Phytophthora capsici, 100 Years Later: Research Mile Markers from 1922 to 2022.

In 1922, Phytophthora capsici was described by Leon Hatching Leonian as a new pathogen infecting pepper (Capsicum annuum), with disease symptoms of root rot, stem and fruit blight, seed rot, and plant wilting and death. Extensive research has been conducted on P. capsici over the last 100 years. This review succinctly describes the salient mile markers of research on P. capsici with current perspectives on the pathogen's distribution, economic importance, epidemiology, genetics and genomics, fungicide resistance, host susceptibility, pathogenicity mechanisms, and management.

First report of Sw-5 resistance-breaking strain of tomato spotted wilt orthotospovirus infecting tomato in Texas.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.

Plant-based antimicrobials inactivate Listeria monocytogenes and Salmonella enterica on melons grown in different regions of the United States.

The efficacy of plant-based antimicrobials against Salmonella Newport and Listeria monocytogenes on melon rinds was evaluated. Four cantaloupe and 3 honeydew melon varieties grown in Georgia, Arizona, Texas, North Carolina, Indiana and California were tested. Melon rinds (10 g pieces) were inoculated with 5-6 log CFU/10 g rind of S. Newport or L. monocytogenes. Samples were then immersed in 5 % olive extract or 0.5 % oregano oil antimicrobial solution and gently agitated for 2 min. Samples were stored at 4 °C and surviving populations of both bacteria were enumerated at days 0 and 3. Plant-based antimicrobials reduced S. Newport and L.monocytogenes population on all rind samples, regardless of the melon types, varieties or growing locations. Compared to the control, antimicrobial treatments caused up to 3.6 and 4.0 log reductions in populations of Salmonella and L. monocytogenes, respectively. In most cases, plant-based antimicrobial treatments reduced pathogen populations to below the detection limit (1 log CFU/g) at day 3. In general, oregano oil had better antimicrobial activity than olive extract and the antimicrobial treatments were more effective on Salmonella than on L. monocytogenes. The plant-based antimicrobial treatments exhibited better microbial reductions on honeydews than on cantaloupes. These antimicrobials could potentially be used as sanitizers for decontaminating melons.

First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Effect of production system and inhibitory potential of aroma volatiles on polyphenol oxidase and peroxidase activity in tomatoes.

BACKGROUND: Polyphenol oxidase (PPO) and peroxidase (POD) are key enzymes associated with shelf life and defense responses. Thus, the activity of PPO and POD enzymes is usually assessed to check the quality of food samples and to understand the physiological responses of plants to different stresses. However, the outcomes of PPO and POD activity assessment studies are highly dependent on assay conditions. Hence, in this study, we initially optimized PPO and POD extraction and high-throughput 96-well plates-based enzymatic activity assessment methods to evaluate the inhibitory potential of tomato volatile compounds. Later, we explored the effects of net-house and open-field growing on the PPO and POD activity in tomato fruits of eight cultivars. RESULTS: We found 150 mM of catechol and pH 7.0 were the optimal conditions for the maximum activity for the PPO assay. Conversely, 24 mM guaiacol with 12 mM H2 O2 and pH 6.0 was the best condition for the POD assay. Thermal inactivation studies confirmed that tomato POD is more resistant to heat than PPO. We found that the production systems had a considerable genotype-specific impact on tomato PPO and POD activity. Moreover, amongst the volatiles that were studied, ß-damascenone and d-limonene showed 50% PPO inhibition at 40 and 80 mM, respectively. CONCLUSION: The results of this study can be used to improve the shelf-life of fresh tomato fruit and its products. The findings also underscore the significance of PPO and POD enzymes as physiological trait markers in the tomato crop and fruit quality improvement programs. © 2020 Society of Chemical Industry.

Hormonal and metabolites responses in Fusarium wilt-susceptible and -resistant watermelon plants during plant-pathogen interactions.

BACKGROUND: Fusarium oxysporum f. sp. niveum (FON) causes Fusarium wilt in watermelon. Several disease-resistant watermelon varieties have been developed to combat Fusarium wilt. However, the key metabolites that mount defense responses in these watermelon varieties are unknown. Herein, we analyzed hormones, melatonin, phenolic acids, and amino acid profiles in the leaf tissue of FON zero (0)-resistant (PI-296341, Calhoun Grey, and Charleston Grey) and -susceptible (Sugar Baby) watermelon varieties before and after infection. RESULTS: We found that jasmonic acid-isoleucine (JA-Ile) and methyl jasmonate (MeJA) were selectively accumulated in one or more studied resistant varieties upon infection. However, indole-3-acetic acid (IAA) was only observed in the FON 0 inoculated plants of all varieties on the 16th day of post-inoculation. The melatonin content of PI-296341 decreased upon infection. Conversely, melatonin was only detected in the FON 0 inoculated plants of Sugar Baby and Charleston Grey varieties. On the 16th day of post-inoculation, the lysine content in resistant varieties was significantly reduced, whereas it was found to be elevated in the susceptible variety. CONCLUSIONS: Taken together, Me-JA, JA-Ile, melatonin, and lysine may have crucial roles in developing defense responses against the FON 0 pathogen, and IAA can be a biomarker of FON 0 infection in watermelon plants.

Incidence, Severity, and Characterization of Phytophthora Foot Rot of Citrus in Texas and Implications for Disease Management.

Phytophthora-induced foot rot, also known as gummosis, is an important disease affecting citrus production worldwide. In Texas, the third-largest citrus-producing state in the United States, limited information is available on the etiology and epidemiology of foot rot in commercial orchards. This study comprises a survey of foot rot incidence and severity in Texas and the characterization of Phytophthora isolates associated with the disease. Surveys in 2015 and 2017 of 30 orchards in the Lower Rio Grande Valley (LRGV) region where commercial citrus production is concentrated in the state revealed that foot rot occurred in 97% of the orchards assessed. Overall, foot rot symptoms were observed on 33.7% of the trees evaluated and the disease severity index in the region was rated at 14.2 and 16.5% in 2015 and 2017, respectively. Lesions were mostly present on the scion, while the rootstock (sour orange) was not affected. Phytophthora nicotianae was the only Phytophthora sp. isolated from the surveyed orchards and from five additional residential sites on the Texas Coastal Bend (TCB). Sporangia and chlamydospores from 34 representative LRGV isolates of P. nicotianae were larger than those of TCB isolates. In both LRGV and TCB, A1 and A2 mating types were present in the same location, albeit the A2 mating type was more prevalent. All isolates were sensitive to mefenoxam (50% inhibition in the presence of mefenoxam [EC50] < 0.5 µg/ml), except for one TCB isolate (EC50 = 143.6 µg/ml). Our research indicates that treatment for Phytophthora foot rot in the region is necessary and, although mefenoxam is still useful, alternating chemistries for resistance management are required.

Evaluation of bitter melon (Momordica charantia) cultivars grown in Texas and levels of various phytonutrients.

BACKGROUND: In the USA, Momordica charantia is relatively unknown and is usually found in specialty markets. In the present study, cultivation of five bitter melon cultivars grown under field conditions in College Station (TX, USA), was evaluated. Additionally, ascorbic acid, amino acids and phenolic compounds were quantified from various cultivars grown in different years. RESULTS: The yield of the first year of evaluation was comparable to other bitter melon growing regions, ranging from 9371.5 kg ha-1 for the Japanese Spindle cultivar to 20 839.1 kg ha-1 for the Hong Kong Green cultivar. Multivariate analysis suggests a strong correlation between yield and growth degree days, water use efficiency and organic matter, as well as an inverse correlation with the amount or precipitation during the growing season. The highest levels of total ascorbic acid were shown in the Japanese Spindle cultivar (162.97 mg 100 g-1 fresh fruit), whereas the lowest levels were expressed in the Hong Kong Green cultivar (42.69 mg 100 g-1 fresh fruit). The highest levels of total phenolics were consistently found the Indian White cultivar, in the range 10.6-12.5 mg g-1 catechin equivalents. Seven phenolics and organic acids were identified and quantified by liquid chromatography-mass spectrometry and high-performance liquid chromatography, respectively. Additionally, the highest levels of total amino acids were found in the Large Top cultivar. CONCLUSION: The current 3-year field study demonstrates that it is feasible to grow bitter melon commercially in Texas with proper climatic and agronomic conditions. Bitter melon is a rich source for ascorbic acid, amino acids and phenolic compounds, which makes it a valuable food source with respect to improving human health. © 2018 Society of Chemical Industry.

Modal Propellant Gauging: High-resolution and non-invasive gauging of both settled and unsettled liquids in reduced gravity.

The modal response of a liquid-filled tank to external acoustic excitation can be used to infer with high resolution the mass of contained liquid, the mass flow rate of liquids into and out of the tank, and changes in tank pressure. Both contained liquid mass and internal ullage pressure affect the modal response of the tank walls through fluid mass-loading of the tank walls and pressure-induced wall stiffening, respectively. Modal Propellant Gauging refers to the technology that exploits these shifts in modal frequencies to infer the mass of propellant in a tank. MPG is a non-invasive gauging technology that has demonstrated gauging resolutions of 1% for settled propellants and 2-3% for unsettled, sloshing propellants. Extensive parabolic flight testing of the MPG system on model tanks has been conducted to validate the technology in reduced gravity. MPG testing on a qualification tank for the Orion Program's European Service Module has also been conducted and is reported here. Finite element modeling of the Orion ESM ″upper" tank is discussed and compared with measurement data. Three computational approaches to mass determination, Peak Tracking, Point Sensor, and Spectral Density methods, are described here. Use cases are defined and analyzed in the context of the Orion ESM Qualification tank data, and an implementation scheme for continuous mass gauging on the Orion ESM is discussed.

Production system influences volatile biomarkers in tomato.

INTRODUCTION: In recent years, growers have used various production types, including high-tunnel systems, to increase the yield of tomatoes (Lycopersicon esculentum). However, the effect of high-tunnel cultivation, in comparison to conventional open-field production, on aroma and flavor volatiles is not fully understood. OBJECTIVES: To optimize the extraction and quantification conditions for the analysis of tomato volatiles using headspace solid phase microextraction (HS-SPME) coupled with gas chromatography-mass spectrometry (GC-MS), and study the effect of production systems on volatile profiles using metabolomics approach. METHODS: The HS-SPME conditions were optimized for extraction and GC-MS was used to quantify the volatiles from four tomato varieties grown in open-field and high-tunnel systems. Univariate and multivariate analyses were performed to identify the influence of production system on tomato volatiles. RESULTS AND CONCLUSIONS: The extraction of 2 g tomato samples at 60 °C for 45 min using divinylbenzene/carboxen/polydimethylsiloxane (DVB/CAR/PDMS) fiber gave the maximum amounts of volatiles. This optimized method was used to identify and quantify 41 volatiles from four tomato varieties. The levels of ß-damascenone were higher in the high-tunnel tomatoes and geranylacetone was higher in open-field tomatoes. These two volatile compounds could be considered as biomarkers for tomatoes grown in high-tunnel and open-field production systems. This study is the first report comparing volatiles in tomatoes grown in high-tunnel and open-field conditions, and our results confirmed that there is a critical need to adopt biomarker-specific production systems to improve the nutritional and organoleptic properties of tomatoes.

Bacterial diversity and composition on the rinds of specific melon cultivars and hybrids from across different growing regions in the United States.

The goal of this study was to characterize the bacterial diversity on different melon varieties grown in different regions of the US, and determine the influence that region, rind netting, and variety of melon has on the composition of the melon microbiome. Assessing the bacterial diversity of the microbiome on the melon rind can identify antagonistic and protagonistic bacteria for foodborne pathogens and spoilage organisms to improve melon safety, prolong shelf-life, and/or improve overall plant health. Bacterial community composition of melons (n = 603) grown in seven locations over a four-year period were used for 16S rRNA gene amplicon sequencing and analysis to identify bacterial diversity and constituents. Statistically significant differences in alpha diversity based on the rind netting and growing region (p < 0.01) were found among the melon samples. Principal Coordinate Analysis based on the Bray-Curtis dissimilarity distance matrix found that the melon bacterial communities clustered more by region rather than melon variety (R2 value: 0.09 & R2 value: 0.02 respectively). Taxonomic profiling among the growing regions found Enterobacteriaceae, Bacillaceae, Microbacteriaceae, and Pseudomonadaceae present on the different melon rinds at an abundance of ≥ 0.1%, but no specific core microbiome was found for netted melons. However, a core of Pseudomonadaceae, Bacillaceae, and Exiguobacteraceae were found for non-netted melons. The results of this study indicate that bacterial diversity is driven more by the region that the melons were grown in compared to rind netting or melon type. Establishing the foundation for regional differences could improve melon safety, shelf-life, and quality as well as the consumers' health.

Quantitative analysis of self-association and mobility of annexin A4 at the plasma membrane.

Annexins, found in most eukaryotic species, are cytosolic proteins that are able to bind negatively-charged phospholipids in a calcium-dependent manner. Annexin A4 (AnxA4) has been implicated in diverse cellular processes, including the regulation of exocytosis and ion-transport; however, its precise mechanistic role is not fully understood. AnxA4 has been shown to aggregate on lipid layers upon Ca(2+) binding in vitro, a characteristic that may be critical for its function. We have utilized advanced fluorescence microscopy to discern details on the mobility and self-assembly of AnxA4 after Ca(2+) influx at the plasma membrane in living cells. Total internal reflection microscopy in combination with Förster resonance energy transfer reveals that there is a delay between initial plasma membrane binding and the beginning of self-assembly and this process continues after the cytoplasmic pool has completely relocated. Number-and-brightness analysis suggests that the predominant membrane bound mobile form of the protein is trimeric. There also exists a pool of AnxA4 that forms highly immobile aggregates at the membrane. Fluorescence recovery after photobleaching suggests that the relative proportion of these two forms varies and is correlated with membrane morphology.

Hydroxy proline and gamma-aminobutyric acid: markers of susceptibility to vine decline disease caused by the fungus Monosporascus cannonballus in melons (Cucumis melo L.).

Background: Vine decline disease caused by the fungus Monosporascus cannonballus, is a threat to melon production (Cucumis melo L.) worldwide. Nonetheless, little is known about the metabolites produced during the host pathogen interaction. Thus, the objective of this study was to measure quantities of amino acids produced over time during such an interaction. Methods: Two melon genotypes named TAM-Uvalde (susceptible) and USDA PI 124104 (resistant) were grown and inoculated with M. cannonballus. The metabolites previously stated were measured before inoculation (0 hours) and 24, 48 and 72 hours after inoculation, using high performance liquid chromatography analysis. Results: The production of some amino acids during the interaction of the resistant and susceptible melon genotypes with the fungus M. cannonballus was different regarding quantities over time. Interestingly, hydroxy proline was always up-regulated in higher quantities in response to pathogen infection in the genotype TAM-Uvalde. Also, the up-regulation in higher quantities of gamma-aminobutyric acid in the genotype TAM-Uvalde 48 and 72 hours after inoculation, suggests more penetration of the pathogen in its roots. Hence, taken together, hydroxy proline and gamma-aminobutyric acid levels could be used as markers of susceptibility to vine decline disease caused by M. cannonballus, which could be useful in developing resistant varieties.

AMPA and GABAA receptor nanodomains assemble in the absence of synaptic neurotransmitter release.

Postsynaptic neurotransmitter receptors and their associated scaffolding proteins assemble into discrete, nanometer-scale subsynaptic domains (SSDs) within the postsynaptic membrane at both excitatory and inhibitory synapses. Intriguingly, postsynaptic receptor SSDs are mirrored by closely apposed presynaptic active zones. These trans-synaptic molecular assemblies are thought to be important for efficient neurotransmission because they concentrate postsynaptic receptors near sites of presynaptic neurotransmitter release. While previous studies have characterized the role of synaptic activity in sculpting the number, size, and distribution of postsynaptic SSDs at established synapses, it remains unknown whether neurotransmitter signaling is required for their initial assembly during synapse development. Here, we evaluated synaptic nano-architecture under conditions where presynaptic neurotransmitter release was blocked prior to, and throughout synaptogenesis with tetanus neurotoxin (TeNT). In agreement with previous work, neurotransmitter release was not required for the formation of excitatory or inhibitory synapses. The overall size of the postsynaptic specialization at both excitatory and inhibitory synapses was reduced at chronically silenced synapses. However, both AMPARs and GABAARs still coalesced into SSDs, along with their respective scaffold proteins. Presynaptic active zone assemblies, defined by RIM1, were smaller and more numerous at silenced synapses, but maintained alignment with postsynaptic AMPAR SSDs. Thus, basic features of synaptic nano-architecture, including assembly of receptors and scaffolds into trans-synaptically aligned structures, are intrinsic properties that can be further regulated by subsequent activity-dependent mechanisms.

Autophagy-associated immune dysregulation and hyperplasia in a patient with compound heterozygous mutations in ATG9A.

ABBREVIATIONS: BCL2: BCL2 apoptosis regulator; BCL10: BCL10 immune signaling adaptor; CARD11: caspase recruitment domain family member 11; CBM: CARD11-BCL10-MALT1; CR2: complement C3d receptor 2; EBNA: Epstein Barr nuclear antigen; EBV: Epstein-Barr virus; FCGR3A; Fc gamma receptor IIIa; GLILD: granulomatous-lymphocytic interstitial lung disease; HV: healthy volunteer; IKBKB/IKB kinase: inhibitor of nuclear factor kappa B kinase subunit beta; IL2RA: interleukin 2 receptor subunit alpha; MALT1: MALT1 paracaspase; MS4A1: membrane spanning 4-domain A1; MTOR: mechanistic target of rapamycin kinase; MYC: MYC proto-oncogene, bHLH: transcription factor; NCAM1: neural cell adhesion molecule 1; NFKB: nuclear factor kappa B; NIAID: National Institute of Allergy and Infectious Diseases; NK: natural killer; PTPRC: protein tyrosine phosphatase receptor type C; SELL: selectin L; PBMCs: peripheral blood mononuclear cells; TR: T cell receptor; Tregs: regulatory T cells; WT: wild-type.

Acute reorganization of postsynaptic GABAA receptors reveals the functional impact of molecular nanoarchitecture at inhibitory synapses.

Neurotransmitter receptors partition into nanometer-scale subdomains within the postsynaptic membrane that are precisely aligned with presynaptic neurotransmitter release sites. While spatial coordination between pre- and postsynaptic elements is observed at both excitatory and inhibitory synapses, the functional significance of this molecular architecture has been challenging to evaluate experimentally. Here we utilized an optogenetic clustering approach to acutely alter the nanoscale organization of the postsynaptic inhibitory scaffold gephyrin while monitoring synaptic function. Gephyrin clustering rapidly enlarged postsynaptic area, laterally displacing GABAA receptors from their normally precise apposition with presynaptic active zones. Receptor displacement was accompanied by decreased synaptic GABAA receptor currents even though presynaptic release probability and the overall abundance and function of synaptic GABAA receptors remained unperturbed. Thus, acutely repositioning neurotransmitter receptors within the postsynaptic membrane profoundly influences synaptic efficacy, establishing the functional importance of precision pre-/postsynaptic molecular coordination at inhibitory synapses.

Influence of extraction solvents on antioxidant activity and the content of bioactive compounds in non-pungent peppers.

Bioactive compounds in foods have been shown to maintain human health. However, the relative amounts of bioactive compounds and the variation in the amounts are still poorly understood. In this study, the efficacy of different extraction solvents (hexane, ethyl acetate, acetone, methanol, and a methanol:water mixture), as well as the levels of certain bioactive compounds in non-pungent pepper cultivars (TMH, TMJ, PA137, and B58) were investigated using high-performance liquid chromatography (HPLC). Antioxidant activities were determined using 2,2,-diphenyl-1-picrylhydrazyl (DPPH), reducing power, and deoxyribose degradation. Hexane extracts had the highest level of carotenoids (47.2-628.8 µg/g), and methanol extracts contained maximum flavonoids (24.9-152.2 µg/g) in four different cultivars. Higher DPPH scavenging activity was found in the hexane extracts from TMH, TMJ, PA137, and B58 (IC50 value: 0.67, 0.74, 0.55, and 0.48 µg/ml, respectively), whereas the reducing power was high in ethyl acetate and acetone extracts. Inhibition of deoxyribose degradation was highest in methanolic extracts from TMH, TMJ, PA137, and B58 (51.2, 49.5, 52.6, and 47.4 %, respectively). These data demonstrate that solvent chemical properties such as polarity can differentially impact the efficiency with which different bioactive compounds are recovered from foods, and this could lead to differences in estimated biological activity such as antioxidant capacity.

Separation of nordihydrocapsiate from capsiate and major capsaicinoid analogues using ultra high performance liquid chromatography.

Accurate, rapid quantitation of the capsaicinoid and capsinoid compounds produced by peppers (Capsicum spp.) is essential to assess quality. Here, we developed a rapid ultra-high performance liquid chromatography method for the simultaneous separation of five major capsaicinoids and three major capsinoids from peppers. Optimal chromatographic separation was achieved using a phenyl-hexyl stationary phase with a mobile phase of acidified water and methanol with a flow rate of 0.5 ml/min at a column temperature of 55 °C over 5 min. The method was validated by testing linearity, precision, robustness, and limits of detection and quantification. The developed method was successfully employed to profile capsaicinoids and capsinoids from different pepper cultivars. Out of the 10 pepper cultivars analysed, all three major capsinoids were detected in two cultivars. To the best of our knowledge, this is the first report of successful separation of nordihydrocapsiate from capsiate and quantification of nordihydrocapsiate.

Complementary Use of Super-Resolution Imaging Modalities to Study the Nanoscale Architecture of Inhibitory Synapses.

The nanoscale architecture of synapses has been investigated using multiple super-resolution methods, revealing a common modular structure for scaffolds, neurotransmitter receptors, and presynaptic proteins. This fundamental organization of proteins into subsynaptic domains (SSDs) is thought to be important for synaptic function and plasticity and common to many types of synapses. Using 3D super-resolution Structured Illumination Microscopy (3D-SIM), we recently showed that GABAergic inhibitory synapses exhibit this nanoscale organizational principle and are composed of SSDs of GABA A receptors (GABA A Rs), the inhibitory scaffold gephyrin, and the presynaptic active zone protein, RIM. Here, we have investigated the use of 3D-SIM and dSTORM to analyze the nanoscale architecture of the inhibitory synaptic adhesion molecule, neuroligin-2 (NL2). NL2 is a crucial mediator of inhibitory synapse formation and organization, associating with both GABA A Rs and gephyrin. However, the nanoscale sub-synaptic distribution NL2 remains unknown. We found that 3D-SIM and dSTORM provide complementary information regarding the distribution of NL2 at the inhibitory synapse, with NL2 forming nanoscale structures that have many similarities to gephyrin nanoscale architecture.

Data on inheritance of race 2 anthracnose resistance in watermelon (Citrullus spp.) biparental mapping populations.

Anthracnose of watermelon is caused by a fungal pathogen Colletotrichum orbiculare. We generated F2 individuals from three different populations: Population 1 (PI 189225 x 'New Hampshire Midget'), Population 2 ('Perola' x PI 189225), and Population 3 ('Verona' x PI 189225). The biparental F2 populations, parents and F1 individuals were inoculated with an isolate of race 2 anthracnose isolated from watermelon. Leaf lesions were visually rated seven days post inoculation on a scale of 0% (no lesion) to 100% (dead true leaf). Here we present the datasets obtained after the disease inoculation. The distribution of data obtained was visualized using histograms and goodness-of-fit was tested using Chi-Square. These datasets provide information on the mode of inheritance of race 2 anthracnose resistance in watermelon.