RESUMO
Objective: To explore the efficacy of chemotherapy re-challenge in the third-line setting for patients with metastatic colorectal cancer (mCRC) in the real world. Methods: The clinicopathological data, treatment information, recent treatment efficacy, adverse events and survival data of mCRC patients who had disease progression after treatment with oxaliplatin-based and/or irinotecan-based chemotherapy and received third-line chemotherapy re-challenge from January 2013 to December 2020 at Tianjin Medical University Cancer Institute and Hospital were retrospectively collected. Survival curves were plotted with the Kaplan-Meier method, and the Cox proportional hazard model was used to analyze the prognostic factors. Results: A total of 95 mCRC patients were included. Among them, 32 patients (33.7%) received chemotherapy alone and 63 patients (66.3%) received chemotherapy combined with targeted drugs. Eighty-three patients were treated with dual-drug chemotherapy (87.4%), including oxaliplatin re-challenge in 35 patients and irinotecan re-challenge in 48 patients. The remaining 12 patients were treated with triplet chemotherapy regimens (12.6%). Among them, as 5 patients had sequential application of oxaliplatin and irinotecan in front-line treatments, their third-line therapy re-challenged both oxaliplatin and irinotecan; 7 patients only had oxaliplatin prescription before, and these patients re-challenged oxaliplatin in the third-line treatment. The overall response rate (ORR) and disease control rate (DCR) reached 8.6% (8/93) and 61.3% (57/93), respectively. The median progression free survival (mPFS) and median overall survival (mOS) were 4.9 months and 13.0 months, respectively. The most common adverse events were leukopenia (34.7%) and neutropenia (34.7%), followed by gastrointestinal adverse reactions such as nausea (32.6%) and vomiting (31.6%). Grade 3-4 adverse events were mostly hematological toxicity. Cox multivariate analysis showed that gender (HR=1.609, 95% CI: 1.016-2.548) and the PFS of front-line treatments (HR=0.598, 95% CI: 0.378-0.947) were independent prognostic factors. Conclusion: The results suggested that it is safe and effective for mCRC patients to choose third-line chemotherapy re-challenge, especially for patients with a PFS of more than one year in front-line treatments.
Assuntos
Neoplasias do Colo , Neoplasias Colorretais , Neoplasias Retais , Humanos , Irinotecano/uso terapêutico , Oxaliplatina/uso terapêutico , Neoplasias Colorretais/patologia , Estudos Retrospectivos , Fluoruracila , Neoplasias do Colo/induzido quimicamente , Neoplasias Retais/tratamento farmacológico , Protocolos de Quimioterapia Combinada Antineoplásica/efeitos adversos , Camptotecina/efeitos adversosRESUMO
The study investigated the clinical value of fluorescence cholangiography using indocyanine green (ICG) in laparoscopic cholecystectomy (LC) and laparoscopic common bile duct exploration (LCBDE) in preventing bile duct injury (BDI) and detecting bile leakage. A total of 300 patients who underwent fluorescent navigation LC and LCBDE in the Second Department of General Surgery, Shengjing Hospital Affiliated to China Medical University from June 2020 to September 2022 were selected as the research objects for observation and analysis. There were 114 males and 186 females, and aged (50.7±14.0) years with the body mass index (BMI) of (23.6±1.6) kg/m². All 300 cases of fluorescence navigation surgery were successfully completed, of which 5 patients received fluorescence-guided LCBDE and primary suture. The results showed that the application of fluorescence cholangiography with ICG can effectively avoid and detect the occurrence of BDI and bile leakage. Meanwhile, it is reasonable to hypothesize that ICG can be used for rapid localization and the final check to prevent the recurrence of bile leakage when bile leakage is suspected in the second operation.
Assuntos
Doenças dos Ductos Biliares , Sistema Biliar , Colecistectomia Laparoscópica , Masculino , Feminino , Humanos , Bile , Colangiografia/métodos , Corantes , Verde de Indocianina , Colecistectomia Laparoscópica/métodosRESUMO
Identification of selection signature is important for a better understanding of genetic mechanisms that affect phenotypic differentiation in livestock. However, the genome-wide selection responses have not been investigated for the production traits of Chinese crossbred buffaloes. In this study, an SNP data set of 133 buffaloes (Chinese crossbred buffalo, n = 45; Chinese local swamp buffalo, n = 88) was collected from the Dryad Digital Repository database (https://datadryad.org/stash/). Population genetics analysis showed that these buffaloes were divided into the following 2 groups: crossbred buffalo and swamp buffalo. The crossbred group had higher genetic diversity than the swamp group. Using 3 complementary statistical methods (integrated haplotype score, cross population extended haplotype homozygosity, and composite likelihood ratio), a total of 31 candidate selection regions were identified in the Chinese crossbred population. Here, within these candidate regions, 25 genes were under the putative selection. Among them, several candidate genes were reported to be associated with production traits. In addition, we identified 13 selection regions that overlapped with bovine QTLs that were mainly involved in milk production and composition traits. These results can provide useful insights regarding the selection response for production traits of Chinese crossbred buffalo, as identified candidate genes influence production performance.
Assuntos
Búfalos , Locos de Características Quantitativas , Animais , Búfalos/genética , Bovinos/genética , China , Homozigoto , Fenótipo , Polimorfismo de Nucleotídeo Único/genética , Locos de Características Quantitativas/genéticaRESUMO
Vaccination is the most effective measure to prevent influenza. However, due to the existence of antigen drift and/or antigen shift of influenza virus, the vaccine strains often do not match the epidemic strains, so that the protection provided by influenza vaccine is still limited. With the rapid development of new vaccine technology, a kind of influenza vaccine with extensive protection or universal has attracted great attention. It can effectively induce humoral and cellular immunity against the conserved epitopes of influenza virus, provide good protection against various types/subtypes of influenza virus, and has a rapid production platform, which is the ideal goal for the development of a new generation of universal influenza vaccine. This article reviews the latest research progress of influenza universal vaccine.
Assuntos
Vacinas contra Influenza , Influenza Humana , Deriva e Deslocamento Antigênicos , Humanos , Influenza Humana/prevenção & controle , Pesquisa , TecnologiaRESUMO
The water buffalo is an important dual-purpose livestock that is widespread throughout central and southern China. However, there has been no characterization of the population genetics of Chinese buffalo. Using an Axiom buffalo genotyping array (Thermo Fisher Scientific, Wilmington, DE), we analyzed the genetic diversity, linkage disequilibrium pattern, and signature of selection in 176 Chinese buffaloes from 13 breeds. A total of 35,547 SNP passed quality control and were used for further analyses. Population genetic analysis revealed a clear separation between swamp and river types. Ten Chinese indigenous breeds were clustered into the swamp group, the Murrah and Nili-Ravi breeds were clustered into the river group, and the crossbred breed was closer to the river group. Genetic diversity analysis showed that the swamp group had a lower average expected heterozygosity. Linkage disequilibrium decay distance was much shorter in the swamp group compared with the river group, with an average square of correlation coefficient value of 0.2 of approximately 50 kb. Analysis of runs of homozygosity indicated extensive remote and recent inbreeding within swamp and river groups, respectively. Moreover, one genomic region under selection was detected between the river and swamp groups. Our findings contribute to our understanding of the characterization of population genetics in Chinese buffaloes, which in turn may be used in buffalo breeding programs.
Assuntos
Búfalos/genética , Variação Genética , Genoma , Animais , Cruzamento , China , Feminino , Genética Populacional , Genômica , Heterozigoto , Homozigoto , Endogamia , Desequilíbrio de Ligação , Leite , FenótipoRESUMO
Water buffalo (Bubalus bubalis) is an important livestock species in developing countries due to its contribution to meat, milk production, and a certain form of labor. However, the genetic potential of buffalo milk production traits has not been fully exploited. To date, 516 candidate genes associated with milk production traits of buffalo have been identified. The present study aimed to explore the possible molecular mechanisms underlying milk production traits of this species through functional genomics analysis of these candidate genes by using different bioinformatics tools. Gene ontology (GO) analysis indicated that these candidate genes were associated with complex biological processes, such as cell proliferation and mitotic nuclear division. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis demonstrated that these candidate genes were enriched in multiple signaling pathways, such as AMPK, ErbB, Toll-like receptor, and Jak-STAT. In addition, one function module consisting of 57 nodes and 139 edges were identified from the protein-protein interaction (PPI) network. GO analysis showed that the 57 candidate genes in this function module were enriched in three main biological processes, including homeostasis, metabolism, and cell response. These three distinct biological processes are well known for regulating mammary gland activities, which explained clearly the mechanism underlying milk production traits. This study provides a novel perspective for better understanding of the biological processes linked with milk production traits. This knowledge is conducive to the improvement of milk yield and composition of this species.
Assuntos
Búfalos/genética , Lactação/genética , Glândulas Mamárias Animais/metabolismo , Transdução de Sinais/genética , Animais , Búfalos/fisiologia , Biologia Computacional , Feminino , Ontologia Genética , Genômica , Leite/metabolismo , FenótipoRESUMO
Objective: To evaluate the incidence of deeply infiltrating endometriosis (DIE) among patients of pelvic endometriosis confirmed by pathology and to make analysis of its clinical and pathological characteristics. Methods: From January 1, 2018 to December 31, 2018, clinical data of 240 cases of pelvic endometriosis diagnosed by laparoscopy and pathology hospitalized in Peking University First Hospital were analyzed retrospectively for the characteristics of symptoms, pelvic examination and anatomic distribution of endometriosis foci. Results: (1) Among 240 cases of pelvic endometriosis, 94 were diagnosed with DIE with an incidence of 39.2% (94/240); of them the diagnosis were made preoperatively in 44 cases (46.8%, 44/94). (2) Compared with those without DIE, patients with DIE had higher rates of secondary dysmenorrhea [53.2% (50/94) versus 38.4% (56/146), P=0.033], anal pain [43.6% (41/94) versus 28.1% (41/146), P=0.013], dyspareunea [39.4% (37/94) versus 18.5% (27/146), P=0.001] and frequent bowel movement [33.0% (31/94) versus 15.8%(23/146), P=0.002]. (3) Patients with DIE had higher rates of bad movement of uterus [21.3% (20/94) versus 6.8% (10/146), P=0.001], painful nodularity on uterosacral ligaments [26.6% (25/94) versus 6.2% (9/146), P<0.01], painful nodularity of posterior fornix [19.1% (18/94) versus 4.8% (7/146), P<0.01], blue nodule in vaginal wall [6.4% (6/94) versus 0 (0/146), P=0.003] by pelvic examination compared with those without DIE. (4) Ninety-four patients with DIE had a total of 162 nodules, of those 88 (54.3%, 88/162) located in uterosacral ligaments, 14 (8.6%, 14/162) in the rectum, 7 (4.3%, 7/162) in vaginal wall, 6 (3.7%, 6/162) in ureter, 4 in bladder (2.5%, 4/162), 2 (1.2%, 2/162) in Douglas pouch. Forty-three DIE patients (45.7%, 43/94) had more than one nodules. Patients with DIE had concomitant ovarian endometriosis in 69 cases (73.4%, 69/94), with a total of 103 endometrial cysts. (5) Patients with DIE had a higher rate of obliterated Douglas pouch [76.6% (72/94) versus 19.2% (28/146), P<0.01]. Conclusions: More than one third of patients with pelvic endometriosis have concomitant DIE with a lower rate of preoperative diagnosis. Pelvic pains, bad movement of uterus and painful nodulirity around cervix suggest the presence of DIE.
Assuntos
Endometriose/patologia , Laparoscopia , Dor Pélvica/etiologia , Dismenorreia/epidemiologia , Endometriose/epidemiologia , Feminino , Humanos , Incidência , Estudos RetrospectivosRESUMO
Water buffalo (Bubalus bubalis) is of great economic importance as a provider of milk and meat in many countries. However, the milk yield of buffalo is much lower than that of Holstein cows. Selection of candidate genes related to milk production traits can be applied to improve buffalo milk performance. A systematic review of studies of these candidate genes will be greatly beneficial for researchers to timely and efficiently understand the research development of molecular markers for buffalo milk production traits. Here, we identified and classified the candidate genes associated with buffalo milk production traits. A total of 517 candidate genes have been identified as being associated with milk performance in different buffalo breeds. Nineteen candidate genes containing 47 mutation sites have been identified using the candidate gene approach. In addition, 499 candidate genes have been identified in six genome-wide association studies (GWASes) including two studies performed with the bovine SNP chip and four studies with the buffalo SNP chip. Genes CTNND2 (catenin delta 2), APOB (apolipoprotein B), FHIT (fragile histidine triad) and ESRRG (estrogen related receptor gamma) were identified in at least two GWASes. These four genes, especially APOB, deserve further study to explore regulatory roles in buffalo milk production. With growth in the number of buffalo genomic studies, more candidate genes associated with buffalo milk production traits will be identified. Therefore, future studies, such as those investigating gene location and functional analyses, are necessary to facilitate the exploitation of genetic potential and the improvement of buffalo milk performance.
Assuntos
Búfalos/genética , Leite , Animais , Búfalos/classificação , Búfalos/fisiologia , Cromossomos de Mamíferos , Estudo de Associação Genômica Ampla , Gado/classificação , Gado/genética , Gado/fisiologia , Leite/químicaRESUMO
This meta-analysis aimed to clarify the actual association between the phosphodiesterase type 5 inhibitors (PDE5-Is) use and the risk of melanoma in erectile dysfunction (ED) patients. A systematic literature search was conducted in online databases in October, 2016 to identify studies focusing on the association between PDE5-Is use and the risk of melanoma. Summarized multivariate adjusted risk ratios (RRs) and 95% confidence intervals (CIs) were calculated to assess the strength of associations. A total of six clinical trials containing more than one million participants were included. ED patients using PDE5-Is shared a significant high risk of melanoma (RR=1.12, 95% CI=1.03-1.21, p=0.006). Positive associations were observed in all kinds of prescriptions: single prescription (RR=1.20, 95% CI=1.06-1.35, p=0.003), medium number of prescription (RR=1.15, 95% CI=1.01-1.30, p=0.03), and high number of prescription (RR=1.18, 95% CI=1.05-1.34, P=0.006). Additionally, PDE5-Is were also found to be significantly associated with increased risk of basal cell carcinoma (RR=1.14, 95% CI=1.09-1.19, p<0.00001). Our study indicates that PDE5-Is use could significantly increase the risk of melanoma and basal cell carcinoma. However, the risk of melanoma did not rise significantly with the increased number of prescriptions. Consequently, owing to the lack of information about other potential synergistic factors, it is difficult for us to make a solid conclusion that application of PDE5-Is is the direct cause of increased risk of melanoma. Their relationship needs to be validated by further evidences.
Assuntos
Carcinoma Basocelular/induzido quimicamente , Disfunção Erétil/tratamento farmacológico , Melanoma/induzido quimicamente , Inibidores da Fosfodiesterase 5/efeitos adversos , Humanos , Masculino , Inibidores da Fosfodiesterase 5/uso terapêutico , Medição de RiscoRESUMO
The use of transition metal oxides and hydroxides in supercapacitors can yield high specific capacity electrodes. However, the effect of interaction between active material and current collector has remained unexplored. Here the behaviour of electrodeposited hexagonal cobalt hydroxide nanosheets on a variety of substrates was investigated, and the resulting valence bonding, morphological evolutions and phase transformations examined. It is shown that the electrochemical activity of the face centred cubic (FCC) Ni substrate dramatically decreases cyclability, the FCC Cu substrate also demonstrates decreased performance, and hexagonal carbon nanofibre (CNF) and Ti substrates exhibit far more stability. The miscellaneous roles of valence bonding, redox reactions and crystal structure mismatch between active material and current collector are examined, and their consequences discussed. Using the resulting insights into performance criteria, it was possible to select a suitable substrate for the fabrication of an asymmetric supercapacitor. The high performance and stability of the device demonstrates the usefulness of this approach, and the utility of applying these insights to energy storage devices.
RESUMO
The invasion of the muscularis propria is defined as T2 stage in esophageal squamous cell carcinoma. Evidence is lacking regarding whether the T2 substage based on anatomy may serve as a prognostic indicator. This study aims to confirm the prognostic value of the T2 substage. The clinicopathological characteristics of 120 patients who had pathologically verified T2 tumors between 2006 and 2011 at the Tianjin Medical University Cancer Institute and Hospital were retrospectively studied. Based on the invasion depth, tumors that had penetrated the circular muscle layer were defined as T2a, while T2b disease referred to those that had invaded the longitudinal muscle layer. Factors potentially related to survival were analyzed with univariate and multivariate analyses. The logistic regression model was used to examine the factors associated with lymph node metastasis. To verify the prognostic value of the T2 substage further, patients with T1b and T3 stage disease during the same period were selected for comparisons. The univariate and multivariate analyses demonstrated that the T2 substage and N stage were independent prognostic factors. The T2 substage was highly relevant to lymph node metastasis in the logistic regression model (P = 0.044). When T1b and T3 was considered, the survival of T2a patients was closer to that of T1b patients, while the survival of T2b patients was closer to that of T3 disease (P = 0.000). The T2 substage was an independent prognostic factor. Patients with T2a tumors displayed a favorable survival, while the prognosis of T2b patients was closer to that of T3 patients.
Assuntos
Carcinoma de Células Escamosas/mortalidade , Carcinoma de Células Escamosas/patologia , Neoplasias Esofágicas/mortalidade , Neoplasias Esofágicas/patologia , Mucosa/patologia , Adulto , Idoso , Intervalo Livre de Doença , Carcinoma de Células Escamosas do Esôfago , Feminino , Seguimentos , Humanos , Estimativa de Kaplan-Meier , Modelos Logísticos , Masculino , Pessoa de Meia-Idade , Análise Multivariada , Invasividade Neoplásica , Estadiamento de Neoplasias , Valor Preditivo dos Testes , Prognóstico , Estudos RetrospectivosRESUMO
AKT1, also known as v-akt murine thymoma viral oncogene homolog 1, is involved in the regulation of cell-survival and anti-apoptotic activities, which may affect the pathogenesis of various cancers. However, the association between genetic variants of AKT1 and the risk of developing prostate cancer has not been investigated before. This study investigated the associations between three polymorphisms (rs1130214, rs3730358, and rs2494732) in AKT1 and the risk of development of prostate cancer in the Chinese Han population. Sequenom MassARRAY & iPLEX technology were used to genotype these polymorphisms in 493 Chinese Han patients with prostate cancer and 309 age-matched healthy individuals. Compared to the CC genotype of the rs3730358 polymorphism, the CT genotype of the same polymorphism was strongly associated with a decreased risk of prostate cancer (OR = 0.617, 95%CI = 0.390-0.976, P = 0.037). However, there was no significant difference between the allele frequency of the rs3730358 polymorphism and those of the other two polymorphisms (P > 0.05). Moreover, no significant difference was found in the haplotype analysis (P > 0.05). Our study found that the variant genotype CT of rs3730358 of AKT1 was associated with a decreased risk of prostate cancer, which suggested that this polymorphism could play an important role in the development of the disease.
Assuntos
Neoplasias da Próstata/genética , Proteínas Proto-Oncogênicas c-akt/genética , Idoso , Idoso de 80 Anos ou mais , Alelos , Povo Asiático/genética , Estudos de Casos e Controles , Etnicidade/genética , Frequência do Gene , Predisposição Genética para Doença , Variação Genética , Haplótipos , Humanos , Masculino , Pessoa de Meia-Idade , Polimorfismo de Nucleotídeo Único , Neoplasias da Próstata/enzimologia , Neoplasias da Próstata/metabolismo , Proteínas Proto-Oncogênicas c-akt/metabolismoRESUMO
Objective: To determine the contribution of follow-up formula (FUF) to the nutrient intake of 7-24-month-old infants and young children. Methods: The cluster random sampling method and the convenience sampling method were used in combination, and geographic and economic factors were taken into consideration. Four areas of China (Beijing, Hebei, Guangxi, Guangdong) were selected, with 120 infants chosen from each of these areas (half of which were 7-12 months old, and half were 13-24 months old). A dietary survey was completed by a continuous 24-hour weighing method over two days. Questionnaires were completed by their caregivers which included weighing the FUF and supplementary food given to the infant, and recording the frequency of breast feeding and any supplementary nutrients. A total of 518 questionnaires were distributed, and 472 questionnaires qualified for inclusion. Nutrient intake was calculated using the China food composition, infant formula food nutrient content and infant nutrition supplement brand-label information databases, and then the nutrient intake proportion (the percentage of estimated energy requirement (EER%), recommended nutrient intake (RNI%) or adequate intake (AI%)), and the contribution rate of FUF were analyzed. Results: A total of 472 infants were investigated (227 infants aged 7-12 months old, 245 infants aged 13-24 months old). The findings revealed that the median energy intake of 7- 12-month-old and 13- 24-month-old infants were 2 530.08 kJ and 3 445.48 kJ, respectively, which accounted for 85.18% and 94.14% of EER, respectively; and the median intake of protein reached 91.50% and 105.88% of their RNI/AI, respectively. For micronutrients, the median intake of vitamin B1, vitamin B2, niacin, vitamin E, potassium, zinc and manganese in 7- 12-month-old infants and vitamin B2, vitamin E, potassium, magnesium, iron and manganese in 13-24-month-old children accounted for 82.00% and 114.29% of RNI/AI (RNI%/AI%), respectively. The intake of vitamin B6, iron and selenium in 7-12-month-old infants and vitamin B1, vitamin B6, vitamin C, calcium and selenium in 13-24-month-old children was less than 80% RNI/AI. Furthermore, some nutrients showed higher intake levels, such as vitamin A, calcium, phosphorus and magnesium in 7-12-month-old infants and vitamin A and phosphorus in 13-24-month-old children, which were higher than 130% RNI/AI. In total, 40.53% (92) of infants aged 7-12 months and 52.65% (129) of children aged 13- 24 months were fed FUF as part of their diet, and its contribution rate to macronutrients was 29.69% for carbohydrates and 51.77% for fats, and to micronutrients was 2.04% for manganese and 74.24% for vitamin C. Conclusion: FUF contributes to the nutrient intake of infants and young children aged from 7-24 months old at different rates depending on the macronutrient or micronutrient analyzed.
Assuntos
Inquéritos sobre Dietas , Ingestão de Energia , Comportamento Alimentar , Fórmulas Infantis , Pequim , Pré-Escolar , China , Dieta , Suplementos Nutricionais , Feminino , Seguimentos , Humanos , Lactente , Fenômenos Fisiológicos da Nutrição do Lactente , Masculino , Micronutrientes/administração & dosagem , Necessidades NutricionaisRESUMO
Melanocortin-4 receptor (MC4R) is associated with feed intake, growth, fatness, and carcass composition in many domestic animals. The aim of this study was to evaluate the association of single nucleotide polymorphisms (SNPs) in MC4R with milk production traits in water buffalo. Eight SNPs were identified by direct polymerase chain reaction sequencing of samples from 18 buffaloes. SNPs were then genotyped using the matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) method in 332 buffaloes. Two of eight SNPs were not in Hardy-Weinberg equilibrium. Based on the SNP data, seven haplotypes were constructed. Three SNPs H1 (AGT), H2 (GAT), and H3 (GAC) accounted for 93.0% of the total individuals. Statistical analysis indicated that the SNP g.1104C>T was significantly associated with milk yield, protein, and fat percentage (P < 0.05). In conclusion, these results provide evidence that polymorphisms in the buffalo MC4R gene are associated with milk production traits and might be potential biomarkers for water buffalo breeding.
Assuntos
Búfalos/fisiologia , Lactação/genética , Glândulas Mamárias Animais/fisiologia , Leite , Receptor Tipo 4 de Melanocortina/genética , Animais , Biomarcadores/análise , Cruzamento , Búfalos/genética , Búfalos/metabolismo , Feminino , Genótipo , Haplótipos , Glândulas Mamárias Animais/metabolismo , Fenótipo , Polimorfismo de Nucleotídeo Único/genética , Receptor Tipo 4 de Melanocortina/metabolismoRESUMO
OBJECTIVE: To evaluate the effect of CD40 on Foxp3(+) Treg cell in the lung of cigarette smoke exposure mice. METHODS: According to the random number table, 20 wild type (WT) C57 BL/6 mice and 20 CD40(-/-)C57 BL/6 mice were randomly divided into two groups: WT control group, WT smoke-exposure group (24 weeks) and CD40(-/-) control group, CD40(-/-) smoke-exposure group (24 weeks) (n=10 each). Alveolar airspace enlargement was observed by HE staining. Morphological change was evaluated by mean linear intercepts (MLI). Immunohistochemical method was used to detect the quantity of Foxp3(+) cell in the lung. The mRNA expression of Foxp3 was measured by fluorescence quantitative real-time polymerase chain reaction (qRT-PCR). The protein level of Foxp3 was measured by Western blot. Interleukin (IL)-10 and IL-35 levels in the lung were tested by enzyme-linked immunosorbent assay (ELISA). RESULTS: The MLI in CD40(-/-) smoke-exposure group was significantly lower than the WT smoke-exposure group[(30.0±1.7) vs (37.3±3.7) µm], but higher than the CD40(-/-) control group[(23.2±2.5) µm], WT smoke-exposure group was significantly higher than the WT control group[(22.2±1.7) µm](all P<0.05). The percentage of Foxp3(+) cell in the lungs of CD40(-/-) smoke-exposure group was significantly higher than the WT smoke-exposure group and CD40(-/-) control group[(16.89±0.75)% vs (9.65±0.74)% and (13.58±0.51)%], WT smoke-exposure group was significantly lower than WT control group[(12.13±0.81)%](all P<0.05). In the lungs, Foxp3 mRNA and protein expression in CD40(-/-) smoke-exposure group were increased compared to WT-smoke-exposure group and CD40(-/-) control group, WT smoke-exposure group were decreased compared to WT control group (all P<0.05). In the lungs, the level of IL-10 in CD40(-/-) smoke-exposure group was higher than the WT smoke-exposure group and CD40(-/-) control group[(231±25) vs (80±31) and (183±29) ng/L], WT smoke-exposure group was lower than the WT control group[(192±37) ng/L](all P<0.05). The level of IL-35 in CD40(-/-) smoke-exposure group was higher than the CD40(-/-) control group, WT control group and WT smoke-exposure group[(208±29) vs (118±29) , (148±36), (137±37) ng/L, all P<0.05]. CONCLUSION: Knockout the CD40 gene can promote the differentiation of Foxp3(+) Treg cell in the lung of cigarette smoke exposure mice, indicating that blocking the CD40-CD40 ligand pathway may contribute to alleviate the smoking-induced pulmonary emphysema.
Assuntos
Antígenos CD40 , Fatores de Transcrição Forkhead/genética , Enfisema Pulmonar/imunologia , Linfócitos T Reguladores , Poluição por Fumaça de Tabaco/efeitos adversos , Animais , Diferenciação Celular , Ensaio de Imunoadsorção Enzimática , Fatores de Transcrição Forkhead/metabolismo , Interleucina-10/sangue , Interleucina-10/metabolismo , Pulmão/fisiopatologia , Camundongos , Camundongos Knockout , Enfisema Pulmonar/induzido quimicamente , Enfisema Pulmonar/patologia , Distribuição Aleatória , Reação em Cadeia da Polimerase em Tempo Real , Fumaça , Fumar/efeitos adversos , NicotianaRESUMO
OBJECTIVE: To explore the effect of CD40 knock out on the cytotoxic function of CD8(+) T cell of mice with cigarette smoke-induced emphysema. METHODS: A total of 40 male C57 mice were divided into four groups according to the random number table, including CD40(+ /+) control group, CD40(+ /+) smoke-exposure group, CD40(-/-)control group, CD40(-/-)smoke-exposure group. The smoke-exposure groups were exposed to cigarette smoke for 24 weeks to establish emphysema model. Morphological changes were evaluated by linear intercepts. The percentages of CD8, perforin, granzyme B positive cells were evaluated by immunohistochemistry. The mRNA expressions of perforin, granzyme B, interleukin (IL) -27 were measured by fluorescent real time quantitative polymerase chain reaction (RT-PCR). The IL-27 cytokine level was tested by enzyme-linked immunosorbent assay (ELISA). RESULTS: The mean linear intercepts in CD40(+ /+) smoke-exposure group was significantly higher than CD40(+ /+) control group, CD40(-/-)control group, and CD40(-/-)smoke-exposure group [(37.2±3.6) vs (24.0±3.4), (22.5±2.4), (29.9±1.7) µm] (all P<0.05). CD40(-/-)smoke-exposure group was higher than CD40(+ /+) control group, CD40(-/-)control group (all P<0.05). The percentages of CD8 positive, perforin positive and granzyme B positive cells in CD40(+ /+) smoke-exposure group [(16.3±2.3)%, (11.4±2.1)%, (10.7±1.9)%] were significantly higher than CD40(+ /+) control group [(8.3±1.6)%, (5.1±1.2)%, (4.6±1.0)%], CD40(-/-)control group [ (6.4±1.5)%, (4.3±1.0)%, (4.2±1.0)%] and CD40(-/-)smoke-exposure group [(8.6±1.7)%, (5.6±1.3)%, (5.5±1.3)%] (all P<0.05). RT-PCR results showed that the mRNA expressions of perforin, granzyme B and IL-27 in CD40(+ /+) smoke-exposure group [(20.3±7.3), (18.3±12.3), (2.2±0.7)] were significantly higher than CD40(+ /+) control group [(9.4±4.8), (10.6±3.8), (1.3±0.6)], CD40(-/-)control group [ (8.1±3.1), (7.7±3.5), (1.1±0.5)] and CD40(-/-)smoke-exposure group [(12.9±6.2), (10.4±4.6), (1.5±0.4)] (all P<0.05). ELISA results showed that the level of IL-27 in CD40(+ /+) smoke-exposure group was significantly higher than CD40(+ /+) control group, CD40(-/-)control group and CD40(-/-)smoke-exposure group [(3 242±754) vs (1 627±710), (1 600±680), (1 850±583) ng/L] (all P<0.05). CONCLUSION: Knockout the CD40 gene can inhibit the cytotoxic effector function in CD8(+) T cells of mice with cigarette smoke-induced emphysema, and alleviate the degree of emphysema.
Assuntos
Antígenos CD40 , Linfócitos T CD8-Positivos/metabolismo , Enfisema Pulmonar/metabolismo , Fumaça/efeitos adversos , Fumar/efeitos adversos , Animais , Citocinas , Modelos Animais de Doenças , Enfisema , Ensaio de Imunoadsorção Enzimática , Granzimas , Interleucinas , Pulmão/fisiopatologia , Masculino , Camundongos , Camundongos Knockout , Enfisema Pulmonar/induzido quimicamente , RNA Mensageiro , NicotianaRESUMO
Cassia fistula, a member of the Fabaceae, known as the golden shower tree, is native to South Asia. It is now distributed worldwide and is popular as an ornamental plant as well as being used in herbal medicine. In October 2013, symptoms of stem canker were observed on C. fistula in a nursery (108°38' E, 22°87' N) in Nanning, Guangxi, China. The symptoms began as small brown lesions, which enlarged over several months to long, striped, slightly sunken lesions, 1 to 9 cm in width and 16 to 135 cm in length. The conspicuous cankers had vertical cracks outlining the canker and evenly spaced horizontal cracks, eventually resulting in whole plants dying back. The cankers were found on 90% of six-year-old plants in this nursery and were also observed in other plantings. On potato dextrose agar (PDA), isolates with similar morphological characteristics were consistently recovered from symptomatic plant tissues after surface sterilization in 75% ethanol for 30 sec and then in 0.1% mercuric chloride for 2 min. Over 100 conidia were examined from three isolates and were found to be elliptical and hyaline when immature, becoming dark brown, one-septate, and longitudinally striate when mature and ranging from 20 to 31 × 11 to 16 µm (average 25.5 × 13.6 µm). The rDNA internal transcribed spacer (ITS) region of isolate LC-1 was sequenced (GenBank Accession No. KM387285), and it showed 100% identity to Lasiodiplodia theobromae (Pat.) Griffon & Maubl. (GenBank KC964548), confirming the morphological identification (2) as L. theobromae (also known as Botryosphaeria rhodina (Cooke) Arx). A culture of this isolate has been preserved in the Guangxi Academy of Agricultural Sciences fungal collection. The pathogenicity of the isolate was tested on healthy twigs and branches of C. fistula trees in a field setting at Guangxi Agricultural Vocational-Technical College, Nanning, Guangxi, in June and August 2014. For each treatment, five green twigs and five 2-year-old branches were used. Five adjacent needle punctures were made on each branch with a sterilized needle. A mycelial plug was then placed on the wound of each branch and wrapped with Parafilm. Control twigs were treated with sterile PDA plugs. One week later, typical lesions were observed on the inoculated branches, with symptoms becoming more extensive after two weeks, but no symptoms were seen on the controls. Koch's postulates were fulfilled by re-isolation of L. theobromae from diseased branches. L. theobromae is recognized as an important wood pathogen and has been reported to cause cankers, dieback, and fruit and root rots in over 500 different hosts, including perennial fruit and nut trees, vegetable crops, and ornamental plants (2). The fungus has been reported on C. fistula in India since the 1970s (1); however, to our knowledge, this is the first report of L. theobromae infecting C. fistula in China. References: (1) R. S. Mathur. The Coelomycetes of India. Bishen Singh Mahendra Pal Singh, Delhi, India, 1979. (2) J. R. Úrbez-Torres et al. Plant Dis. 92:519, 2008.
RESUMO
The therapeutic potential of pectic polysaccharides extracted from Rauvolfia verticillata (Lour.) Baill. var. hainanensis Tsiang in ulcerative colitis were investigated. This study showed that pectic polysaccharides extracted from Rauvolfia verticillata (Lour.) Baill. var. hainanensis Tsiang ameliorated ulcerative colitis and were proposed to exhibit anti-inflammatory effects via increased expression of IκB-α proteins and suppressing NF-αB translocation.
Assuntos
Colite Ulcerativa/tratamento farmacológico , Proteínas I-kappa B/biossíntese , Pectinas/farmacologia , Polissacarídeos/farmacologia , Rauwolfia/química , Animais , Colite Ulcerativa/patologia , Colo/patologia , Feminino , Camundongos , Camundongos Endogâmicos BALB C , Pectinas/química , Pectinas/uso terapêutico , Polissacarídeos/química , Polissacarídeos/uso terapêuticoRESUMO
BACKGROUND: Syndecan-1 (Sdc-1) shedding induced by matrix metalloproteinase-7 (MMP-7) and additional proteases has an important role in cancer development. However, the impact of Sdc-1 shedding on chemotherapeutic resistance has not been reported. METHODS: We examined Sdc-1 shedding in colorectal cancer by enzyme-linked immunosorbent assay (ELISA), Dot blot, reverse transcription-PCR (RT-PCR), immunohistochemistry and so on, its impact on chemotherapeutic sensitivity by collagen gel droplet embedded culture-drug sensitivity test (CD-DST) and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide), and potential mechanisms of action by Dot blot, western blot and immunofluorescence. RESULTS: Sdc-1 shedding was increased in colorectal cancer patients, Sdc-1 serum levels in postoperative patients were lower than in preoperative patients, but still higher than those observed in healthy adults. Patients with high preoperative Sdc-1 serum levels were less responsive to 5-Fluorouracil, Oxaliplatin, Irintecan, Cisplatin or Paclitaxel chemotherapy. Moreover, the disease-free survival of patients with high preoperative Sdc-1 serum levels was significantly poorer. The possible mechanism of chemotherapy resistance in colorectal cancer can be attributed to Sdc-1 shedding, which enhances EGFR phosphorylation and downstream signalling. CONCLUSIONS: Shed Sdc-1 is involved in chemotherapy resistance via the EGFR pathway in colorectal cancer, and Sdc-1 serum levels could be a new prognostic marker in colorectal cancer.
Assuntos
Protocolos de Quimioterapia Combinada Antineoplásica/farmacologia , Neoplasias Colorretais/metabolismo , Resistencia a Medicamentos Antineoplásicos , Receptores ErbB/metabolismo , Sindecana-1/metabolismo , Idoso , Apoptose/efeitos dos fármacos , Biomarcadores Tumorais/metabolismo , Western Blotting , Camptotecina/administração & dosagem , Camptotecina/análogos & derivados , Estudos de Casos e Controles , Proliferação de Células/efeitos dos fármacos , Cisplatino/administração & dosagem , Neoplasias Colorretais/tratamento farmacológico , Neoplasias Colorretais/patologia , Feminino , Citometria de Fluxo , Imunofluorescência , Fluoruracila/administração & dosagem , Humanos , Técnicas Imunoenzimáticas , Irinotecano , Masculino , Metaloproteinase 7 da Matriz/metabolismo , Gradação de Tumores , Invasividade Neoplásica , Estadiamento de Neoplasias , Compostos Organoplatínicos/administração & dosagem , Oxaliplatina , Paclitaxel/administração & dosagem , RNA Mensageiro/genética , RNA Interferente Pequeno/genética , Reação em Cadeia da Polimerase em Tempo Real , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Sindecana-1/antagonistas & inibidores , Sindecana-1/genética , Células Tumorais CultivadasRESUMO
Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) 'Tainung No. 1' is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5'TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3'/5'CGCAGTTT CTGGAGGATATTAAG3'/5'TCGCATGCCACTTCCTCAGT3') were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia. References: (1) X. Ma et al. J. Phytopathol. 152:215. (2) X. Wang et al. Virus Genes 29:303. (3) C. Wu et al. J. Virol. Methods 147:355.