Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 2 de 2
Filtrar
Mais filtros

Base de dados
Ano de publicação
Tipo de documento
Intervalo de ano de publicação
1.
Curr Psychol ; : 1-19, 2022 Oct 14.
Artigo em Inglês | MEDLINE | ID: mdl-36258889

RESUMO

It is now widely accepted that we are in a climate emergency, and the number of people who are concerned about this problem is growing. Yet, qualitative, in-depth studies to investigate the emotional response to climate change were conducted either in high-income, western countries, or in low-income countries particularly vulnerable to climate change. To our knowledge, there are no qualitative studies conducted in countries that share great barriers to decarbonization while being significant contributors to carbon emissions. Since climate change affects people globally, it is crucial to study this topic in a variety of socio-political contexts. In this work, we discuss views and reflections voiced by highly concerned residents of Poland, a Central European country that is a major contributor to Europe's carbon emissions. We conducted 40 semi-structured interviews with Polish residents, who self-identified as concerned about climate change. A variety of emotions related to climate change were identified and placed in the context of four major themes: dangers posed by climate change, the inevitability of its consequences, attributions of responsibility, and commonality of concern. Our findings highlight a variety of often ambivalent and conflicting emotions that change along with the participant's thoughts, experiences and behaviours. Furthermore, we describe a wide repertoire of coping strategies, which promoted well-being and sustained long-term engagement in climate action. As such, our work contributes to research on a broad array of climate-related emotions. Supplementary Information: The online version contains supplementary material available at 10.1007/s12144-022-03807-3.

2.
Plant Dis ; 94(7): 920, 2010 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-30743587

RESUMO

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5'GGTTTGTTTACCACCCTTGG3' (3) and PMTV2 5'AAAAGCCTGAGCGGTTAATTG3' (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Lódz County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production. References: (1) S. Chang et al. Plant Mol Biol Rep. 11:113, 1993. (2) A. Germundsson et al. J. Gen. Virol. 83:1201, 2002. (3) S. Latvala-Kilby et al. Phytopathology 99:519, 2009.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA