Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 36
Filtrar
1.
Antimicrob Agents Chemother ; 68(5): e0028024, 2024 May 02.
Artigo em Inglês | MEDLINE | ID: mdl-38587391

RESUMO

Testing Plasmodium vivax antimicrobial sensitivity is limited to ex vivo schizont maturation assays, which preclude determining the IC50s of delayed action antimalarials such as doxycycline. Using Plasmodium cynomolgi as a model for P. vivax, we determined the physiologically significant delayed death effect induced by doxycycline [IC50(96 h), 1,401 ± 607 nM]. As expected, IC50(96 h) to chloroquine (20.4 nM), piperaquine (12.6 µM), and tafenoquine (1,424 nM) were not affected by extended exposure.


Assuntos
Aminoquinolinas , Antimaláricos , Doxiciclina , Piperazinas , Plasmodium cynomolgi , Plasmodium vivax , Doxiciclina/farmacologia , Antimaláricos/farmacologia , Aminoquinolinas/farmacologia , Plasmodium vivax/efeitos dos fármacos , Plasmodium cynomolgi/efeitos dos fármacos , Cloroquina/farmacologia , Animais , Malária Vivax/tratamento farmacológico , Malária Vivax/parasitologia , Quinolinas/farmacologia , Concentração Inibidora 50 , Humanos , Testes de Sensibilidade Parasitária
2.
PLoS Pathog ; 16(2): e1008287, 2020 02.
Artigo em Inglês | MEDLINE | ID: mdl-32032366

RESUMO

Our inability to predict which mutations could result in antibiotic resistance has made it difficult to rapidly identify the emergence of resistance, identify pre-existing resistant populations, and manage our use of antibiotics to effectively treat patients and prevent or slow the spread of resistance. Here we investigated the potential for resistance against the new antitubercular nitroimidazole prodrugs pretomanid and delamanid to emerge in Mycobacterium tuberculosis, the causative agent of tuberculosis (TB). Deazaflavin-dependent nitroreductase (Ddn) is the only identified enzyme within M. tuberculosis that activates these prodrugs, via an F420H2-dependent reaction. We show that the native menaquinone-reductase activity of Ddn is essential for emergence from hypoxia, which suggests that for resistance to spread and pose a threat to human health, the native activity of Ddn must be at least partially retained. We tested 75 unique mutations, including all known sequence polymorphisms identified among ~15,000 sequenced M. tuberculosis genomes. Several mutations abolished pretomanid and delamanid activation in vitro, without causing complete loss of the native activity. We confirmed that a transmissible M. tuberculosis isolate from the hypervirulent Beijing family already possesses one such mutation and is resistant to pretomanid, before being exposed to the drug. Notably, delamanid was still effective against this strain, which is consistent with structural analysis that indicates delamanid and pretomanid bind to Ddn differently. We suggest that the mutations identified in this work be monitored for informed use of delamanid and pretomanid treatment and to slow the emergence of resistance.


Assuntos
Antituberculosos/farmacologia , Proteínas de Bactérias , Farmacorresistência Bacteriana , Mutação , Mycobacterium tuberculosis , Nitroimidazóis/farmacologia , Nitrorredutases , Oxazóis/farmacologia , Engenharia de Proteínas , Proteínas de Bactérias/genética , Proteínas de Bactérias/metabolismo , Farmacorresistência Bacteriana/efeitos dos fármacos , Farmacorresistência Bacteriana/genética , Mycobacterium tuberculosis/genética , Mycobacterium tuberculosis/metabolismo , Nitrorredutases/genética , Nitrorredutases/metabolismo , Polimorfismo Genético
3.
Emerg Infect Dis ; 27(11): 2847-2855, 2021 11.
Artigo em Inglês | MEDLINE | ID: mdl-34670644

RESUMO

Multidrug resistance is a major threat to global elimination of tuberculosis (TB). We performed phenotypic drug-susceptibility testing and whole-genome sequencing for 309 isolates from 342 consecutive patients who were given a diagnosis of TB in Yangon, Myanmar, during July 2016‒June 2018. We identified isolates by using the GeneXpert platform to evaluate drug-resistance profiles. A total of 191 (62%) of 309 isolates had rifampin resistance; 168 (88%) of these rifampin-resistant isolates were not genomically related, indicating the repeated emergence of resistance in the population, rather than extensive local transmission. We did not detect resistance mutations to new oral drugs, including bedaquiline and pretomanid. The current GeneXpert MTB/RIF system needs to be modified by using the newly launched Xpert MTB/XDR cartridge or line-probe assay. Introducing new oral drugs to replace those currently used in treatment regimens for multidrug-resistant TB will also be useful for treating TB in Myanmar.


Assuntos
Mycobacterium tuberculosis , Tuberculose Resistente a Múltiplos Medicamentos , Farmacorresistência Bacteriana , Genômica , Humanos , Testes de Sensibilidade Microbiana , Mianmar/epidemiologia , Mycobacterium tuberculosis/genética , Rifampina , Tuberculose Resistente a Múltiplos Medicamentos/diagnóstico , Tuberculose Resistente a Múltiplos Medicamentos/tratamento farmacológico , Tuberculose Resistente a Múltiplos Medicamentos/epidemiologia
4.
Mol Microbiol ; 107(2): 198-213, 2018 01.
Artigo em Inglês | MEDLINE | ID: mdl-29134701

RESUMO

Glutamate racemase (MurI) has been proposed as a target for anti-tuberculosis drug development based on the inability of ΔmurI mutants of Mycobacterium smegmatis to grow in the absence of d-glutamate. In this communication, we identify ΔmurI suppressor mutants that are detected during prolonged incubation. Whole genome sequencing of these ΔmurI suppressor mutants identified the presence of a SNP, located in the promoter region of MSMEG_5795. RT-qPCR and transcriptional fusion analyses revealed that the ΔmurI suppressor mutant overexpressed MSMEG_5795 14-fold compared to the isogenic wild-type. MSMEG_5795, which is annotated as 4-amino-4-deoxychorismate lyase (ADCL) but which also has homology to d-amino acid transaminase (d-AAT), was expressed, purified and found to have d-AAT activity and to be capable of producing d-glutamate from d-alanine. Consistent with its d-amino acid transaminase function, overexpressed MSMEG_5795 is able to complement both ΔmurI deletion mutants and alanine racemase (Δalr) deletion mutants, thus confirming a multifunctional role for this enzyme in M. smegmatis.


Assuntos
Isomerases de Aminoácido/metabolismo , D-Alanina Transaminase/metabolismo , Mycobacterium smegmatis/enzimologia , Oxo-Ácido-Liases/metabolismo , Alanina/metabolismo , Alanina Racemase/genética , Alanina Racemase/metabolismo , Isomerases de Aminoácido/genética , Sequência de Bases/genética , D-Alanina Transaminase/química , D-Alanina Transaminase/genética , Deleção de Genes , Ácido Glutâmico/metabolismo , Mycobacterium smegmatis/genética , Oxo-Ácido-Liases/química , Oxo-Ácido-Liases/genética , Regiões Promotoras Genéticas , Supressão Genética , Sequenciamento Completo do Genoma
5.
Artigo em Inglês | MEDLINE | ID: mdl-28971867

RESUMO

A screening of more than 1,500 drug-resistant strains of Mycobacterium tuberculosis revealed evolutionary patterns characteristic of positive selection for three alanine racemase (Alr) mutations. We investigated these mutations using molecular modeling, in vitro MIC testing, as well as direct measurements of enzymatic activity, which demonstrated that these mutations likely confer resistance to d-cycloserine.


Assuntos
Alanina Racemase/genética , Proteínas de Bactérias/genética , Ciclosserina/farmacologia , Farmacorresistência Bacteriana/genética , Mutação , Mycobacterium tuberculosis/genética , Alanina Racemase/metabolismo , Antibióticos Antituberculose/farmacologia , Proteínas de Bactérias/metabolismo , Evolução Molecular , Expressão Gênica , Testes de Sensibilidade Microbiana , Mycobacterium tuberculosis/classificação , Mycobacterium tuberculosis/efeitos dos fármacos , Mycobacterium tuberculosis/enzimologia , Filogenia , Seleção Genética
6.
Microbiology (Reading) ; 161(Pt 3): 648-61, 2015 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-25525207

RESUMO

Mycobacterium smegmatis is a fast-growing, saprophytic, mycobacterial species that contains two cAMP-receptor protein (CRP) homologues designated herein as Crp1 and Crp2. Phylogenetic analysis suggests that Crp1 (Msmeg_0539) is uniquely present in fast-growing environmental mycobacteria, whereas Crp2 (Msmeg_6189) occurs in both fast- and slow-growing species. A crp1 mutant of M. smegmatis was readily obtained, but crp2 could not be deleted, suggesting it was essential for growth. A total of 239 genes were differentially regulated in response to crp1 deletion (loss of function), including genes coding for mycobacterial energy generation, solute transport and catabolism of carbon sources. To assess the role of Crp2 in M. smegmatis, the crp2 gene was overexpressed (gain of function) and transcriptional profiling studies revealed that 58 genes were differentially regulated. Identification of the CRP promoter consensus in M. smegmatis showed that both Crp1 and Crp2 recognized the same consensus sequence (TGTGN8CACA). Comparison of the Crp1- and Crp2-regulated genes revealed distinct but overlapping regulons with 11 genes in common, including those of the succinate dehydrogenase operon (MSMEG_0417-0420, sdh1). Expression of the sdh1 operon was negatively regulated by Crp1 and positively regulated by Crp2. Electrophoretic mobility shift assays with purified Crp1 and Crp2 demonstrated that Crp1 binding to the sdh1 promoter was cAMP-independent whereas Crp2 binding was cAMP-dependent. These data suggest that Crp1 and Crp2 respond to distinct signalling pathways in M. smegmatis to coordinate gene expression in response to carbon and energy supply.


Assuntos
Proteínas de Bactérias/metabolismo , Proteína Receptora de AMP Cíclico/metabolismo , Mycobacterium smegmatis/crescimento & desenvolvimento , Mycobacterium smegmatis/metabolismo , Sequência de Aminoácidos , Proteínas de Bactérias/química , Proteínas de Bactérias/genética , Carbono/metabolismo , Proteína Receptora de AMP Cíclico/química , Proteína Receptora de AMP Cíclico/genética , Regulação Bacteriana da Expressão Gênica , Humanos , Dados de Sequência Molecular , Infecções por Mycobacterium não Tuberculosas/microbiologia , Mycobacterium smegmatis/genética , Óperon , Regiões Promotoras Genéticas , Alinhamento de Sequência
7.
Protein Expr Purif ; 107: 62-7, 2015 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-25462810

RESUMO

DNA gyrase is a type IIA topoisomerase found in bacteria but not in humans. The enzyme is required for bacterial DNA replication and transcription, and is an important antibacterial target that is sensitive to the widely-used fluoroquinolone drugs. Due to the emergence of fluoroquinolone resistance, the discovery of new classes of drugs that target DNA gyrase is urgent. The DNA gyrase holoenzyme is a heterodimer of subunit pairs (A2B2). The 90 kDa A subunits bind, cleave, and rejoin double stranded DNA. The enzyme introduces negative supercoils into closed circular bacterial DNA using ATP hydrolysis catalysed by the 70 kDa B subunits. Subdomains of DNA gyrase subunits have been crystallised for structural analysis and the resulting models used to improve drugs that target the DNA binding region and active site. While crystal structures are available for topoisomerase IV complexes with cleaved DNA, there is none for the complete DNA gyrase complex with substrate DNA bound. Thermophiles offer significant advantages in obtaining stable enzymes for structural and functional studies. In order to develop a capability for drug screening and structure-directed drug discovery we have reconstituted a functional and drug-sensitive DNA gyrase complex using heterologously expressed subunits from the thermophile Thermus thermophilus.


Assuntos
Proteínas de Bactérias/metabolismo , DNA Girase/metabolismo , Thermus thermophilus/enzimologia , Proteínas de Bactérias/química , Proteínas de Bactérias/genética , Proteínas de Bactérias/isolamento & purificação , DNA Girase/química , DNA Girase/genética , DNA Girase/isolamento & purificação , DNA Bacteriano/genética , DNA Bacteriano/metabolismo , Estabilidade Enzimática , Hidrólise , Modelos Moleculares , Thermus thermophilus/química , Thermus thermophilus/genética
8.
J Bacteriol ; 196(17): 3091-7, 2014 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-24936051

RESUMO

Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator.


Assuntos
Proteína Receptora de AMP Cíclico/metabolismo , Citocromos/metabolismo , Regulação Bacteriana da Expressão Gênica/fisiologia , Mycobacterium smegmatis/enzimologia , Oxigênio/metabolismo , Proteína Receptora de AMP Cíclico/genética , Citocromos/genética , Regulação Enzimológica da Expressão Gênica/fisiologia , Mycobacterium smegmatis/genética , Mycobacterium smegmatis/metabolismo , Transcrição Gênica
9.
J Glob Antimicrob Resist ; 36: 1-3, 2024 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-37992964

RESUMO

OBJECTIVES: Antimicrobial resistance (AMR) including multidrug-resistant (MDR) and extensively drug-resistant (XDR) Pseudomonas aeruginosa has emerged as one of the serious public health threats across the globe. Southeast Asia is a 'hot spot' of antimicrobial-resistant bacteria, including MDR P. aeruginosa. Despite Myanmar being located in Southeast Asia and suffering from a high infectious disease burden, data on MDR and XDR P. aeruginosa from Myanmar are limited. In this communication, we report the draft genome of an XDR P. aeruginosa isolate, MMXDRPA001, that was identified during a routine diagnosis in Myanmar. METHODS: An MMXDRPA001 isolate colonising a hospitalised patient was characterised by antibiotic resistance profiling following standard methods and whole-genome sequencing using an Illumina MiSeq platform. The generated reads were de novo assembled using SPAdes (v.3.9.1). Annotation was performed by Prokka (v.1.14.0). Sequence type, antimicrobial resistance and virulence-related genes were predicted from the sequence. The phylogenetic relationships of all P. aeruginosa isolates were determined using core genome single-nucleotide polymorphisms (SNPs) analysis utilising Snippy (v.4.6.0) and Gubbins (v.2.3.4). RESULTS: P. aeruginosa MMXDRPA001 was resistant to most antipseudomonal ß-lactams, aminoglycosides and quinolones. The assembly comprised 145 contigs totalling 6 808 493 bases of sequence and a total of 6183 coding sequences. The isolate belonged to sequence type (ST) 235, contained carbapenemase-encoding gene blaIMP-1 and was clonally related to a previously reported isolate from Thailand. CONCLUSION: The identification of an international high-risk clone of ST235 XDR isolate in Myanmar, genomically relating to that from a neighbouring country underscores the need for coordinated AMR surveillance throughout healthcare settings in Myanmar and in the Southeast Asia region.


Assuntos
Infecções por Pseudomonas , Pseudomonas aeruginosa , Humanos , Farmacorresistência Bacteriana Múltipla/genética , Mianmar , Filogenia , Antibacterianos/farmacologia , Infecções por Pseudomonas/microbiologia
11.
Trop Med Infect Dis ; 8(4)2023 Apr 21.
Artigo em Inglês | MEDLINE | ID: mdl-37104364

RESUMO

This study aimed to characterize whole-genome sequencing (WGS) information of Mycobacterium tuberculosis (Mtb) in the Mandalay region of Myanmar. It was a cross-sectional study conducted with 151 Mtb isolates obtained from the fourth nationwide anti-tuberculosis (TB) drug-resistance survey. Frequency of lineages 1, 2, 3, and 4 were 55, 65, 9, and 22, respectively. The most common sublineage was L1.1.3.1 (n = 31). Respective multi-drug resistant tuberculosis (MDR-TB) frequencies were 1, 1, 0, and 0. Four clusters of 3 (L2), 2 (L4), 2 (L1), and 2 (L2) isolates defined by a 20-single-nucleotide variant (SNV) cutoff were detected. Simpson's index for sublineages was 0.0709. Such high diversity suggests that the area probably had imported Mtb from many geographical sources. Relatively few genetic clusters and MDR-TB suggest there is a chance the future control will succeed if it is carried out properly.

12.
J Biol Chem ; 286(46): 39882-92, 2011 Nov 18.
Artigo em Inglês | MEDLINE | ID: mdl-21953465

RESUMO

An unresolved question in the bioenergetics of methanogenic archaea is how the generation of proton-motive and sodium-motive forces during methane production is used to synthesize ATP by the membrane-bound A(1)A(o)-ATP synthase, with both proton- and sodium-coupled enzymes being reported in methanogens. To address this question, we investigated the biochemical characteristics of the A(1)A(o)-ATP synthase (MbbrA(1)A(o)) of Methanobrevibacter ruminantium M1, a predominant methanogen in the rumen. Growth of M. ruminantium M1 was inhibited by protonophores and sodium ionophores, demonstrating that both ion gradients were essential for growth. To study the role of these ions in ATP synthesis, the ahaHIKECFABD operon encoding the MbbrA(1)A(o) was expressed in Escherichia coli strain DK8 (Δatp) and purified yielding a 9-subunit protein with an SDS-stable c oligomer. Analysis of the c subunit amino acid sequence revealed that it consisted of four transmembrane helices, and each hairpin displayed a complete Na(+)-binding signature made up of identical amino acid residues. The purified MbbrA(1)A(o) was stimulated by sodium ions, and Na(+) provided pH-dependent protection against inhibition by dicyclohexylcarbodiimide but not tributyltin chloride. ATP synthesis in inverted membrane vesicles lacking sodium ions was driven by a membrane potential that was sensitive to cyanide m-chlorophenylhydrazone but not to monensin. ATP synthesis could not be driven by a chemical gradient of sodium ions unless a membrane potential was imposed. ATP synthesis under these conditions was sensitive to monensin but not cyanide m-chlorophenylhydrazone. These data suggest that the M. ruminantium M1 A(1)A(o)-ATP synthase exhibits all the properties of a sodium-coupled enzyme, but it is also able to use protons to drive ATP synthesis under conditions that favor proton coupling, such as low pH and low levels of sodium ions.


Assuntos
Trifosfato de Adenosina/biossíntese , Methanobrevibacter/enzimologia , ATPases Translocadoras de Prótons/metabolismo , Sódio/metabolismo , Trifosfato de Adenosina/genética , Cátions Monovalentes/metabolismo , Methanobrevibacter/genética , Monensin/farmacologia , Óperon/fisiologia , Estrutura Secundária de Proteína , Ionóforos de Próton/farmacologia , ATPases Translocadoras de Prótons/antagonistas & inibidores , ATPases Translocadoras de Prótons/química , ATPases Translocadoras de Prótons/genética , Ionóforos de Sódio/farmacologia
14.
PLOS Glob Public Health ; 2(6): e0000588, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36962394

RESUMO

Tuberculosis (TB) remains a significant cause of morbidity and mortality in Myanmar. The fourth National TB Prevalence Survey was conducted in 2017-2018 to determine the actual burden of TB not only at the national level but also for three subnational strata (the states, regions other than Yangon, and the Yangon region) and develop a more efficacious country strategy on TB care and control. One hundred and thirty eight clusters were selected by population proportionate sampling. Adult (≥15 years of age) residents having lived for 2 weeks or more in the households of the selected clusters were invited to participate in the survey. The survey participants were screened for TB by a questionnaire and digital chest X-ray (CXR) after providing written informed consent. Individuals with a positive symptom screen and/or chest X-ray suggestive of TB were asked to provide sputum samples to test for Mycobacterium tuberculosis (Mtb) by Ziehl-Neelsen direct light microscopy, Xpert MTB/RIF Ultra (Xpert), and culture (Ogawa media). Bacteriologically confirmed TB cases were defined by an expert panel. Of 75 676 eligible residents, 66 480 (88%) participated, and 10 082 (15%) screened positive for TB. Among these, 322 participants were defined as bacteriologically confirmed TB cases. Cough lasting for two weeks or longer, one of the criteria used for screening for symptoms, could detect only 14% (45/322) of the study cases. The estimated prevalence of bacteriologically confirmed adult pulmonary TB was 468 (95% CI: 391-546) per 100,000. The prevalence was much higher among males, the older age group, urban Yangon and remote villages. In-depth interview with the participants on TB treatment showed that none of them was diagnosed in a TB health centre (primary care facilities). The prevalence of TB in Myanmar is still high due to challenges such as uncontrolled urbanization, an ageing population, migration, and poor access to health facilities in remote areas. New screening and diagnostic tools might help to detect more TB patients. There is a need to lay greater emphasis on multisectoral approaches, decentralization and the integration of basic TB services into primary care facilities.

15.
Trop Med Infect Dis ; 7(12)2022 Dec 19.
Artigo em Inglês | MEDLINE | ID: mdl-36548703

RESUMO

Mycobacterium tuberculosis complex (MTBC) is divided into 9 whole genome sequencing (WGS) lineages. Among them, lineages 1−4 are widely distributed. Multi-drug resistant tuberculosis (MDR-TB) is a major public health threat. For effective TB control, there is a need to obtain genetic information on lineages of Mycobacterium tuberculosis (Mtb) and to understand distribution of lineages and drug resistance. This study aimed to describe the distribution of major lineages and drug resistance patterns of Mtb in Upper Myanmar. This was a cross-sectional study conducted with 506 sequenced isolates. We found that the most common lineage was lineage 2 (n = 223, 44.1%). The most common drug resistance mutation found was streptomycin (n = 44, 8.7%). Lineage 2 showed a higher number of MDR-TB compared to other lineages. There were significant associations between lineages of Mtb and drug resistance patterns, and between lineages and geographical locations of Upper Myanmar (p value < 0.001). This information on the distribution of Mtb lineages across the geographical areas will support a lot for the better understanding of TB transmission and control in Myanmar and other neighboring countries. Therefore, closer collaboration in cross border tuberculosis control is recommended.

16.
Microbiol Resour Announc ; 11(11): e0078122, 2022 Nov 17.
Artigo em Inglês | MEDLINE | ID: mdl-36227116

RESUMO

We report here the complete genome sequence of Mycobacterium tuberculosis strain Colonial S-type 1 (CS1), which has been responsible for ongoing outbreaks of tuberculosis in New Zealand over the past 30 years. CS1 appears to be highly transmissible, with greater rates of progression to active disease, compared to other circulating M. tuberculosis strains; therefore, comparison of its genomic content is of interest.

17.
Parasitol Int ; 89: 102589, 2022 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-35470066

RESUMO

The absence of a routine continuous in vitro cultivation method for Plasmodium vivax, an important globally distributed parasite species causing malaria in humans, has restricted investigations to field and clinical sampling. Such a method has recently been developed for the Berok strain of P. cynomolgi, a parasite of macaques that has long been used as a model for P. vivax, as these two parasites are nearly indistinguishable biologically and are genetically closely related. The availability of the P. cynomolgi Berok in routine continuous culture provides for the first time an opportunity to conduct a plethora of functional studies. However, the initial cultivation protocol proved unsuited for investigations requiring extended cultivation times, such as reverse genetics and drug resistance. Here we have addressed some of the critical obstacles to this, and we propose a set of modifications that help overcome them.


Assuntos
Malária Vivax , Malária , Parasitos , Plasmodium cynomolgi , Animais , Macaca/parasitologia , Malária/parasitologia , Malária Vivax/parasitologia , Plasmodium vivax
18.
Trop Med Infect Dis ; 6(3)2021 Jul 14.
Artigo em Inglês | MEDLINE | ID: mdl-34287379

RESUMO

BACKGROUND: This is the first survey to use the World Health Organization (WHO) methodology to document the magnitude and main drivers of tuberculosis (TB) patient costs in order to guide policies on cost mitigation and to produce a baseline measure for the percentage of TB-affected households experiencing catastrophic costs in Myanmar. METHODS: A nationally representative cross-sectional survey was administered to 1000 TB patients in health facilities from December 2015 to February 2016, focusing on costs of TB treatment (direct and indirect), household income, and coping strategies. A total cost was estimated for each household by extrapolating reported costs and comparing them to household income. If the proportion of total costs exceeded 20% of the annual household income, a TB-affected household was deemed to have faced catastrophic costs. RESULTS: 60% of TB-affected households faced catastrophic costs in Myanmar. On average, total costs were USD 759, and the largest proportion of this total was accounted for by patient time (USD 365), followed by food costs (USD 200), and medical expenses (USD 130). Low household wealth quintile and undergoing MDR-TB treatment were both significant predictors for households facing catastrophic costs. CONCLUSIONS: The high proportion of TB-affected households experiencing catastrophic costs suggests the need for TB-specific social protection programs in patient-centered healthcare. The survey findings have led the government and donors to increase support for MDR-TB patients. The significant proportion of total spending attributable to lost income and food or nutritional supplements suggests that income replacement programs and/or food packages may ameliorate the burdensome costs.

19.
Trop Med Infect Dis ; 5(4)2020 Sep 30.
Artigo em Inglês | MEDLINE | ID: mdl-33007895

RESUMO

Worldwide, studies investigating the relationship between the lineage of Mycobacterium tuberculosis (MTB) across geographic areas has empowered the "End TB" program and understand transmission across national boundaries. Genomic diversity of MTB varies with geographical locations and ethnicity. Genomic diversity can also affect the emergence of drug resistance. In Myanmar, we still have limited genetic information about geographical, ethnicity, and drug resistance linkage to MTB genetic information. This study aimed to describe the geno-spatial distribution of MTB and drug resistance profiles in Myanmar-Thailand border areas. A cross-sectional study was conducted with a total of 109 sequenced isolates. The lineages of MTB and the potential associated socio-demographic, geographic and clinical factors were analyzed using Fisher's exact tests. p value of statistically significance was set at < 0.05. We found that 67% of the isolates were lineage 1 (L1)/East-African-Indian (EAI) (n = 73), followed by lineage 2 (L2)/Beijing (n = 26), lineage 4 (L4)/European American (n = 6) and lineage 3 (L3)/Delhi/Central Asian (n = 4). "Gender", "type of TB patient", "sputum smear grading" and "streptomycin resistance" were significantly different with the lineages of MTB. Sublineages of L1, which had never been reported elsewhere in Myanmar, were detected in this study area. Moreover, both ethnicity and lineage of MTB significantly differed in distribution by patient location. Diversity of the lineage of MTB and detection of new sublineages suggested that this small area had been resided by a heterogeneous population group who actively transmitted the disease. This information on distribution of lineage of MTB can be linked in the future with those on the other side of the border to evaluate cross-border transmission.

20.
ACS Infect Dis ; 5(2): 239-249, 2019 02 08.
Artigo em Inglês | MEDLINE | ID: mdl-30485737

RESUMO

Respiration is a promising target for the development of new antimycobacterial agents, with a growing number of compounds in clinical development entering this target space. However, more candidate inhibitors are needed to expand the therapeutic options available for drug-resistant Mycobacterium tuberculosis infection. Here, we characterize a putative respiratory complex III (QcrB) inhibitor, TB47: a pyrazolo[1,5- a]pyridine-3-carboxamide. TB47 is active (MIC between 0.016 and 0.500 µg/mL) against a panel of 56 M. tuberculosis clinical isolates, including 37 multi-drug-resistant and two extensively drug-resistant strains. Pharmacokinetic and toxicity studies showed promising profiles, including negligible CYP450 interactions, cytotoxicity, and hERG channel inhibition. Consistent with other reported QcrB inhibitors, TB47 inhibits oxygen consumption only when the alternative oxidase, cytochrome bd, is deleted. A point mutation in the qcrB cd2-loop (H190Y, M. smegmatis numbering) rescues the inhibitory effects of TB47. Metabolomic profiling of TB47-treated M. tuberculosis H37Rv cultures revealed accumulation of steps in the TCA cycle and pentose phosphate pathway that are linked to reducing equivalents, suggesting that TB47 causes metabolic redox stress. In mouse infection models, a TB47 monotherapy was not bactericidal. However, TB47 was strongly synergistic with pyrazinamide and rifampicin, suggesting a promising role in combination therapies. We propose that TB47 is an effective lead compound for the development of novel tuberculosis chemotherapies.


Assuntos
Antituberculosos/farmacologia , Complexo III da Cadeia de Transporte de Elétrons/antagonistas & inibidores , Tuberculose Extensivamente Resistente a Medicamentos/tratamento farmacológico , Mycobacterium tuberculosis/efeitos dos fármacos , Tuberculose Resistente a Múltiplos Medicamentos/tratamento farmacológico , Animais , Antituberculosos/farmacocinética , Feminino , Metabolômica , Camundongos , Camundongos Endogâmicos BALB C , Testes de Sensibilidade Microbiana , Piridinas/farmacologia
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA