The intracellular environment affects protein-protein interactions.

Protein-protein interactions are essential for life but rarely thermodynamically quantified in living cells. In vitro efforts show that protein complex stability is modulated by high concentrations of cosolutes, including synthetic polymers, proteins, and cell lysates via a combination of hard-core repulsions and chemical interactions. We quantified the stability of a model protein complex, the A34F GB1 homodimer, in buffer, Escherichia coli cells and Xenopus laevis oocytes. The complex is more stable in cells than in buffer and more stable in oocytes than E. coli Studies of several variants show that increasing the negative charge on the homodimer surface increases stability in cells. These data, taken together with the fact that oocytes are less crowded than E. coli cells, lead to the conclusion that chemical interactions are more important than hard-core repulsions under physiological conditions, a conclusion also gleaned from studies of protein stability in cells. Our studies have implications for understanding how promiscuous-and specific-interactions coherently evolve for a protein to properly function in the crowded cellular environment.

A Difference between In Vitro and In-Cell Protein Dimer Formation.

The high concentration of macromolecules in cells affects the stability of proteins and protein complexes via hard repulsions and chemical interactions, yet few studies have focused on chemical interactions. We characterized the domain-swapped dimer of the B1 domain of protein G in buffer and Escherichia coli cells by using heteronuclear, multidimensional nuclear magnetic resonance spectroscopy. In buffer, the monomer is a partially folded molten globule, but that species is not observed in cells. Experiments using urea suggest that the monomer is unfolded in cells, but again, the molten-globule form of the monomer is absent. The data suggest that attractive chemical interactions in the cytoplasm unfold the molten globule. We conclude that the intracellular environment not only modulates the stability of protein complexes but also can change the species present, reinforcing the idea that chemical interactions are more important than hard repulsions in cells.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Rheostatic Control of Protein Expression Using Tuner Cells.

We assessed the ability of two strains of Escherichia coli, BL21 (DE3) and Tuner (DE3), to express a variant of the B1 domain of protein G, which forms a side-by-side dimer, by using fluorine-labeling and 19F nuclear magnetic resonance spectroscopy. BL21 cells express the protein in a binary, all-or-none, manner, where more cells express the protein at a high level with an increasing inducer concentration. Tuner cells express the protein in a rheostatic manner, where expression increases across all cells with an increasing inducer concentration.

Effects of Length and Loop Composition on Structural Diversity and Similarity of (G3TG3NmG3TG3) G-Quadruplexes.

A G-rich sequence containing three loops to connect four G-tracts with each ≥2 guanines can possibly form G-quadruplex structures. Given that all G-quadruplex structures comprise the stacking of G-quartets, the loop sequence plays a major role on their folding topology and thermal stability. Here circular dichroism, NMR, and PAGE are used to study the effect of loop length and base composition in the middle loop, and a single base difference in loop 1 and 3 on G-quadruplex formation of (G3HG3NmG3HG3) sequences with and without flanking nucleotides, where H is T, A, or C and N is T, A, C, or G. In addition, melting curve for G-quadruplex unfolding was used to provide relatively thermal stability of G-quadruplex structure after the addition of K+ overnight. We further studied the effects of K+ concentration on their stability and found structural changes in several sequences. Such (G3HG3NmG3HG3) configuration can be found in a number of native DNA sequences. The study of structural diversity and similarity from these sequences may allow us to establish the correlation between model sequences and native sequences. Moreover, several sequences upon interaction with a G-quadruplex ligand, BMVC, show similar spectral change, implying that structural similarity is crucial for drug development.

Expression of the human telomerase reverse transcriptase gene is modulated by quadruplex formation in its first exon due to DNA methylation.

DNA secondary structures and methylation are two well-known mechanisms that regulate gene expression. The catalytic subunit of telomerase, human telomerase reverse transcriptase (hTERT), is overexpressed in ∼90% of human cancers to maintain telomere length for cell immortalization. Binding of CCCTC-binding factor (CTCF) to the first exon of the hTERT gene can down-regulate its expression. However, DNA methylation in the first exon can prevent CTCF binding in most cancers, but the molecular mechanism is unknown. The NMR analysis showed that a stretch of guanine-rich sequence in the first exon of hTERT and located within the CTCF-binding region can form two secondary structures, a hairpin and a quadruplex. A key finding was that the methylation of cytosine at the specific CpG dinucleotides will participate in quartet formation, causing the shift of the equilibrium from the hairpin structure to the quadruplex structure. Of further importance was the finding that the quadruplex formation disrupts CTCF protein binding, which results in an increase in hTERT gene expression. Our results not only identify quadruplex formation in the first exon promoted by CpG dinucleotide methylation as a regulator of hTERT expression but also provide a possible mechanistic insight into the regulation of gene expression via secondary DNA structures.

A G-Quadruplex Structure in the Promoter Region of CLIC4 Functions as a Regulatory Element for Gene Expression.

The differential transcriptional expression of CLIC4 between tumor cells and the surrounding stroma during cancer progression has been suggested to have a tumor-promoting effect. However, little is known about the transcriptional regulation of CLIC4. To better understand how this gene is regulated, the promoter region of CLIC4 was analyzed. We found that a high GC content near the transcriptional start site (TSS) might form an alternative G-quadruplex (G4) structure. Nuclear magnetic resonance spectroscopy (NMR) confirmed their formation in vitro. The reporter assay showed that one of the G4 structures exerted a regulatory role in gene transcription. When the G4-forming sequence was mutated to disrupt the G4 structure, the transcription activity dropped. To examine whether this G4 structure actually has an influence on gene transcription in the chromosome, we utilized the CRISPR/Cas9 system to edit the G4-forming sequence within the CLIC4 promoter in the cell genome. The pop-in/pop-out strategy was adopted to isolate the precisely-edited A375 cell clone. In CRISPR-modified A375 cell clones whose G4 was disrupted, there was a decrease in the endogenous CLIC4 messenger RNA (mRNA) expression level. In conclusion, we found that the G4 structure in the CLIC4 promoter might play an important role in regulating the level of transcription.

Binding of Small Molecules to G-quadruplex DNA in Cells Revealed by Fluorescence Lifetime Imaging Microscopy of o-BMVC Foci.

G-quadruplex (G4) structures have recently received increasing attention as a potential target for cancer research. We used time-gated fluorescence lifetime imaging microscopy (FLIM) with a G4 fluorescent probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), to measure the number of o-BMVC foci, which may represent G4 foci, in cells as a common signature to distinguish cancer cells from normal cells. Here, the decrease in the number of o-BMVC foci in the pretreatment of cancer cells with TMPyP4, BRACO-19 and BMVC4 suggested that they directly bind to G4s in cells. In contrast, the increase in the number of o-BMVC foci in the pretreatment of cells with PDS and Hoechst 33258 (H33258) suggested that they do not inhabit the binding site of o-BMVC to G4s in cells. After the H33258 was removed, the gradual decrease of H33258-induced G4 foci may be due to DNA repair. The purpose of this work is to introduce o-BMVC foci as an indicator not only to verify the direct binding of potential G4 ligands to G4 structures but also to examine the possible effect of some DNA binding ligands on DNA integrity by monitoring the number of G4 foci in cells.

Macromolecular Crowding by Polyethylene Glycol Reduces Protein Breathing.

Most efforts to understand macromolecular crowding focus on global (i.e., complete) unfolding, but smaller excursions, often called breathing, promote aggregation, which is associated with several diseases and the bane of pharmaceutical and commercial protein production. We used NMR to assess the effects of ethylene glycol (EG) and polyethylene glycols (PEGs) on the structure and stability of the B1 domain of protein G (GB1). Our data show that EG and PEGs stabilize GB1 differently. EG interacts with GB1 more strongly than PEGs, but neither affects the structure of the folded state. EG and 12000 g/mol PEG stabilize GB1 more than PEGs of intermediate size, but EG and smaller PEGs stabilize GB1 enthalpically while the largest PEG acts entropically. Our key finding is that PEGs turn local unfolding into global unfolding, and meta-analysis of published data supports this conclusion. These efforts provide knowledge that can be applied to improve biological drugs and commercial enzymes.

G-quadruplex formation by single-base mutation or deletion of mitochondrial DNA sequences.

BACKGROUND: Mitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro. METHODS: The combined circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE) results provide complementary insights into the structural variation of the studied G-rich sequence and its mutants. RESULTS: This study illustrates the structural diversity of mt10251, a G-rich mtDNA sequence with a 16-nt loop, (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures of mt10251 in 20 mM K+ solution. Moreover, a single-base mutation of mt10251 can cause significant changes in terms of structural populations and polymorphism. In addition, single-base mutations of near-but-not-PQF sequences can potentially change not-G4 to G4 structures. We further found 124 modified PQF sequences due to single-base mutations of near-but-not-PQF sequences in mtDNA. CONCLUSIONS: Single-base mutations of mt10251 could make significant changes in its structural variation and some single-base mutated sequences in mtDNA could form G4 structures in vitro. GENERAL SIGNIFICANCE: We illustrate the importance of single-base mutations of DNA sequences to the change of G4 formation in vitro. The use of single-base mutations by generating the fourth G-tract and followed by selection in shortening the longest loop size in the near-but-not-PQF sequences was conducted for the G4 formation.

Comparison and Elucidation of Structural Diversity and Variation of G-Rich Sequences with a Single G-Base Difference.

Previously, we found the structural diversity of a mitochondrial sequence mt10251 (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures in 20 mM K+ solution. Moreover, a single-base mutation of mt10251 could cause significant changes in terms of structural populations and polymorphism. In this work, we investigate the diverse G4 topologies of mt10251 and structural variation of its mutants. Using circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE), we first illustrate an unusual tetrameric G4 structure together with hairpin bulges formed by four strands of mt10251-d30 (GGGTGGGAGTAGTTCCCTGCTAAGGGAGG). Of interest is that the structural conversion from a hairpin structure to diverse G4 structures in mt10251 is negligible in mt10251-d30 after the addition of 20 mM K+. Further kinetic and thermal studies of mt10251, mt10251-d30, and their mutants reveal the major factors in determining the transition from a hairpin structure to diverse G4 structures of mt10251 and the structural variation of their mutants after the addition of 20 mM K+.

The G-quadruplex fluorescent probe 3,6-bis(1-methyl-2-vinyl-pyridinium) carbazole diiodide as a biosensor for human cancers.

Using time-gated fluorescence lifetime imaging microscopy, significantly more signals from 3,6-bis(1-methyl-2-vinyl-pyridinium) carbazole diiodide (o-BMVC) foci, characterized by the longer fluorescent decay time of o-BMVC, were detected in six types of cancer cells than in three types of normal cells. Accumulating evidence suggested that the o-BMVC foci are mainly the G-quadruplex foci. The large contrast in the number of o-BMVC foci can be considered as a common signature to distinguish cancer cells from normal cells. Further study of tissue biopsy showed that the o-BMVC test provides a high accuracy for clinical detection of head and neck cancers.