , Camundongos , Ânions , Fibrose Cística/genética , Regulador de Condutância Transmembrana em Fibrose Cística/genética , Epitélio , Uridina TrifosfatoRESUMO
Early cancer screening enables timely detection of carcinogenesis, and aids in prompt clinical intervention. Herein, we report on the development of a simple, sensitive, and rapid fluorometric assay based on the aptamer probe (aptamer beacon probe, ABP) for monitoring the energy-demand biomarker adenosine triphosphate (ATP), an essential energy source that is released into the tumor microenvironment. Its level plays a significant role in risk assessment of malignancies. The operation of the ABP for ATP was examined using solutions of ATP and other nucleotides (UTP, GTP, CTP), followed by monitoring of ATP production in SW480 cancer cells. Then, the effect of a glycolysis inhibitor, 2-deoxyglucose (2-DG), on SW480 cells was investigated. The stability of predominant ABP conformations in the temperature range of 23-91 °C and the effects of temperature on ABP interactions with ATP, UTP, GTP, and CTP were evaluated based on quenching efficiencies (QE) and Stern-Volmer constants (KSV). The optimized temperature for best selectivity of ABP toward ATP was 40 °C (KSV = 1093 M-1, QE = 42%). We have found that the inhibition of glycolysis in SW480 cancer cells by 2-deoxyglucose resulted in lowering of ATP production by 31.7%. Therefore, monitoring and modulation of ATP concentration may aid in future cancer treatment.
Assuntos
Aptâmeros de Nucleotídeos , Técnicas Biossensoriais , Neoplasias , Aptâmeros de Nucleotídeos/farmacologia , Aptâmeros de Nucleotídeos/metabolismo , Trifosfato de Adenosina/metabolismo , Técnicas Biossensoriais/métodos , Uridina Trifosfato , Glicólise , Guanosina Trifosfato , Desoxiglucose/farmacologiaRESUMO
This study investigated the effect of multi-glycosides of Tripterygium wilfordii(GTW) on renal injury in diabetic kidney disease(DKD) rats through Nod-like receptor protein 3(NLRP3)/cysteine-aspartic acid protease-1(caspase-1)/gsdermin D(GSDMD) pyroptosis pathway and the mechanism. To be specific, a total of 40 male SD rats were randomized into the normal group(n=8) and modeling group(n=34). In the modeling group, a high-sugar and high-fat diet and one-time intraperitoneal injection of streptozotocin(STZ) were used to induce DKD in rats. After successful modeling, they were randomly classified into model group, valsartan(Diovan) group, and GTW group. Normal group and model group were given normal saline, and the valsartan group and GTW group received(ig) valsartan and GTW, respectively, for 6 weeks. Blood urea nitrogen(BUN), serum creatinine(Scr), alanine ami-notransferase(ALT), albumin(ALB), and 24 hours urinary total protein(24 h-UTP) were determined by biochemical tests. The pathological changes of renal tissue were observed based on hematoxylin and eosin(HE) staining. Serum levels of interleukin-1ß(IL-1ß) and interleukin-18(IL-18) were detected by enzyme-linked immunosorbent assay(ELISA). Western blot was used to detect the expression of pyroptosis pathway-related proteins in renal tissue, and RT-PCR to determine the expression of pyroptosis pathway-related genes in renal tissue. Compared with the normal group, the model group showed high levels of BUN, Scr, ALT, and 24 h-UTP and serum levels of IL-1ß and IL-18(P<0.01), low level of ALB(P<0.01), severe pathological damage to kidney, and high protein and mRNA levels of NLRP3, caspase-1, and GSDMD in renal tissue(P<0.01). Compared with the model group, valsartan group and GTW group had low levels of BUN, Scr, ALT, and 24 h-UTP and serum levels of IL-1ß and IL-18(P<0.01), high level of ALB(P<0.01), alleviation of the pathological damage to the kidney, and low protein and mRNA levels of NLRP3, caspase-1, and GSDMD in renal tissue(P<0.01 or P<0.05). GTW may inhibit pyroptosis by decreasing the expression of NLRP3/caspase-1/GSDMD in renal tissue, thereby relieving the inflammatory response of DKD rats and the pathological injury of kidney.
Assuntos
Diabetes Mellitus , Nefropatias Diabéticas , Ratos , Masculino , Animais , Nefropatias Diabéticas/tratamento farmacológico , Nefropatias Diabéticas/genética , Interleucina-18/metabolismo , Glicosídeos/farmacologia , Tripterygium , Proteína 3 que Contém Domínio de Pirina da Família NLR/genética , Proteína 3 que Contém Domínio de Pirina da Família NLR/metabolismo , Ratos Sprague-Dawley , Caspase 1/metabolismo , Piroptose , Uridina Trifosfato/metabolismo , Uridina Trifosfato/farmacologia , Rim , Valsartana/metabolismo , Valsartana/farmacologia , RNA Mensageiro/metabolismoRESUMO
To investigate the intervention effect and mechanism of Zhenwu Decoction on diabetic nephropathy(DN) mice of spleen-kidney Yang deficiency syndrome based on the Rho-associated coiled-coil kinase(ROCK)/IκB kinase(IKK)/nuclear factor-κB(NF-κB) pathway. Ninety-five 7-week-old db/db male mice and 25 7-week-old db/m male mice were fed adaptively for one week. The DN model of spleen-kidney Yang deficiency syndrome was induced by Dahuang Decoction combined with hydrocortisone by gavage, and then the model was evaluated. After modeling, they were randomly divided into a model group, high-dose, medium-dose, and low-dose Zhenwu Decoction groups(33.8, 16.9, and 8.45 g·kg~(-1)·d~(-1)), and an irbesartan group(25 mg·kg~(-1)·d~(-1)), with at least 15 animals in each group. The intervention lasted for eight weeks. After the intervention, body weight and food intake were measured. Serum crea-tinine(Scr), blood urea nitrogen(BUN), fasting blood glucose(FBG), urinary albumin(uALb), and urine creatinine(Ucr) were determined. The uALb/Ucr ratio(ACR) and 24 h urinary protein(UTP) were calculated. Renal pathological morphology was evaluated by HE staining and Masson staining. The levels of key molecular proteins in the ROCK/IKK/NF-κB pathway were detected by Western blot. Enzyme-linked immunosorbent assay(ELISA) was used to detect interleukin-1ß(IL-1ß), interleukin-6(IL-6), interleukin-8(IL-8), interleukin-10(IL-10), and tumor necrosis factor-α(TNF-α). Compared with the blank group, the model group showed increased content of BUN, uALb, and SCr, increased values of 24 h UTP and ACR, decreased content of Ucr(P<0.05), enlarged glomeruli, thickened basement membrane, mesangial matrix proliferation, inflammatory cell infiltration, and collagen fiber deposition. The protein expression of ROCK1, ROCK2, IKK, NF-κB, phosphorylated IKK(p-IKK), phosphorylated NF-κB(p-NF-κB), and phosphorylated inhibitor of NF-κB(p-IκB) increased(P<0.05), while the protein expression of inhibitor of NF-κB(IκB) decreased(P<0.05). The levels of inflammatory factors IL-1ß, IL-6, IL-8, and TNF-α increased(P<0.05), while the level of IL-10 decreased(P<0.05). Compared with the model group, the groups with drug treatment showed decreased levels of BUN, uALb, SCr, 24 h UTP, and ACR, increased level of Ucr(P<0.05), and improved renal pathological status to varying degrees. The high-and medium-dose Zhenwu Decoction groups and the irbesartan group showed reduced protein expression of ROCK1, ROCK2, IKK, NF-κB, p-IKK, p-NF-κB, and p-IκB in the kidneys(P<0.05), increased protein expression of IκB(P<0.05), decreased levels of serum inflammatory factors IL-1ß, IL-6, IL-8, and TNF-α(P<0.05), and increased level of IL-10(P<0.05). Zhenwu Decoction can significantly improve renal function and renal pathological damage in DN mice of spleen-kidney Yang deficiency syndrome, and its specific mechanism may be related to the inhibition of inflammatory response by down-regulating the expression of key molecules in the ROCK/IKK/NF-κB pathway in the kidney.
Assuntos
Interleucina-8 , NF-kappa B , Camundongos , Masculino , Animais , NF-kappa B/genética , NF-kappa B/metabolismo , Interleucina-10 , Fator de Necrose Tumoral alfa/metabolismo , Interleucina-6 , Quinase I-kappa B , Baço , Irbesartana , Uridina Trifosfato , Deficiência da Energia Yang/tratamento farmacológico , Rim/fisiologia , Rim/patologiaRESUMO
Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 polyuridylates pre-let-7, the precursor of let-7, when pre-let-7 is complexed with LIN28, an RNA-binding protein. Polyuridylation of pre-let-7 marks it for degradation. In addition to this LIN28-dependent activity, Z11 also has LIN28-independent activities. In this paper, we report the results of experiments that characterize LIN28-independent activities of Z11. Significant observations include the following. (1) Z11 uridylates not only mature let-7 species but also substrates as small as dinucleotides. (2) For both let-7i and the diribonucleotide AG, Z11 follows a steady-state ordered mechanism, with UTP adding before RNA. (3) Uridylation kinetics of let-7i (UGAGGUAGUAGUUUGUGCUGUU) and two truncated derivatives, GCUGUU and UU, indicate that Z11 manifests selectivity in Km,RNA; kcat,RNA values for the three substrates are nearly identical. (4) Z11 preferentially uridylates RNA lacking base-pairing near the 3' terminus. (5) Selectivity of Z11 toward ribonucleoside triphosphates is similar for let-7i and AG, with XTP preference: UTP > CTP > ATP â« GTP. Selectivity is manifested in Km,XTP, with kcat,XTP values being similar for UTP, CTP, and ATP. (6) Kinetic parameters for RNA turnover are dependent on the structure of the nucleoside triphosphate, consistent with recent structural data indicating stacking of the nucleoside triphosphate base with the base of the 3'-nucleotide of the substrate RNA (Faehnle et al., Nat. Struct. Mol. Biol. 2017, 24, 658).
Assuntos
MicroRNAs , Nucleosídeos , Trifosfato de Adenosina , Citidina Trifosfato , MicroRNAs/genética , RNA Nucleotidiltransferases , Uridina Monofosfato/metabolismo , Uridina TrifosfatoRESUMO
The protein-bound uremic toxin indoxyl sulfate has negative effects on a variety of physiological activities including vascular function. Uridine adenosine tetraphosphate (Up4A), a new dinucleotide molecule affects vascular function including induction of vasocontraction, and aberrant responsiveness to Up4A is evident in arteries from disorders such as hypertension and diabetes. The link between indoxyl sulfate and the Up4A-mediated response is, however, unknown. We used Wistar rat's renal arteries to see if indoxyl sulfate will affect Up4A-mediated vascular contraction. In renal arteries of indoxyl sulfate, the contractile response generated by Up4A was dramatically reduced compared to the non-treated control group. Indoxyl sulfate increased endothelin-1-induced contraction but had no effect on phenylephrine, thromboxane analog, or isotonic K+-induced renal arterial contractions. UTP, ATP, UDP, and ADP-produced contractions were reduced by indoxyl sulfate. CH223191, an aryl hydrocarbon receptor (AhR) antagonist, did not reverse Up4A, and UTP contraction decreases caused by indoxyl sulfate. The ectonucleotidase inhibitor ARL67156 prevents indoxyl sulfate from reducing Up4A- and UTP-mediated contractions. In conclusion, we discovered for the first time that indoxyl sulfate inhibits Up4A-mediated contraction in the renal artery, possibly through activating ectonucleotidase but not AhR. Indoxyl sulfate is thought to play a function in the pathophysiology of purinergic signaling.
Assuntos
Indicã , Artéria Renal , Ratos , Animais , Indicã/farmacologia , Uridina Trifosfato/farmacologia , Ratos Wistar , Trifosfato de AdenosinaRESUMO
Intracellular Ca2+ dynamics shape malignant behaviors of cancer cells. Whereas previous studies focused on cultured cancer cells, we here used breast organoids and colonic crypts freshly isolated from human and murine surgical biopsies. We performed fluorescence microscopy to evaluate intracellular Ca2+ concentrations in breast and colon cancer tissue with preferential focus on intracellular Ca2+ release in response to purinergic and cholinergic stimuli. Inhibition of the sarco-/endoplasmic reticulum Ca2+ ATPase with cyclopiazonic acid elicited larger Ca2+ responses in breast cancer tissue, but not in colon cancer tissue, relative to respective normal tissue. The resting intracellular Ca2+ concentration was elevated, and ATP, UTP and acetylcholine induced strongly augmented intracellular Ca2+ responses in breast cancer tissue compared with normal breast tissue. In contrast, resting intracellular Ca2+ levels and acetylcholine-induced increases in intracellular Ca2+ concentrations were unaffected and ATP- and UTP-induced Ca2+ responses were smaller in colon cancer tissue compared with normal colon tissue. In accordance with the amplified Ca2+ responses, ATP and UTP substantially increased proliferative activity-evaluated by bromodeoxyuridine incorporation-in breast cancer tissue, whereas the effect was minimal in normal breast tissue. ATP caused cell death-identified with ethidium homodimer-1 staining-in breast cancer tissue only at concentrations above the expected pathophysiological range. We conclude that intracellular Ca2+ responses are amplified in breast cancer tissue, but not in colon cancer tissue, and that nucleotide signaling stimulates breast cancer cell proliferation within the extracellular concentration range typical for solid cancer tissue.