A novel tenuivirus infecting wheat in Brazil.

Since 1948, pale yellow wheat spike have been reported in southern Brazil. This symptom was associated with tenuiviruses due to the observation of cytoplasmic inclusions constituted by a mass of filamentous particles (7-10 nm in diameter) with indeterminate length, identical to those found in "leaf dip" preparations. Such symptoms are still seen in wheat crops; however, there is a lack of information regarding this pathosystem. Decades after the first report, the first sequences of wheat white spike virus were characterized. Wheat plants with symptoms such as pale yellowing, chlorotic streaks, and leaf mosaic were collected in Paraná State, Southern Brazil. High-throughput sequencing was used to determine the nearly complete nucleotide sequence of the viral genome. The genome is composed of five RNAs with a total size of 18,129 nucleotides, with eight open reading frames (ORFs). The virus identified in this study can be included in a new species in the family Phenuiviridae, genus Tenuivirus, and we have tentatively named this virus "wheat white spike virus".

Molecular characterization and sequence analysis of four Brazilian rice stripe necrosis virus isolates.

Rice (Oryza sativa L.) is an important food crop for humanity, being cultivated in tropical and temperate regions of the world. This study reports the nearly complete genome sequences of four Brazilian rice stripe necrosis virus (RSNV) isolates. The nucleotide sequences of the RNA1 and RNA2 genome segments of these Brazilian isolates were 96.5 to 99.9% identical, indicating their close phylogenetic relationship to each other. Phylogeny and recombination analysis indicated that the genome of one of the isolates consisted of RNA segments of different origins, suggesting that a reassortment event had occurred.

First report of grapevine associated jivivirus 1 infecting grapevines in Brazil.

Grapevines can host up to 86 virus species, some of which affect plant vigor, production and fruit quality (Fuchs, 2020). In 2014, a Vitis vinifera cv. Semillon vine showing yellow speckles and mild leafroll symptoms in Bento Gonçalves, RS, Brazil, was investigated for viruses (Silva et al., 2017), resulting in the detection of grapevine enamovirus 1, grapevine yellow speckle viroid 1 and hop stunt viroid. Total nucleic acids (TNA) extracts from this sample were enriched for dsRNA (Valverde et al., 1990), prepped with TruSeq Stranded mRNA kit (Illumina, USA), then subjected to high throughput sequencing (HTS) on the Illumina HiSeq 2000 platform. The HTS yielded 13,214 Mbp raw reads, which were trimmed and the host derived sequences subtracted with Trimmomatic and Burrows-Wheeler Aligner softwares, respectively. The remaining reads were subjected to taxonomic assignment with the Kaiju webserver, preliminarily indicating 26 reads related to citrus virga-like virus (Matsumura et al., 2017). De novo assembled contigs built by SPAdes generated five contigs that were subjected to tBLASTx searches against the NCBI viral RefSeq. Four sets of primers were designed to sequence the gaps between these contigs and the PCR amplicons were sequenced by Sanger method resulting in two long contigs. A third long contig related to citrus jingmen-like virus (Matsumura et al., 2017) was also retained for further analysis. BLASTn analyses of the assembled virus contigs showed that they are closely related to grapevine associated jivivirus 1 (GaJV-1) (Chiapello et al, 2020). The derived partial tripartite genomic sequences of GaJV-1 isolate SEM-BR from Brazil (GenBank acc. nos. MT657278-MT657280) covered 84.4% (3424 nt), 40.3% (1289 nt) and 73% (1555 nt) of RNAs 1, 2 and 3 of isolate DMG 109 from Italy (MN520745-MN520747), respectively. The pairwise nt sequence identities between both isolates were 99.3% (RNA1), 97.1% (RNA2) and 100% (RNA3), indicating that they are highly identical to each other. To confirm the HTS results, fresh TNA extracts from SEM-BR and four newly sampled vines were screened by RT-PCR using specific primers F (5'GGACGAAGTCACAACCAACACAGTTT3') and R (5'CGCGAGTAGGTCTGACAACTTTCATTAT3'), designed based on GaJV-1 RNA1. The resulting 478 bp amplicons were sequenced (MT657281-MT657285) and found to share 99.4%-99.8% nt identities with the corresponding sequences of GaJV-1 SEM-BR (MT657278). To assess graft-transmissibility of GaJV-1, Semillon scions of SEM-BR source vine were grafted onto 14 GaJV-1-free 1103P rootstocks. Six of 14 recipient plants (all asymptomatic) tested positive for GaJV-1 by RT-PCR 106 days after grafting. Additionally, RT-PCR screening of a Brazilian grapevine collection block resulted in the detection of GaJV-1 in nine of 33 tested vines of different accessions (27.3%). The GaJV-1 positive vines included eight commercial cultivars (Ancelotta, Aragonez, Merlot, Semillon, Michele Palieri, Malvasia, Viognier, and Pinot Nero). This is the first report of GaJV-1 in Brazil, a virus that was recently described in Italy and Spain (Chiapello et al, 2020). Our results also demonstrated the graft-transmissible nature of the virus but it is unclear if GaJV-1 is associated to grapevine plant cells or strictly to a possible grapevine fungal endophyte. Additional studies on the GaJV-1 prevalence in commercial vineyards in Brazil and possible effects of the virus on grapevines are necessary. References: Chiapello, M., et al. 2020. Annals of Applied Biology 176:180. https://doi.org/10.1111/aab.12563 Fuchs, M. 2020. J. Plant Pathol. https://doi.org/10.1007/s42161-020-00579-2 Matsumura, E.E., et al. 2017. Viruses 9:92. https://doi.org/10.3390/v9040092 Silva, J.M.F., et al. 2017. Virus Genes 53:667. https://doi.org/10.1007/s11262-017-1470-y Valverde, R.A., et al. 1990. Plant Dis. 74:255. https://www.apsnet.org/publications/plantdisease/backissues/Documents/1990Articles/PlantDisease74n03_255.PDF.

Discovery and molecular characterization of a novel enamovirus, Grapevine enamovirus-1.

In this study, we describe a novel putative Enamovirus member, Grapevine enamovirus-1 (GEV-1), discovered by high-throughput sequencing (HTS). A limited survey using HTS of 17 grapevines (Vitis spp.) from the south, southeast, and northeast regions of Brazil led to the detection of GEV-1 exclusively on southern plants, infecting four grapevine cultivars (Cabernet Sauvignon, Semillon, CG 90450, and Cabernet franc) with a remarkable identity of around 99% at the nucleotide level. This novel virus was only detected in multiple-virus infected plants exhibiting viral-like symptoms. GEV-1 was also detected on a cv. Malvasia Longa by RT-PCR. We performed graft-transmissibility assays on GEV-1. The organization, products, and cis-acting regulatory elements of GEV-1 genome are also discussed here. The near complete genome sequence of GEV-1 was obtained during the course of this study, lacking only part of the 3' untranslated terminal region. This is the first report of a virus in the family Luteoviridae infecting grapevines. Based on its genomic properties and phylogenetic analyses, GEV-1 should be classified as a new member of the genus Enamovirus.

Molecular Characterization of the Coat Protein Gene of Greek Apple Stem Pitting Virus Isolates: Evolution through Deletions, Insertions, and Recombination Events.

A RT-PCR assay developed to amplify the full coat protein (CP) gene of apple stem pitting virus (ASPV) was evaluated using 180 Greek apple and pear samples and showed a broad detection range. This method was used to investigate the presence of ASPV in quince in Greece and showed a high incidence of 52%. The sequences of 14 isolates from various hosts with a distinct RFLP profile were determined. ASPV population genetics and the factors driving ASPV evolution were analyzed using the Greek ASPV sequences, novel sequences from Brazilian apple trees and Chinese botanical Pyrus species, and homologous sequences retrieved from GenBank. Fourteen variant types of Greek, Brazilian and botanical isolates, which differ in CP gene length and presence of indels, were identified. In addition, these analyses showed high intra- and inter-group variation among isolates from different countries and hosts, indicating the significant variability present in ASPV. Recombination events were detected in four isolates originating from Greek pear and quince and two from Brazilian apples. In a phylogenetic analysis, there was a tendency for isolates to cluster together based on CP gene length, the isolation host, and the detection method applied. Although there was no strict clustering based on geographical origin, most isolates from a given country tended to regroup in specific clusters. Interestingly, it was found that the phylogeny was correlated to the type, position, and pattern of indels, which represent hallmarks of specific lineages and indicate their possible role in virus diversification, rather than the CP size itself. Evidence of recombination between isolates from botanical and cultivated species and the clustering of isolates from botanical species and isolates from cultivated species suggest the existence of a possible undetermined transmission mechanism allowing the exchange of ASPV isolates between the cultivated and wild/ornamental hosts.

Near-complete genome sequence and seed transmission evaluation of Physalis rugose mosaic virus from southern Brazil / Sequência do genoma completo e avaliação da transmissão por sementes do Physalis rugose mosaic virus no sul do Brasil

ABSTRACT: Physalis rugose mosaic virus (PhyRMV) causes severe damage to Physalis peruviana L., affecting vegetative parameters, fruit quantity and quality. The aim of this study was to perform a molecular characterization of PhyRMV associated with P. peruviana from commercial fields in the municipality of Lages, Santa Catarina State, Southern Brazil, and to evaluate its transmission by seeds. Plants displaying mosaic, dwarfism, and leaf malformation symptoms were collected from P. peruviana. Double-stranded RNA was extracted and submitted to cDNA library synthesis and high-throughput sequencing (HTS). For the virus transmission assay, seeds from PhyRMV-infected plants were used, and viral infection in seedlings was verified using symptomatic and molecular diagnosis. PhyRMV RNA has 4162 nucleotides (nts) and a genomic organization similar to that of other sobemoviruses and shares 97% nt identity with the previously characterized PhyRMV Piracicaba isolate. Results indicated the unlikely transmission of PhyRMV by physalis seeds.

RESUMO: Physalis rugose mosaic virus (PhyRMV) causa danos severos em Physalis peruviana L., afetando características vegetativas, a quantidade e qualidade de frutos. Os objetivos desse estudo consistem na caracterização molecular do PhyRMV associado a P. peruviana coletada em campos de produção em Lages, Santa Catarina, Brasil; e avaliar a transmissão do vírus por sementes. Plantas apresentando sintomas de mosaico, deformação e nanismo foram coletadas de P. peruviana. Amostras foliares dessas plantas foram utilizadas para extração de RNA de fita dupla, síntese de biblioteca de cDNA e sequenciamento de alto rendimento. No experimento de transmissão, sementes obtidas de plantas infectadas por PhyRMV foram utilizadas, e a infecção viral nas plântulas foi avaliada por inspeção visual de sintomas e diagnóstico molecular. O RNA viral apresentou 4162 nucleotideos (nts), a organização genômica foi similar à de outros sobemovírus e apresentou 97% de identidade de nucleotídeos com o isolado de Piracicaba de PhyRMV previamente caracterizado. Os resultados obtidos sugerem que é improvável a transmissão de PhyRMV por sementes de physalis.

A novel, highly divergent ssDNA virus identified in Brazil infecting apple, pear and grapevine.

Fruit trees of temperate and tropical climates are of great economical importance worldwide and several viruses have been reported affecting their productivity and longevity. Fruit trees of different Brazilian regions displaying virus-like symptoms were evaluated for infection by circular DNA viruses. Seventy-four fruit trees were sampled and a novel, highly divergent, monopartite circular ssDNA virus was cloned from apple, pear and grapevine trees. Forty-five complete viral genomes were sequenced, with a size of approx. 3.4 kb and organized into five ORFs. Deduced amino acid sequences showed identities in the range of 38% with unclassified circular ssDNA viruses, nanoviruses and alphasatellites (putative Replication-associated protein, Rep), and begomo-, curto- and mastreviruses (putative coat protein, CP, and movement protein, MP). A large intergenic region contains a short palindromic sequence capable of forming a hairpin-like structure with the loop sequence TAGTATTAC, identical to the conserved nonanucleotide of circoviruses, nanoviruses and alphasatellites. Recombination events were not detected and phylogenetic analysis showed a relationship with circo-, nano- and geminiviruses. PCR confirmed the presence of this novel ssDNA virus in field plants. Infectivity tests using the cloned viral genome confirmed its ability to infect apple and pear tree seedlings, but not Nicotiana benthamiana. The name "Temperate fruit decay-associated virus" (TFDaV) is proposed for this novel virus.

Absolute quantification of viruses by TaqMan real-time RT-PCR in grapevines / Quantificação absoluta de vírus por RT-PCR em tempo real (TaqMan) em videiras

ABSTRACT: The absolute quantification determines the absolute amount of a targeted nucleic acid expressed as a copy number or concentration. The knowledge of virus concentrations in commercial crops possesses high relevance to ensure a reliable diagnosis. The objective of this study was to perform an absolute quantification of five viruses in infected grapevines (Vitis spp.). Different known amounts of the standard sample (cloned viral cDNA or in vitro transcribed viral RNA) were quantified by TaqMan RT-qPCR. Based on these data, standard curves were generated plotting Ct values (threshold cycle) against the log of the standard sample amount. Infected grapevine samples were evaluated to determine virus titers, which were highly variable. This result may contribute to improve virus diagnosis by accurately quantifying virus titre variations in grapevines.

RESUMO: A quantificação absoluta determina a quantidade absoluta de um ácido nucleico alvo expressa como número de cópias ou concentração. O conhecimento das concentrações virais em culturas comerciais tem grande relevância para assegurar um diagnóstico confiável. O objetivo deste trabalho foi realizar uma quantificação absoluta de cinco vírus em videiras infectadas (Vitis spp.). Diferentes quantidades conhecidas da amostra padrão (cDNA viral clonado ou RNA viral transcrito in vitro) foram quantificadas por RT-qPCR TaqMan. A partir destes dados, curvas padrão foram geradas plotando-se os valores de Ct (ciclo limiar) contra o log da quantidade da amostra padrão. Amostras de videiras infectadas foram avaliadas visando-se determinar os títulos virais que foram bastante variáveis. Este resultado contribui para melhorar o diagnóstico viral ao quantificar com precisão variações no título viral em videiras.

Molecular variants of Grapevine rupestris stem pitting-associated virus infecting grapevines (Vitis spp.) in Brazil / Variantes moleculares de Grapevine rupestris stem pitting-associated virus infectando videiras (Vitis spp.) no Brasil

ABSTRACT: Grapevine rupestris stem pitting-associated virus (GRSPaV) is one of the most common viruses of grapevine. It is involved in the graft-transmissible disease rupestris stem pitting of the rugose wood complex. The objective of the research was to perform the molecular characterization of the coat protein (CP) gene of sixteen Brazilian GRSPaV isolates aiming to determine the occurrence of molecular variants (strains) of this virus. Nine grapevine samples were evaluated, from which dsRNA was extracted. Nucleotide sequences were generated by Next generation sequencing (NGS). Fifteen complete sequences of the GRSPaV CP gene were obtained and phylogenetically analyzed. Multiple alignments of the sequences showed identities of nucleotides ranging from 82% to 99%, suggesting high variability among the CPs of Brazilian isolates. The study revealed that genetic variability of GRSPaV comprising three molecular variants is also present in Brazilian grapevine genotypes.

RESUMO: O GRSPaV é um dos vírus mais comuns da videira. Está associado à doença transmissível por enxertia denominada caneluras de rupestris que compõe o complexo do lenho rugoso. O objetivo do trabalho foi realizar a caracterização molecular do gene da proteína capsidial (CP) de 16 isolados brasileiros de GRSPaV visando determinar a ocorrência de variantes moleculares desse vírus. Nove amostras de videira foram avaliadas das quais foi extraído dsRNA. As sequências de nucleotídeos foram geradas pelo sequenciamento de nova geração (NGS). Quinze sequências completas do gene CP de GRSPaV foram obtidas e filogeneticamente analisadas. Os alinhamentos múltiplos entre as sequências mostraram identidades de nucleotídeos variando de 82% a 99%, sugerindo alta variabilidade entre as CPs de isolados brasileiros. O estudo revelou que a variabilidade genética de GRSPaV compreendendo três variantes moleculares também está presente nos genótipos de videira no Brasil.

Incidência de vírus em videiras no Nordeste brasileiro e caracterização molecular parcial de isolados virais locais / Incidence of viruses in grapevines in the Brazilian Northeast and partial molecular characterization of local virus isolates

Os objetivos deste trabalho foram identificar as espécies virais presentes em vinhedos comerciais de duas regiões do Nordeste do Brasil e realizar a caracterização molecular parcial de isolados de três espécies virais. A diagnose foi realizada por meio de RT-PCR em tempo real para a detecção de Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine leafroll-associated virus 2, 3 e 4 (GLRaV-2, -3 e -4), Grapevine fleck virus (GFkV), Grapevine rupestris vein feathering virus (GRVFV) e Grapevine fanleaf virus (GFLV). Exceto para GFLV, os vírus avaliados estão amplamente disseminados nas áreas amostradas, frequentemente em altas incidências e em infecções múltiplas, de até 98% e 76,4%, na Zona da Mata e no Vale do São Francisco, respectivamente. Isolados locais de GVA, GVB e GLRaV-3 foram parcialmente caracterizados com base na sequência completa de nucleotídeos do gene da proteína capsidial e apresentaram alta porcentagem de identidade de nucleotídeos com outros isolados brasileiros: 91,2% (GVA), 99,8% (GVB) e 99,7% (GLRaV-3).

The objectives of this study were to identify viral species infecting commercial vineyards in two regions of Northeastern Brazil and perform partial molecular characterization of isolates of three virus species. The diagnosis was performed by real time RT-PCR for detection of GRSPaV, GVA, GVB, GLRaV-2, GLRaV-3, GLRaV-4, GFkV, GRVFV and GFLV. Except for GFLV, the evaluated viruses are widespread in the sampled areas, often in high incidences and in multiple infections, up to 98% and 76.4%, in the Zona da Mata and in the Vale do São Francisco regions, respectively. Local isolates of GVA, GVB and GLRaV-3, partially characterized by complete coat protein gene nucleotide sequencing, showed high percentage of nucleotide identities with other Brazilian isolates of these viruses: 91.2% (GVA), 99.8% (GVB) and 99.7% (GLRaV-3).

Detection and partial molecular characterization of Grapevine fleck virus, Grapevine virus D, Grapevine leafroll-associated virus -5 and -6 infecting grapevines in Brazil / Detecção e caracterização molecular parcial de Grapevine fleck virus, Grapevine virus D, Grapevine leafroll-associated virus -5 e -6 que infectam videiras no Brasil

Grapevine fleck, rugose wood and leafroll are three grapevine viral diseases whose causal agents (or associated viruses) respectively are Grapevine fleck virus (GFkV), Grapevine virus D (GVD) and Grapevine leafroll-associated virus 5 and 6 (GLRaV-5 and -6). The objective of this work was to perform a partial molecular characterization of local isolates of these four viral species that infect grapevines. The nucleotide and deduced amino acid sequences of complete genes of the coat protein (CP) (of GFkV), the CP and the RNA binding protein (of GVD), the CP and the partial hHSP70 gene (of GLRaV-5) and the partial hHSP70 gene (of GLRaV-6) were aligned and compared in silico with other isolates. These data extend the available information about Brazilian isolates of GFkV, GLRaV-5 and -6, and reports for the first time the GVD occurrence in Brazil.

Mancha das nervuras, lenho rugoso e enrolamento das folhas são três doenças virais da videira, cujos agentes causais (ou vírus associados) são o Grapevine fleck virus (GFkV), o Grapevine virus D (GVD) e os Grapevine leafroll-associated virus 5 e 6 (GLRaV-5 e -6), respectivamente. O objetivo deste trabalho foi realizar a caracterização molecular parcial de isolados locais dessas quatro espécies virais que infectam videira. As sequências de nucleotídeos e de aminoácidos deduzidos dos genes completos da proteína capsidial (CP) (do GFkV), da CP e da RNA binding protein (do GVD), da CP do GLRaV-5 e parte do gene codificador da hHSP70 do GLRaV-5 e -6 foram alinhadas e comparadas in silico com sequências de outros isolados. Os dados obtidos expandem a informação existente sobre isolados brasileiros de GFkV, GLRaV-5 e - 6 e relatam pela primeira vez a ocorrência do GVD no Brasil.

Detecção e caracterização molecular dos genes da proteína capsidial de ilarvírus e ampelovírus que infectam fruteiras temperadas / Detection and molecular characterization of ilarvirus and ampelovirus coat protein genes infecting temperate fruit trees

Dentre os principais patógenos que incidem em fruteiras temperadas, destacam-se o Prune dwarf virus (PDV), o Apple mosaic virus (ApMV) e o Grapevine leafroll-associated virus 1 (GLRaV-1). Neste trabalho foram realizadas a detecção e a caracterização molecular dos genes da proteína capsidial de isolados destas três espécies virais. RNAs totais foram extraídos de amostras de folhas de pessegueiros, macieiras e videiras e, nas reações de RT-PCR, foram utilizados oligonucleotídeos específicos para cada espécie viral. Os cDNAs amplificados foram clonados e sequenciados. Foram verificadas altas identidades entre as sequências de nucleotídeos dos genes da proteína capsidial dos isolados brasileiros de PDV, ApMV e GLRaV-1 e isolados de outros países, independente da origem geográfica e da hospedeira. O peso molecular da proteína capsidial destes vírus foi estimado por meio de Western blot em cerca de 24kDa (PDV), 26kDa (ApMV) e 39kDa (GLRaV-1).

Among the main pathogens infecting temperate fruit trees are Prune dwarf virus, Apple mosaic virus and Grapevine leafroll-associated virus 1. In this work the detection and molecular characterization of the coat protein genes of isolates from these viral species were carried out. Total RNA was extracted from peach, apple and grapevine leaves and RT-PCR reactions were performed using specific primers to each virus. The amplified cDNA fragments were cloned and sequenced. High identities were observed between coat protein nucleotide sequences of Brazilian isolates of PDV, ApMV and GLRaV-1 and isolates from other countries, independently from geographic origin and host. Coat protein molecular weights of these viruses were estimated by Western blot to be ca. 24kDa (PDV), 26kDa (ApMV) and 39kDa (GLRaV-1).

Detecção e identificação molecular de vírus associados a videiras sintomáticas e assintomáticas / Molecular detection and identification of virus associated with symptomatic and symptomless grapevines

A propagação vegetativa da videira favorece infecções virais múltiplas, com expressão diferencial de sintomas em função da combinação da cultivar ou espécie da hospedeira com a espécie viral. Os objetivos deste trabalho foram detectar e identificar as espécies virais presentes em duas espécies/cultivares de videira: uma sintomática e outra assintomática. DsRNA de ambas as amostras foi submetido à RT-PCR com 17 pares de oligonucleotídeos específicos para a detecção de Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine virus D (GVD), Grapevine fleck virus (GFkV), Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Grapevine chrome mosaic virus (GCMV), Rupestris stem pitting-associated virus (RSPaV), Grapevine leafroll-associated virus 1 a 4 (GLRaV-1 a -4), além de três pares de oligonucleotídeos degenerados. Pelo menos um fragmento amplificado, por par de oligonucleotídeos, foi clonado e sequenciado. Plantas sintomáticas e assintomáticas mostraram infecções múltiplas por RSPaV, GLRaV-2 e/ou GLRaV-3. As sequências de nucleotídeos obtidas para sete isolados de RSPaV, três de GLRaV-2 e dois de GLRaV-3 apresentaram identidades superiores a 90 por cento com espécies homólogas e permitiram a definição das possíveis estirpes presentes nas amostras infectadas. Esses resultados evidenciam a necessidade da diagnose viral baseada em testes específicos para determinar a condição sanitária da videira.

The vegetative propagation of grapevine facilitates multiple viral infections, with different symptoms which vary according to combinations of cultivar or host species with viral species. The aims of this research were to detect and identify the viral species infecting two grapevine species/cultivars: one symptomatic and one symptomless. DsRNA from both samples was assayed by RT-PCR using 17 pairs of specific primers for detection of the Grapevine virus A (GVA), Grapevine virus B (GVB), Grapevine virus D (GVD), Grapevine fleck virus (GFkV), Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Grapevine chrome mosaic virus (GCMV), Rupestris stem pitting-associated virus (RSPaV) and Grapevine leafroll-associated virus 1-4 (GLRaV-1 to -4), besides three degenerate primer pairs. For each primer pair at least one amplicon was cloned and sequenced. Symtomatic and symptomless plants were multiple infected by RSPaV, GLRaV-2 and/or GLRaV-3. The nucleotide sequences of seven isolates of RSPaV, three of GLRaV-2 and two of GLRaV-3 showed identities higher than 90 percent with the homologous viral species and allowed to identify possible viral strains in infected samples. These results highlight the necessity of viral diagnosis based on specific assays to determine grapevine sanitary status.

Produção de antissoro policlonal utilizando a proteína capsidial recombinante do Rupestris stem pitting-associated virus / Production of polyclonal antiserum using recombinant coat protein of Rupestris stem pitting -associated virus

O Rupestris stem pitting-associated virus (RSPaV) é o agente causal das caneluras do lenho da videira. Este trabalho teve como objetivo produzir antissoro policlonal a partir da proteína capsidial (CP) recombinante do RSPaV e avaliar a sua especificidade e sensibilidade. O gene da CP do RSPaV, com 780pb, foi previamente caracterizado. Esse gene foi subclonado no sítio de restrição EcoRI, no vetor de expressão pRSET-B e o plasmídeo recombinante foi utilizado para induzir a expressão da CP em Escherichia coli. A CP, ligada a uma cauda de seis histidinas, foi purificada por meio de cromatografia de afinidade em coluna de Ni-NTA a partir do extrato de proteínas totais extraídas de E. coli. A identidade da proteína purificada foi confirmada em SDS-PAGE e Western blot, utilizando-se anticorpos comerciais contra a cauda de seis histidinas. A CP recombinante expressada in vitro apresentou massa molecular de cerca de 31kDa. A proteína purificada foi quantificada e 2,55mg foram utilizados para a imunização de um coelho. O antissoro policlonal obtido reagiu com diferentes isolados deste vírus, extraídos de videiras em ELISA indireto.

RSPaV is the causal agent of pitting in the grapevine woody cylinder. The aim of this research was to produce polyclonal antiserum against recombinant RSPaV coat protein (CP) and evaluate its specificity and sensibility. The CP gene (780bp) of RSPaV was previously characterized. This gene was subcloned into the EcoRI site of the pRSET-B expression vector and the recombinant plasmid was used to induce the expression of the CP in E. coli cells. The CP, fused to a 6-His-tag, was purified from E. coli total protein extract by affinity chromatography using Ni-NTA resin. Identity of the purified protein was confirmed by SDS-PAGE and Western blot, using antibodies against the histidine tail. The in vitro-expressed recombinant CP presented a MW of ca. 31kDa. The purified protein was quantified and 2.55mg used for the immunization of a rabbit. The obtained polyclonal antiserum reacted with different RSPaV isolates extracted from grapevines in indirect ELISA.