RESUMO
Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.
Assuntos
Regulação da Expressão Gênica de Plantas , Plantas Geneticamente Modificadas , Populus , Regiões Promotoras Genéticas , Populus/genética , Populus/metabolismo , Regiões Promotoras Genéticas/genética , Plantas Geneticamente Modificadas/genética , Desidratação/genética , Estresse Fisiológico/genética , Especificidade de Órgãos/genética , Folhas de Planta/genética , Folhas de Planta/metabolismoRESUMO
Adaptation to abiotic stress is critical for the survival of perennial tree species. Salinity affects plant growth and productivity by interfering with major biosynthetic processes. Detrimental effects of salinity may vary between different plant tissues and cell types. However, spatial molecular mechanisms controlling plant responses to salinity stress are not yet thoroughly understood in perennial trees. We used laser capture microdissection in clones of Populus tremula x alba to isolate palisade and vascular cells of intermediary leaf from plants exposed to 150 mM NaCl for 10 days, followed by a recovery period. Cell-specific changes in proteins and metabolites were determined. Salinity induced a vascular-specific accumulation of proteins associated with photorespiration, and the accumulation of serine, 3-phosphoglycerate and NH4 + suggesting changes in N metabolism. Accumulation of the GLUTAMINE SYNTHETASE 2 protein, and increased GS1.1 gene expression, indicated that NH4 + produced in photorespiration was assimilated to glutamine, the main amino acid translocated in Populus trees. Further analysis of total soluble proteins in stems and roots showed the accumulation of bark storage proteins induced by the salinity treatments. Collectively, our results suggest that the salt-induced photorespiration in vascular cells mediates N-reallocation in Populus, an essential process for the adaptation of trees to adverse conditions.
RESUMO
Global warming and climate change are driving an alarming increase in the frequency and intensity of different abiotic stresses, such as droughts, heat waves, cold snaps, and flooding, negatively affecting crop yields and causing food shortages. Climate change is also altering the composition and behavior of different insect and pathogen populations adding to yield losses worldwide. Additional constraints to agriculture are caused by the increasing amounts of human-generated pollutants, as well as the negative impact of climate change on soil microbiomes. Although in the laboratory, we are trained to study the impact of individual stress conditions on plants, in the field many stresses, pollutants, and pests could simultaneously or sequentially affect plants, causing conditions of stress combination. Because climate change is expected to increase the frequency and intensity of such stress combination events (e.g., heat waves combined with drought, flooding, or other abiotic stresses, pollutants, and/or pathogens), a concentrated effort is needed to study how stress combination is affecting crops. This need is particularly critical, as many studies have shown that the response of plants to stress combination is unique and cannot be predicted from simply studying each of the different stresses that are part of the stress combination. Strategies to enhance crop tolerance to a particular stress may therefore fail to enhance tolerance to this specific stress, when combined with other factors. Here we review recent studies of stress combinations in different plants and propose new approaches and avenues for the development of stress combination- and climate change-resilient crops.
Assuntos
Aclimatação , Mudança Climática , Produtos Agrícolas/fisiologia , Estresse Fisiológico , Agricultura , Secas , Microbiologia do SoloRESUMO
Changes in climate conditions can negatively affect the productivity of crop plants. They can induce chloroplast degradation (senescence), which leads to decreased source capacity, as well as decreased whole-plant carbon/nitrogen assimilation and allocation. The importance, contribution and mechanisms of action regulating source-tissue capacity under stress conditions in tomato (Solanum lycopersicum) are not well understood. We hypothesized that delaying chloroplast degradation by altering the activity of the tomato chloroplast vesiculation (CV) under stress would lead to more efficient use of carbon and nitrogen and to higher yields. Tomato CV is upregulated under stress conditions. Specific induction of CV in leaves at the fruit development stage resulted in stress-induced senescence and negatively affected fruit yield, without any positive effects on fruit quality. Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated protein 9 (CRISPR/CAS9) knockout CV plants, generated using a near-isogenic tomato line with enhanced sink capacity, exhibited stress tolerance at both the vegetative and the reproductive stages, leading to enhanced fruit quantity, quality and harvest index. Detailed metabolic and transcriptomic network analysis of sink tissue revealed that the l-glutamine and l-arginine biosynthesis pathways are associated with stress-response conditions and also identified putative novel genes involved in tomato fruit quality under stress. Our results are the first to demonstrate the feasibility of delayed stress-induced senescence as a stress-tolerance trait in a fleshy fruit crop, to highlight the involvement of the CV pathway in the regulation of source strength under stress and to identify genes and metabolic pathways involved in increased tomato sink capacity under stress conditions.
Assuntos
Solanum lycopersicum , Solanum lycopersicum/genética , Frutas/metabolismo , Cloroplastos/metabolismo , Carbono/metabolismo , Nitrogênio/metabolismoRESUMO
KEY MESSAGE: T-DNA and CRISPR/Cas9-mediated knockout of polyester synthase-like genes delays flowering time in Arabidopsis thaliana and Medicago sativa (alfalfa). Thus, we here present the first report of edited alfalfa with delayed flowering.
Assuntos
Arabidopsis , Medicago sativa , Medicago sativa/genética , Sistemas CRISPR-Cas/genética , Flores/genética , Arabidopsis/genéticaRESUMO
Arabidopsis plastid antiporters KEA1 and KEA2 are critical for plastid development, photosynthetic efficiency, and plant development. Here, we show that KEA1 and KEA2 are involved in vacuolar protein trafficking. Genetic analyses found that the kea1 kea2 mutants had short siliques, small seeds, and short seedlings. Molecular and biochemical assays showed that seed storage proteins were missorted out of the cell and the precursor proteins were accumulated in kea1 kea2. Protein storage vacuoles (PSVs) were smaller in kea1 kea2. Further analyses showed that endosomal trafficking in kea1 kea2 was compromised. Vacuolar sorting receptor 1 (VSR1) subcellular localizations, VSR-cargo interactions, and p24 distribution on the endoplasmic reticulum (ER) and Golgi apparatus were affected in kea1 kea2. Moreover, plastid stromule growth was reduced and plastid association with the endomembrane compartments was disrupted in kea1 kea2. Stromule growth was regulated by the cellular pH and K+ homeostasis maintained by KEA1 and KEA2. The organellar pH along the trafficking pathway was altered in kea1 kea2. Overall, KEA1 and KEA2 regulate vacuolar trafficking by controlling the function of plastid stromules via adjusting pH and K+ homeostasis.
Assuntos
Proteínas de Arabidopsis , Arabidopsis , Arabidopsis/metabolismo , Antiporters/genética , Antiporters/metabolismo , Proteínas de Arabidopsis/genética , Proteínas de Arabidopsis/metabolismo , Vacúolos/metabolismo , Plastídeos/metabolismo , Cátions/metabolismo , Transporte ProteicoRESUMO
Improving biological nitrogen fixation (BNF) in cereal crops is a long-sought objective; however, no successful modification of cereal crops showing increased BNF has been reported. Here, we described a novel approach in which rice plants were modified to increase the production of compounds that stimulated biofilm formation in soil diazotrophic bacteria, promoted bacterial colonization of plant tissues and improved BNF with increased grain yield at limiting soil nitrogen contents. We first used a chemical screening to identify plant-produced compounds that induced biofilm formation in nitrogen-fixing bacteria and demonstrated that apigenin and other flavones induced BNF. We then used CRISPR-based gene editing targeting apigenin breakdown in rice, increasing plant apigenin contents and apigenin root exudation. When grown at limiting soil nitrogen conditions, modified rice plants displayed increased grain yield. Biofilm production also modified the root microbiome structure, favouring the enrichment of diazotrophic bacteria recruitment. Our results support the manipulation of the flavone biosynthetic pathway as a feasible strategy for the induction of biological nitrogen fixation in cereals and a reduction in the use of inorganic nitrogen fertilizers.
Assuntos
Fixação de Nitrogênio , Oryza , Fixação de Nitrogênio/genética , Oryza/metabolismo , Solo , Edição de Genes , Apigenina/metabolismo , Fertilizantes , Produtos Agrícolas , Bactérias/genética , Nitrogênio/metabolismo , Grão Comestível/metabolismo , BiofilmesRESUMO
In acidic soils, aluminum (Al) toxicity is the main factor inhibiting plant root development and reducing crops yield. STOP1 (SENSITIVE TO PROTON RHIZOTOXICITY 1) was a critical factor in detoxifying Al stress. Under Al stress, STOP1 expression was not induced, although STOP1 protein accumulated, even in the presence of RAE1 (STOP1 DEGRADATION E3-LIGASE). How the Al stress triggers and stabilises the accumulation of STOP1 is still unknown. Here, we characterised SlSTOP1-interacting zinc finger protein (SlSZP1) using a yeast-two-hybrid screening, and generated slstop1, slszp1 and slstop1/slszp1 knockout mutants using clustered regularly interspaced short palindromic repeats (CRISPR) in tomato. SlSZP1 is induced by Al stress but it is not regulated by SlSTOP1. The slstop1, slszp1 and slstop1/slszp1 knockout mutants exhibited hypersensitivity to Al stress. The expression of SlSTOP1-targeted genes, such as SlRAE1 and SlASR2 (ALUMINUM SENSITIVE), was inhibited in both slstop1 and slszp1 mutants, but not directly regulated by SlSZP1. Furthermore, the degradation of SlSTOP1 by SlRAE1 was prevented by SlSZP1. Al stress increased the accumulation of SlSTOP1 in wild-type (WT) but not in slszp1 mutants. The overexpression of either SlSTOP1 or SlSZP1 did not enhance plant Al resistance. Altogether, our results show that SlSZP1 is an important factor for protecting SlSTOP1 from SlRAE1-mediated degradation.
Assuntos
Proteínas de Arabidopsis , Arabidopsis , Alumínio/metabolismo , Alumínio/toxicidade , Arabidopsis/genética , Proteínas de Arabidopsis/metabolismo , Regulação da Expressão Gênica de Plantas , Raízes de Plantas/metabolismo , Fatores de Transcrição/metabolismo , Dedos de ZincoRESUMO
KEYMESSAGE: We present the first report on base editing in alfalfa. Specifically, we showed edited alfalfa with tolerance to both sulfonylurea- and imidazolinone-type herbicides.
Assuntos
Edição de Genes/métodos , Herbicidas/farmacologia , Medicago sativa/efeitos dos fármacos , Medicago sativa/genética , Resistência a Herbicidas/genética , Herbicidas/química , Plantas Geneticamente Modificadas , Compostos de Sulfonilureia/farmacologiaRESUMO
Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic-related and salt stress-inducible synthetic promoters for use in hybrid poplar. De novo motif-detecting algorithms yielded 30 water-deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water-deficit stress motifs (SD18, SD13 and SD9) found in 16 co-expressed gene promoters, and we discovered a well-conserved motif for salt response (SS16). We characterized several native poplar stress-inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five-to-eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18-1, SD9-2, SS16-1, SS16-2 and SS16-3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18-1 and SD9-2 were induced by water-deficit stress, whereas SS16-1, SS16-2 and SS16-3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.
Assuntos
Regulação da Expressão Gênica de Plantas , Proteínas de Plantas , Regulação da Expressão Gênica de Plantas/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Plantas Geneticamente Modificadas/genética , Plantas Geneticamente Modificadas/metabolismo , Regiões Promotoras Genéticas/genética , Estresse Fisiológico/genéticaRESUMO
Cadmium is one of the most important contaminants and it induces severe plant growth restriction. In this study, we analyzed the metabolic changes associated with root growth restriction caused by cadmium in the early seminal root apex of wheat. Our study included two genotypes: the commercial variety ProINTA Federal (WT) and the PSARK ::IPT (IPT) line which exhibit high-grade yield performance under water deficit. Root tips of seedlings grown for 72 h without or with 10 µM CdCl2 (Cd-WT and Cd-IPT) were compared. Root length reduction was more severe in Cd-WT than Cd-IPT. Cd decreased superoxide dismutase activity in both lines and increased catalase activity only in the WT. In Cd-IPT, ascorbate and guaiacol peroxidase activities raised compared to Cd-WT. The hormonal homeostasis was altered by the metal, with significant decreases in abscisic acid, jasmonic acid, 12-oxophytodienoic acid, gibberellins GA20, and GA7 levels. Increases in flavonoids and phenylamides were also found. Root growth impairment was not associated with a decrease in expansin (EXP) transcripts. On the contrary, TaEXPB8 expression increased in the WT treated by Cd. Our findings suggest that the line expressing the PSARK ::IPT construction increased the homeostatic range to cope with Cd stress, which is visible by a lesser reduction of the root elongation compared to WT plants. The decline of root growth produced by Cd was associated with hormonal imbalance at the root apex level. We hypothesize that activation of phenolic secondary metabolism could enhance antioxidant defenses and contribute to cell wall reinforcement to deal with Cd toxicity.
Assuntos
Cádmio , Triticum , Alquil e Aril Transferases , Antioxidantes , Cádmio/toxicidade , Catalase , Raízes de Plantas/genética , Plântula/genética , Superóxido Dismutase , Triticum/genéticaRESUMO
Cation/H+ (NHX-type) antiporters are important regulators of intracellular ion homeostasis and are critical for cell expansion and plant stress acclimation. In Arabidopsis (Arabidopsis thaliana), four distinct NHX isoforms, named AtNHX1 to AtNHX4, locate to the tonoplast. To determine the concerted roles of all tonoplast NHXs on vacuolar ion and pH homeostasis, we examined multiple knockout mutants lacking all but one of the four vacuolar isoforms and quadruple knockout plants lacking any vacuolar NHX activity. The nhx triple and quadruple knockouts displayed reduced growth phenotypes. Exposure to sodium chloride improved growth while potassium chloride was deleterious to some knockouts. Kinetic analysis of K+ and Na+ transport indicated that AtNHX1 and AtNHX2 are the main contributors to both vacuolar pH and K+ and Na+ uptake, while AtNHX3 and AtNHX4 differ in Na+/K+ selectivity. The lack of any vacuolar NHX activity resulted in no K+ uptake, highly acidic vacuoles, and reduced but not abolished vacuolar Na+ uptake. Additional K+/H+ and Na+/H+ exchange activity assays in the quadruple knockout indicated Na+ uptake that was not H+ coupled, suggesting the existence of an alternative, cation/H+-independent, Na+ conductive pathway in vacuoles. These results highlight the importance of NHX-type cation/H+ antiporters in the maintenance of cellular cation homeostasis and in growth and development.
Assuntos
Antiporters/metabolismo , Proteínas de Arabidopsis/metabolismo , Arabidopsis/fisiologia , Proteínas de Transporte de Cátions/metabolismo , Trocadores de Sódio-Hidrogênio/metabolismo , Vacúolos/metabolismo , Antiporters/genética , Arabidopsis/efeitos dos fármacos , Proteínas de Arabidopsis/genética , Proteínas de Transporte de Cátions/genética , Cátions Monovalentes , Estiolamento/genética , Técnicas de Inativação de Genes , Concentração de Íons de Hidrogênio , Folhas de Planta/genética , Folhas de Planta/metabolismo , Plantas Geneticamente Modificadas , Potássio/metabolismo , Potássio/farmacologia , Sódio/metabolismo , Sódio/farmacologia , Trocadores de Sódio-Hidrogênio/genéticaRESUMO
High CO2 concentrations stimulate net photosynthesis by increasing CO2 substrate availability for Rubisco, simultaneously suppressing photorespiration. Previously, we reported that silencing the chloroplast vesiculation (cv) gene in rice increased source fitness, through the maintenance of chloroplast stability and the expression of photorespiration-associated genes. Because high atmospheric CO2 conditions diminished photorespiration, we tested whether CV silencing might be a viable strategy to improve the effects of high CO2 on grain yield and N assimilation in rice. Under elevated CO2 , OsCV expression was induced, and OsCV was targeted to peroxisomes where it facilitated the removal of OsPEX11-1 from the peroxisome and delivered it to the vacuole for degradation. This process correlated well with the reduction in the number of peroxisomes, the decreased catalase activity and the increased H2 O2 content in wild-type plants under elevated CO2 . At elevated CO2 , CV-silenced rice plants maintained peroxisome proliferation and photorespiration and displayed higher N assimilation than wild-type plants. This was supported by higher activity of enzymes involved in NO3- and NH4+ assimilation and higher total and seed protein contents. Co-immunoprecipitation of OsCV-interacting proteins suggested that, similar to its role in chloroplast protein turnover, OsCV acted as a scaffold, binding peroxisomal proteins.
Assuntos
Cloroplastos/metabolismo , Oryza/metabolismo , Fotossíntese , Dióxido de Carbono , Cloroplastos/genética , Cloroplastos/fisiologia , Grão Comestível/crescimento & desenvolvimento , Grão Comestível/metabolismo , Inativação Gênica , Genes de Plantas/genética , Genes de Plantas/fisiologia , Peróxido de Hidrogênio/metabolismo , Microscopia Eletrônica , Microscopia Eletrônica de Transmissão , Nitrogênio/metabolismo , Oryza/genética , Oryza/crescimento & desenvolvimento , Fotossíntese/fisiologia , Plantas Geneticamente Modificadas , Reação em Cadeia da PolimeraseRESUMO
In Arabidopsis, the initiation and proliferation of stomatal lineage cells is controlled by SPEECHLESS (SPCH). Phosphorylation of SPCH at the post-translational level has been reported to regulate stomatal development. Here we report that IDD16 acts as a negative regulator for stomatal initiation by directly regulating SPCH transcription. In Arabidopsis, IDD16 overexpression decreased abaxial stomatal density in a dose-dependent manner. Time course analysis revealed that the initiation of stomatal precursor cells in the IDD16-OE plants was severely inhibited. Consistent with these findings, the transcription of SPCH was greatly repressed in the IDD16-OE plants. In contrast, IDD16-RNAi transgenic line resulted in enhanced stomatal density, suggesting that IDD16 is an intrinsic regulator of stomatal development. ChIP analysis indicated that IDD16 could directly bind to the SPCH promoter. Furthermore, Arabidopsis plants overexpressing IDD16 exhibited significantly increased drought tolerance and higher integrated water use efficiency (WUE) due to reduction in leaf transpiration. Collectively, our results established that IDD16 negatively regulates stomatal initiation via trans-repression of SPCH, and thus provide a practical tool for increasing plant WUE through the manipulation of IDD16 expression.
Assuntos
Proteínas de Arabidopsis/genética , Arabidopsis/genética , Fatores de Transcrição Hélice-Alça-Hélice Básicos/genética , Regulação da Expressão Gênica de Plantas , Estômatos de Plantas/fisiologia , Arabidopsis/fisiologia , SecasRESUMO
Reactive oxygen species (ROS) play a key role in the acclimation process of plants to abiotic stress. They primarily function as signal transduction molecules that regulate different pathways during plant acclimation to stress, but are also toxic byproducts of stress metabolism. Because each subcellular compartment in plants contains its own set of ROS-producing and ROS-scavenging pathways, the steady-state level of ROS, as well as the redox state of each compartment, is different at any given time giving rise to a distinct signature of ROS levels at the different compartments of the cell. Here we review recent studies on the role of ROS in abiotic stress in plants, and propose that different abiotic stresses, such as drought, heat, salinity and high light, result in different ROS signatures that determine the specificity of the acclimation response and help tailor it to the exact stress the plant encounters. We further address the role of ROS in the acclimation of plants to stress combination as well as the role of ROS in mediating rapid systemic signaling during abiotic stress. We conclude that as long as cells maintain high enough energy reserves to detoxify ROS, ROS is beneficial to plants during abiotic stress enabling them to adjust their metabolism and mount a proper acclimation response.
Assuntos
Plantas/metabolismo , Espécies Reativas de Oxigênio/metabolismo , Secas , Regulação da Expressão Gênica de Plantas/efeitos dos fármacos , Regulação da Expressão Gênica de Plantas/genética , Regulação da Expressão Gênica de Plantas/efeitos da radiação , Temperatura Alta , Luz , Plantas/efeitos dos fármacos , Plantas/efeitos da radiação , Transdução de Sinais/efeitos dos fármacos , Transdução de Sinais/genética , Transdução de Sinais/efeitos da radiação , Cloreto de Sódio/farmacologiaRESUMO
KEY MESSAGE: We studied the salt stress tolerance of two accessions isolated from different areas of the world (Norway and Tunisia) and characterized the mechanism(s) regulating salt stress in Brachypodium sylvaticum Osl1 and Ain1. Perennial grasses are widely grown in different parts of the world as an important feedstock for renewable energy. Their perennial nature that reduces management practices and use of energy and agrochemicals give these biomass crops advantages when dealing with modern agriculture challenges such as soil erosion, increase in salinized marginal lands and the runoff of nutrients. Brachypodium sylvaticum is a perennial grass that was recently suggested as a suitable model for the study of biomass plant production and renewable energy. However, its plasticity to abiotic stress is not yet clear. We studied the salt stress tolerance of two accessions isolated from different areas of the world and characterized the mechanism(s) regulating salt stress in B. sylvaticum Osl1, originated from Oslo, Norway and Ain1, originated from Ain-Durham, Tunisia. Osl1 limited sodium transport from root to shoot, maintaining a better K/Na homeostasis and preventing toxicity damage in the shoot. This was accompanied by higher expression of HKT8 and SOS1 transporters in Osl1 as compared to Ain1. In addition, Osl1 salt tolerance was accompanied by higher abundance of the vacuolar proton pump pyrophosphatase and Na+/H+ antiporters (NHXs) leading to a better vacuolar pH homeostasis, efficient compartmentation of Na+ in the root vacuoles and salt tolerance. Although preliminary, our results further support previous results highlighting the role of Na+ transport systems in plant salt tolerance. The identification of salt tolerant and sensitive B. sylvaticum accessions can provide an experimental system for the study of the mechanisms and regulatory networks associated with stress tolerance in perennials grass.
Assuntos
Brachypodium/fisiologia , Tolerância ao Sal/efeitos dos fármacos , Cloreto de Sódio/farmacologia , Brachypodium/classificação , Brachypodium/efeitos dos fármacos , Plantas Tolerantes a Sal/efeitos dos fármacos , Plantas Tolerantes a Sal/fisiologia , Estresse Fisiológico/efeitos dos fármacosRESUMO
The NHX-type cation/H+ transporters in plants have been shown to mediate Na+ (K+ )/H+ exchange for salinity tolerance and K+ homoeostasis. In this study, we identified and characterized two NHX homologues, HtNHX1 and HtNHX2 from an infertile and salinity tolerant species Helianthus tuberosus (cv. Nanyu No. 1). HtNHX1 and HtNHX2 share identical 5'- and 3'-UTR and coding regions, except for a 342-bp segment encoding 114 amino acids (L272 to Q385 ) which is absent in HtNHX2. Both hydroponics and soil culture experiments showed that the expression of HtNHX1 or HtNHX2 improved the rice tolerance to salinity. Expression of HtNHX2, but not HtNHX1, increased rice grain yield, harvest index, total nutrient uptake under K+ -limited salt-stress or general nutrient deficiency conditions. The results provide a novel insight into NHX function in plant mineral nutrition.
Assuntos
Helianthus/metabolismo , Oryza/efeitos dos fármacos , Oryza/metabolismo , Regulação da Expressão Gênica de Plantas/efeitos dos fármacos , Regulação da Expressão Gênica de Plantas/genética , Helianthus/genética , Oryza/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Potássio/metabolismo , Salinidade , Tolerância ao Sal/genética , Tolerância ao Sal/fisiologia , Sódio/metabolismo , Cloreto de Sódio/farmacologiaRESUMO
Climate-change-driven stresses such as extreme temperatures, water deficit, and ion imbalance are projected to exacerbate and jeopardize global food security. Under field conditions, these stresses usually occur simultaneously and cause damages that exceed single stresses. Here, we investigated the transcriptional patterns and morpho-physiological acclimations of Brachypodium dystachion to single salinity, drought, and heat stresses, as well as their double and triple stress combinations. Hierarchical clustering analysis of morpho-physiological acclimations showed that several traits exhibited a gradually aggravating effect as plants were exposed to combined stresses. On the other hand, other morphological traits were dominated by salinity, while some physiological traits were shaped by heat stress. Response patterns of differentially expressed genes, under single and combined stresses (i.e. common stress genes), were maintained only among 37% of the genes, indicating a limited expression consistency among partially overlapping stresses. A comparison between common stress genes and genes that were uniquely expressed only under combined stresses (i.e. combination unique genes) revealed a significant shift from increased intensity to antagonistic responses, respectively. The different transcriptional signatures imply an alteration in the mode of action under combined stresses and limited ability to predict plant responses as different stresses are combined. Coexpression analysis coupled with enrichment analysis revealed that each gene subset was enriched with different biological processes. Common stress genes were enriched with known stress response pathways, while combination unique-genes were enriched with unique processes and genes with unknown functions that hold the potential to improve stress tolerance and enhance cereal productivity under suboptimal field conditions.
Assuntos
Brachypodium/genética , Secas , Perfilação da Expressão Gênica/métodos , Regulação da Expressão Gênica de Plantas , Temperatura Alta , Salinidade , Adaptação Fisiológica/genética , Biomassa , Brachypodium/metabolismo , Genes de Plantas/genética , Análise de Componente Principal , Estresse FisiológicoRESUMO
Senescence is an age-dependent process, ultimately leading to plant death, that in annual crop plants overlaps with the reproductive stage of development. Research on the molecular and biochemical mechanisms of leaf senescence has revealed a multi-layered regulatory network operating to control age-dependent processes. Abiotic stress-induced senescence challenges source-sink relationships and results in significant reduction in crop yields. Although processes associated with plant senescence are well studied, the mechanisms regulating stress-induced senescence are not well known. Here, we discuss the effects of abiotic stress on crop productivity, mechanisms associated with stress-induced senescence, and the possible use of these mechanisms for the generation of plant stress tolerance. We emphasize the involvement of source strength and stability of the photosynthetic apparatus in this process, and suggest a possible role of a perennial plant life strategy for the amelioration of stress-induced senescence.
Assuntos
Produtos Agrícolas/fisiologia , Folhas de Planta/fisiologia , Fenômenos Fisiológicos Vegetais , Estresse Fisiológico , Produção Agrícola , Produtos Agrícolas/crescimento & desenvolvimento , Folhas de Planta/crescimento & desenvolvimentoRESUMO
Abiotic stress-induced senescence in crops is a process particularly affecting the photosynthetic apparatus, decreasing photosynthetic activity and inducing chloroplast degradation. A pathway for stress-induced chloroplast degradation that involves the CHLOROPLAST VESICULATION (CV) gene was characterized in rice (Oryza sativa) plants. OsCV expression was up-regulated with the age of the plants and when plants were exposed to water-deficit conditions. The down-regulation of OsCV expression contributed to the maintenance of the chloroplast integrity under stress. OsCV-silenced plants displayed enhanced source fitness (i.e. carbon and nitrogen assimilation) and photorespiration, leading to water-deficit stress tolerance. Co-immunoprecipitation, intracellular co-localization, and bimolecular fluorescence demonstrated the in vivo interaction between OsCV and chloroplastic glutamine synthetase (OsGS2), affecting source-sink relationships of the plants under stress. Our results would indicate that the OsCV-mediated chloroplast degradation pathway is involved in the regulation of nitrogen assimilation during stress-induced plant senescence.