Mortality and recurrence patterns of breast cancer patients diagnosed under a screening programme versus comparable non-screened breast cancer patients from the same population: analytical survey from 2002 to 2012.

Breast cancer screening programmes seem to bring about significant benefits, including decreased mortality, although they may also have some drawbacks such as false-negative and false-positive results. This study aims to compare the clinical outcome of a group of patients undergoing a breast cancer screening programme with that of a synchronous non-screened group of patients matched for age and follow-up period. We studied basic characteristics of epidemiology, immunohistochemistry, loco-regional relapse, distant metastases, disease-free interval and overall and specific mortality. We compared 510 patients in the screened group with 394 non-screened patients, along the period of 2002-2012. Screening was applied on a target population of 49,847 and was based on double-projection, double-read mammograms. Two years were allowed per round. Overall participation for the five rounds considered was 75.2%, with 86.5% coverage, and a total cumulative population of 123,445. The non-participant women amounted 40,794. Tumour detection rate for the screened women was 3.8 per thousand (475/123,445), while the corresponding rate for non-participants was 9.4 per thousand (382/40,797). Incidence of luminal A subtype was 15% higher in screened than that in non-screened patients (95% confidence interval (CI) 8-22%). Conversely, the triple-negative subtype was 6% higher in the non-screened group (95% CI 2-10%). Incidence of breast conservative treatments and sentinel node biopsies was significantly higher in the screened group. Overall mortality was 2.6 times higher in non-screened than that in screened group (95% CI 1.2-5.6) After 10 years of experience with our own screening programme, we believe that included patients receive a benefit versus comparable non-screened breast cancer patients, with acceptable benefit-risk relation.

First Report of Olpidium bornovanus and O. virulentus on Melon in Italy.

A survey for the presence of Olpidium spp. on melon (Cucumis melo L.) was conducted during the beginning of 2013 in central Italy in an unheated greenhouse, located in the melon-producing coastal area of north Latium (central Italy, Viterbo Province) (42°23'09.31″N, 11°30'46.10″E) with a history of monosporascus root rot and vine decline (MRRVD). For this aim, 10 soil samples were collected adjacent to the roots of plants symptomatic of MRRVD, represented by root lesions and rots and loss of smaller feeder roots. Olpidium was baited from collected infested soil by growing melon (cv. Dinero) plants for 45 days. Bait plants grown in sterilized soil were used as negative controls. All the baited melon roots were analyzed by morphological and molecular methods. For the morphological analysis, feeder roots were clarified in a 1.5% KOH solution for 24 h (2) and observed under a light microscope to record the presence or absence of sporangia and resting spores of Olpidium spp., which were observed in baited melon plants grown in infested soil and not in control roots. In particular, stellate resting spores were referred to as O. virulentus because this species cannot be distinguished from O. brassicae, which does not colonize melon. O. bornovanus had smooth-walled resting spores with a honeycomb-like pattern (2). For molecular analysis, DNA was extracted from 21 melon roots and tested by multiplex PCR to confirm Olpidium spp. identification (2). Based on molecular identification, O. virulentus was identified in 40% of samples, and O. bornovanus was identified in 10%. There were no mixed infections in the same sample. Two amplified PCR products, corresponding to O. bornovanus and O. virulentus expected fragment sizes of 977 and 579 bp respectively, were sequenced (GenBank Accession Nos. KF661295 and KF661296). BLAST analysis of the sequences showed 99% nucleotide identity with O. bornovanus isolate CH from Japan collected in melon roots (AB205215) and O. virulentus isolate HY-1 from Japan collected in lettuce roots as reported by Sasaya and Koganezawa (3) (AB205204, formerly O. brassicae). At the end of the experiment, the root systems of all inoculated plants appeared brown, whereas neither symptoms nor sporangia and resting spores were observed in roots of control plants. Olpidium spp. are root-infecting plant pathogens of melon (4), acting as vectors of Melon necrotic spot virus (MNSV) and other destructive plant viruses (1). Moreover, they are directly involved in the induction of germination of ascospores of Monosporascus cannonballus, the causal agent of MRRVD of cucurbits (4). To our knowledge, this is the first report of O. virulentus and O. bornovanus on melon in Italy. References: (1) A. Alfaro-Fernández et al. J. Phytopathol. 91:1250, 2009. (2) J. A. Herrera-Vásquez et al. Mycol. Res. 113:602, 2009. (3) T. Sasaya and H. Koganezawa. J. Gen. Plant Pathol. 72:20, 2006. (4) M. E. Stanghellini and I. J. Misaghi. Phytopathology 101:794, 2011.

First Report of Pepper vein yellows virus Infecting Sweet Pepper in Spain.

In November 2012, unusual symptoms were observed in plants of sweet pepper (Capsicum annuum L.) grown in commercial greenhouses of Almería Province, southeastern Spain. Symptoms included interveinal yellowing, upward leaf curling, and internode shortening, and were more evident in the upper part of the plant. Abnormal ripening of fruits was observed in symptomatic plants, with fruits remaining orange in the red varieties and yellow in the orange varieties, thus reducing their marketability. During December 2012 and January 2013, severe outbreaks of this disease syndrome occurred, with many greenhouses exhibiting almost 100% incidence. The symptoms observed were similar to those reported for isolates of Pepper vein yellows virus (PeVYV, genus Polerovirus, family Luteoviridae) (previously also named Pepper yellow leaf curl virus [PYLCV] and Pepper yellows virus [PYV]) (2,4). Twenty five symptomatic leaf and/or fruit samples (some of them supplied by Zeraim Ibérica, S.A.), each from a different greenhouse, were analyzed and all reacted positively in double-antibody sandwich-ELISA with an antiserum against the polerovirus Cucurbit aphid-borne yellows virus (CABYV) (Sediag, Longvic, France), known to cross-react with PeVYV (2). Total RNA was extracted by TRIsure reagent (Bioline, London, United Kingdom) from symptomatic leaves and analyzed by reverse transcription (RT)-PCR with primers Pol-G-F (5'-GAYTGCTCYGGYTTYGACTGGAG-3') and Pol-G-R (5'-GATYTTATAYTCATGGTAGGCCTTGAG-3') designed for universal detection of poleroviruses by amplifying the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) partial genes (3). DNA fragments of the expected size (1.1 kbp) were amplified supporting a polerovirus infection in all the analyzed samples. The PCR product obtained from one sample (Almería-1) was extracted from agarose gel with a QIAquick gel extraction kit (Qiagen, Hilden, Germany), cloned in pGEM-T Easy vector (Promega, Madison, WI), and one clone was sequenced (Macrogen Inc., Seoul, South Korea). The PCR products amplified from three other samples (2-13, 7-13, and 8-13) were directly sequenced. The nucleotide identity between the amplified fragments (GenBank Accession Nos. KC769487, KC839992 to 94), calculated after alignment with ClustalW, was 99.7 to 100%. The highest nucleotide identity of the Spanish sequences was with a PeVYV isolate from Turkey (FN600344, named as PYV) (98.5 to 98.7%). The spread of PeVYV in Spain is additional evidence of the emergence of this virus as a global threat for pepper crops after its first detection in Japan in 1995 and recent reports from the Mediterranean Basin (1,2). References: (1) N. Buzkan et al. Arch. Virol. 158:881, 2013. (2) A. Dombrovsky et al. Phytoparasitica 38:477, 2010. (3) D. Knierim et al. Plant Pathol. 59:991, 2010. (4) R. Murakami et al. Arch. Virol. 156:921, 2011.

Non-type I cystinuria caused by mutations in SLC7A9, encoding a subunit (bo,+AT) of rBAT.

Cystinuria (MIM 220100) is a common recessive disorder of renal reabsorption of cystine and dibasic amino acids. Mutations in SLC3A1, encoding rBAT, cause cystinuria type I (ref. 1), but not other types of cystinuria (ref. 2). A gene whose mutation causes non-type I cystinuria has been mapped by linkage analysis to 19q12-13.1 (Refs 3,4). We have identified a new transcript, encoding a protein (bo, +AT, for bo,+ amino acid transporter) belonging to a family of light subunits of amino acid transporters, expressed in kidney, liver, small intestine and placenta, and localized its gene (SLC7A9) to the non-type I cystinuria 19q locus. Co-transfection of bo,+AT and rBAT brings the latter to the plasma membrane, and results in the uptake of L-arginine in COS cells. We have found SLC7A9 mutations in Libyan-Jews, North American, Italian and Spanish non-type I cystinuria patients. The Libyan Jewish patients are homozygous for a founder missense mutation (V170M) that abolishes b o,+AT amino-acid uptake activity when co-transfected with rBAT in COS cells. We identified four missense mutations (G105R, A182T, G195R and G295R) and two frameshift (520insT and 596delTG) mutations in other patients. Our data establish that mutations in SLC7A9 cause non-type I cystinuria, and suggest that bo,+AT is the light subunit of rBAT.

'Candidatus Liberibacter solanacearum' Associated with Bactericera trigonica-Affected Carrots in the Canary Islands.

In 2009 and 2010, commercial carrot (Daucus carota L.) fields located in Tenerife (Canary Islands, Spain) showed symptoms of curling, yellow, bronze, and purple discoloration of leaves, stunting of shoots and tap roots, and proliferation of secondary roots. A large population of the psyllid Bactericera trigonica was noted in those fields. Similar symptoms were reported previously in carrot-production areas of the Canary Islands and mainland Spain that were associated with stolbur and aster yellows (1997 and 1998) (2) and Spiroplasma citri and phytoplasmas (2009 and 2010) (1). These symptoms were also reported in southern Finland in 2008 and associated with 'Candidatus Liberibacter solanacerum' (4). Studies were conducted to investigate whether these pathogens and the psyllid B. trigonica were associated with the observed symptoms in carrot in Tenerife. A total of 18 petiole samples of symptomatic carrots were collected (13 samples in 2009 and 5 samples 2010). Five asymptomatic plants were also sampled. Three samples of psyllids (five individuals grouped) collected from one affected field in 2010 were also included in the assay. Total DNA was extracted with the DNeasy Plant Mini Kit (Qiagen, Valencia, CA), and analyzed by nested-PCR assays using primer pairs P1/P7 and R16F2n/R16R2n for phytoplasmas and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2 for S. citri detection as described previously (3). PCR was performed using primer pairs OA2/OI2c and CL514F/R to amplify a portion of 16S rDNA and rplJ/rplL ribosomal protein genes, respectively, for 'Ca. L. solanacearum' (4). S. citri and phytoplasmas were not detected in any of the studied samples. However, a 1,168-bp 16S rDNA fragment and a 669-bp rplJ/rplL fragment were amplified from DNA from 16 symptomatic carrot samples and three psyllid grouped samples using specific primers for 'Ca. L. solanacearum'. No DNA was amplified from the asymptomatic samples. These results indicate the presence of 'Ca. L. solanacearum' in the affected carrot and psyllid samples collected in Tenerife (Canary Islands). Four and one PCR products obtained from DNA of carrot and psyllid samples, respectively, with both primer pairs were sequenced. BLAST analysis of the 16S rDNA sequences obtained from infected carrots (GenBank Accession Nos. HQ454312, HQ454313, HQ454314, and HQ454315) and psyllids (HQ454316) showed 99% identity to those of 'Ca. L. solanacearum' amplified from carrot in Finland (GU373049) and B. cockerelli (EU812557). The rplJ/rplL nucleotide sequences obtained from infected carrots (Accession Nos. HQ454317, HQ454318, HQ454319, and HQ454320) and psyllid (HQ454321) were 98% identical to the analogous rplJ/rplL 'Ca.L. solanacearum' ribosomal protein gene from carrot (GU373051) in Finland and tomato (EU834131) from New Zealand. To our knowledge, this is the first report of 'Ca. L. solanacearum' associated with psyllid-affected carrots in the Canary Islands (Tenerife, Spain) and also the first report of this plant pathogen associated with B. trigonica. References: (1) M. C. Cebrián et al. Plant Dis. 94:1264, 2010. (2) M. I. Font et al. Bol. San. Veg. Plagas 25:405, 1999. (3) I.-M. Lee et al. Plant Dis. 90:989, 2006. (4) J. E. Munyaneza et al. Plant Dis. 94:639, 2010.

First Report of 'Candidatus Liberibacter solanacearum' in Carrot in Mainland Spain.

In the summer of 2008, symptoms of leaf curling with yellow, bronze, and purple discoloration, twisting of petioles, stunting of shoots and tap roots, and proliferation of secondary roots were observed in 18 commercial carrot (Daucus carota L.) fields (~62 ha) severely infested with psyllids (mainly Bactericera sp.) from 52 fields (297 ha) located in Alicante and Albacete provinces of Spain. Incidence of symptomatic plants was variable among fields. Similar symptoms were observed in 2009, 2010, and 2011. Symptoms resembled those associated with phytoplasma, spiroplasma, or the bacterium 'Candidatus Liberibacter solanacearum' infections in carrot (1-4). Aster yellows and stolbur phytoplasmas and Spiroplasma citri have previously been reported from carrot in mainland Spain but liberibacter infection has not been documented in this region (1). Studies were conducted to determine if 'Ca. L. solanacearum' was associated with the symptoms. Petiole samples of symptomatic carrot plants were collected in 2009 (25 from 9 fields in Alicante and Albacete provinces) and early 2010 (21 from 8 fields in Alicante, Albacete, and Valencia provinces) from symptomatic fields where incidence ranged from 50 to 90%. In addition, one sample collected in 2008 in Alicante was included in the assay. Also, samples were collected from five asymptomatic carrot plants. Total DNA was extracted from 0.5 g of petiole tissue of each sample with the CTAB extraction buffer method (3,4). DNA extractions were analyzed by PCR assay using primer pairs OA2/OI2c and CL514F/R to amplify a portion of 16S rDNA and rplJ/rplL ribosomal protein genes, respectively, of 'Ca. L. solanacearum' (3,4). DNA samples were also tested for phytoplasmas and S. citri by nested-PCR assays using primer pairs P1/P7 followed by R16F2n/R16R2n and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2, respectively (2). A 1,168-bp fragment of 16S rDNA was detected in DNA extracted from 1, 12, and 12 symptomatic samples collected in 2008, 2009, and 2010, respectively, suggesting the presence of 'Ca. L. solanacearum' in the carrot samples. A 669-bp rplJ/rplL fragment also was amplified from DNA of the same samples. Liberibacter was not detected in asymptomatic plants. Eight and two samples were infected with S. citri and aster yellows phytoplasmas, respectively. Three samples were infected with S. citri and 'Ca. L. solanacearum' and one sample was infected with all three pathogens. Three amplicons obtained from the PCR assays with both primer pairs from carrot samples collected in 2009 and 2010 were sequenced directly. BLAST analysis of the 16S rDNA sequences (GenBank Nos. HQ454302, HQ454303, and HQ454304) showed 99% nucleotide identity to those of 'Ca. L. solanacearum' amplified from carrot in Finland (GU373049). The rplJ/rplL nucleotide sequences (HQ454305, HQ454306, and HQ454307) were 97% identical to sequences of the analogous rplJ/rplL 'Ca. L. solanacearum' ribosomal protein gene from carrot in Finland (GU373051). To our knowledge, this is the first report of 'Ca. L. solanacearum' in carrot in mainland Spain and also the first evidence of mixed infections of S. citri, 'Ca. L. solanacearum', and phytoplasmas in carrot. References: (1) M. C. Cebrián et al. Plant Dis. 94:1264, 2010. (2) I.-M. Lee et al. Plant Dis. 90:989, 2006. (3) J. E. Munyaneza et al. J. Econ. Entomol. 103:1060, 2010. (4) J. E. Munyaneza et al. Plant Dis. 94:639, 2010.

Consequences of penile fracture: Complications and long-term functional outcomes.

INTRODUCTION: Penile fracture (PF) is a urological emergency with low incidence, and evidence of its long-term outcomes is scarce. This study focuses on postoperative complications and long-term functional outcomes in patients with PF and surgical repair at our center. MATERIALS AND METHOD: Clinical records of patients undergoing urgent surgery for PF at a third level hospital between 2006 and 2020 were retrospectively reviewed. Functional outcomes were assessed with voluntary telephone interviews from June 2020 to February 2021. Lower urinary tract symptoms were screened by IPSS questionnaire, sexual function by EHS and IIEF-5 and morphological alterations by direct questions to patients. RESULTS: A total of 41 patients underwent surgery for PF. Eleven of them also had urethral injury (higher incidence if there was bilateral corpora cavernosa injury, 19.4% vs. 80%, p < 0.05). Only 1 patient presented a Clavien-Dindo type 3a complication due to wound dehiscence, 4 (13%) type 2 and 9 (29%) type 1. Twenty-four patients underwent long-term follow-up, of whom 20 (83.3%) presented normal sexual function. Twelve patients (50%) had a palpable nodule at the fracture site, 8 (33.3%) had new onset penile curvature and 1 patient with previous urethral injury presented urethral stricture. CONCLUSION: In cases of penile fracture, there is a higher incidence of urethral injury if both corpora cavernosa are affected. Long-term functional sequelae after surgical repair of a PF are rare.

First Report of Eggplant mottled dwarf virus in Pittosporum tobira in Spain.

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5' TATGCGAGAATTGGGAGTGGGTAGT 3') and EMDV-R (5' CATTGTTATCCCGGGAAGTATTT 3') targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.

[Evaluation of the quality-of-life of patients with pacemakers : experience of Burkina Faso about 120 patients paired with the collaboration of doctors from AUVERGNE (France)]. / Évaluation de la qualité de vie des patients porteurs d'un stimulateur cardiaque (pacemaker) : expérience du Burkina Faso à propos de 120 patients appareillés avec la collaboration des médecins d'Auvergne (France).

INTRODUCTION: In Burkina Faso, cardiac stimulation was introduced in October 2000 has grown over time.In orderto evaluate the effectiveness of stimulation on life, we proposed to evaluate the quality of life of patients with a pacemaker. GENERAL OBJECTIVE: to study the effect of the pacemaker on the quality of life of patients PATIENTS AND METHODS: This was a cross-sectional study aimed at describingthe wearers of a pacemaker for at least six months at the Yalgado OUEDRAOGO University Hospital and the Schiphramedical center.The AQUAREL questionnaire has been adapted to our context to establish a quality-of-life score. RESULTS: The mean age of the study population was 68 years with a female predominance (53.3%). Complete atrioventricular block was the main indication of stimulation in 55%. The average duration of implantation was 41.6 months with extremes of 8 and 128 months. The primo implantation was found in 79.1 % of patients against 18.3 % for a first change of case and2.5 % for a second change of housing. Double chamber stimulation was performed in 65% of cases. DDD mode was the most used followed by VVIR. The average quality of life score was 90.12. Negative predictors of quality of life were age and female.A correlation between quality-of-life score and age, hypertension and dyslipidemia was found (p< 0.05). On the other hand, no correlation between the number of implantation, the duration of implantation and the mode of stimulation was found (p> 0.05). CONCLUSION: patients with a pacemaker have a good quality of life. However, quality-of-life is not correlated with the number of pacemakers, nor the duration and mode of stimulation.

Nuclear Medicine in the diagnosis of pathologies of the spine: role of hybrid imaging. / Medicina nuclear en el diagnóstico de las afecciones de la columna vertebral: papel de la imagen híbrida.

Clinical problems in the human spine are still common in our society, often causing pain and can also limit movement. Back pain is a very common clinical entity, although difficult to diagnose due to its multifactorial nature. There are multiple processes that can alter the structure of the spine, injure vertebrae and/or the surrounding tissue. For the study of the spine, image diagnosis is essential, and within this, molecular hybrid techniques play an important role by providing us with an image of functional and morphological fusion. Among these, SPECT/CT is key in the diagnosis of traumatic and stress pathology, allowing us to locate hidden vertebral fractures, and is also very useful in degenerative and post-surgical pathology. On the other hand, PET/CT with 18F-FDG also plays an important role in the management and monitoring of infectious and oncological processes. This review describes the application of these hybrid techniques in the different pathologies of the spine and the findings of their images, being very useful for the diagnostic assessment and therapeutic management of the patient.

Insight in Obsessive-Compulsive Disorder: Relationship With Sociodemographic and Clinical Characteristics.

Insight is considered a multidimensional concept and, in the context of obsessive-compulsive disorder (OCD), impairment in insight has been widely reported to be associated with severity and other clinical and sociodemographic variables. However, the studies concerning insight in OCD have produced heterogenous data as a result of the scales used to measure insight. To overcome this heterogeneity, the study presented here used 4 different widely used and validated insight scales. The objective was to evaluate various aspects of insight using these scales to identify the relationships between different aspects of insight and clinical and sociodemographic variables to assess which scale or scales might possess greater efficiency in clinical practice. For this purpose, a descriptive, observational, and cross-sectional study of 81 patients in treatment in a mental health center was conducted. Patients were evaluated using the Brown Assessment of Beliefs Scale, the Overvalued Ideas Scale, the Scale of Unawareness of Mental Disorders, the Yale-Brown Obsessive Compulsive Scale, the Clinical Global Impressions Scale, the Global Assessment of Functioning Scale, and the Rey-Osterrieth Complex Figure Test. The results reported significant relationships between insight and scores on the Yale-Brown Obsessive Compulsive Scale (Thoughts, Compulsions, and Total scales), Clinical Global Impressions Scale, and the Global Assessment of Functioning Scale, and significant differences with regard to sex, level of education, working status, and course of the disorder. A correlation analysis was conducted to assess the relationships among the 4 insight scales. The results of this analysis suggest that the scales that measure insight in a multidimensional way (Brown Assessment of Beliefs Scale and Overvalued Ideas Scale) provide more information about the severity of the disorder in patients with OCD.

The V gamma locus of the human T cell receptor gamma gene. Repertoire polymorphism of the first variable gene segment subgroup.

Southern blot analysis using a genomic probe of the human TCR-gamma chain first variable gene subgroup (V gamma I) was performed on DNA samples from both parents of 36 healthy Caucasian families. Two types of polymorphisms were found in these 72 unrelated DNA samples: three repertoire polymorphisms and two restriction fragment length polymorphisms (RFLP). In all cases, Mendelian inheritance of these polymorphisms was demonstrated. The most frequent repertoire polymorphism consists in the lack of the V gamma 4 and V gamma 5 segments. In 16% of chromosomes, the Eco RI and Taq I restriction fragments corresponding to V gamma 4 and V gamma 5 were lacking, with no additional bands. In these cases, a decrease of 10 kb was observed in the Bam HI fragment containing all V gamma I segments as compared with samples containing V gamma 4-V gamma 5 segments. To better understand this polymorphism, which takes place in a previously incompletely defined region, the central part of the V gamma I region, including the polymorphic V gamma 4-V gamma 5 segments, was cloned. This allowed us to localize precisely the V gamma 5 segment and thus complete the description of the V gamma I region. A striking homology of DNA and deduced amino acid sequences is present between V gamma 2 and V gamma 4 and between V gamma 3 and V gamma 5, much higher than that observed between V gamma 2 and V gamma 3 and between V gamma 4 and V gamma 5. The differences in nucleotide sequence occur mainly in the intron and three hypervariable regions. These results strongly suggest a gene duplication relationship between the segments V gamma 2-V gamma 3 and the segments V gamma 4-V gamma 5. The most frequent RFLP documented in this study is due to the combined absence of the Eco RI and the Taq I sites located in the noncoding region between V gamma 3 and V gamma 4. The haplotypic frequence of this RFLP is 6.9% of the general population. As the gamma/delta receptor may play an important role in immunological response, the biological relevance of the high degree of polymorphism occurring in the V gamma I region, as well as its possible association with some immune disturbances, should be further explored.

First Report of Spiroplasma citri in Carrot in Europe.

In 2008 and 2009, symptoms of curling, yellow and purple discoloration of leaves, stunting of shoots and tap roots, and formation of bunchy, fibrous secondary roots were observed in commercial carrot (Daucus carota L.) fields located in several production areas of Spain (Alicante, Albacete, Segovia, and Valladolid). Incidence of this disease was almost 100% in individual affected fields. Similar symptoms were reported from 1997 to 1998 in various carrot production areas of Spain (the Canary Islands, Segovia, and Madrid) and were associated with infection of stolbur and aster yellows phytoplasmas (2). Moreover, the observed symptoms resembled those caused by Spiroplasma citri in carrots affected by the carrot purple leaf disease recently reported in the United States (4). Studies were conducted to investigate whether S. citri and phytoplasmas were associated with the observed carrot symptoms. Total DNA was extracted from 0.5 g of phloem tissue of 13 symptomatic and 3 asymptomatic plants with DNeasy Plant Mini Kit (Qiagen, Valencia, CA). DNA samples were analyzed by nested-PCR assays using primers pair P1/P7 (1) and R16F2n/R16R2n (3) for phytoplasmas and ScR16F1/ScR16R1 followed by ScR16F1A/ScR16R2 (4) for S. citri detection. DNA of a known strain of S. citri (Sediag, Longvic, France) was used as a positive control of the assay. Analyses revealed that 8 of the 13 symptomatic plants tested positive for S. citri; the plants were collected from three different provinces of Spain, namely, Alicante, Valladolid, and Segovia. Two symptomatic plants were double infected by S. citri and a phytoplasma strain belonging to the Aster yellows group (16SrI), subgroup 16SrI-A. However, none of the symptomatic plants presented single infection with phytoplasmas. S. citri identity was determined by sequencing two nested PCR products (1.1 kb) that yielded identical sequences deposited in the GenBank database (Accession Nos. HM124555 and HM124556). BLAST analysis showed 100% nt identity with a sequence of S. citri from carrot (Accession No. DQ112019) associated with the new carrot disease referred to as 'carrot purple leaf reported in Washington State (4). To our knowledge, this is the first report of S. citri associated with carrot in Europe. References: (1) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (2) M. I. Font et al. Bol. San. Veg. Plagas 25:415, 1999. (3) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (4) I. M. Lee et al. Plant Dis. 90:989, 2006.

Biomarkers levels and brachial and central blood pressure during the subacute phase of lacunar stroke and other ischemic stroke subtypes.

We aimed to evaluate brachial and central blood pressure (BP) estimates and biomarker levels in lacunar ischemic stroke (IS) and other IS subtypes (nonlacunar stroke). We studied 70 functionally independent subjects consecutively admitted to our institution after a first episode of IS. Subjects with previous heart failure were excluded. BP was measured at admission and during the subacute phase of stroke (5-7 days after stroke onset). Aortic pulse wave velocity (aPWV), augmentation index (AIx), and 24 h brachial and central BP (24h-ABPM) were measured by means of a Mobil-O-Graph device during the subacute phase of stroke. Determination of N-terminal prohormone of brain natriuretic peptide (NT-proBNP), urinary albumin excretion, and echocardiography were performed in all subjects. After adjusting for age and clinical severity, lacunar IS had significantly higher levels of BP at admission (systolic BP 173 ± 37 vs 153 ± 28 mmHg, p = 0.006; diastolic BP: 97 ± 21 vs 86 ± 16 mmHg, p = 0.035) and during the subacute phase of stroke (systolic BP 152 ± 23 vs 134 ± 19 mmHg, p = 0.001; diastolic BP: 84 ± 14 and 77 ± 10 mmHg, respectively; p = 0.038) but lower NT-proBNP levels (median: 36,277 vs 274 pg/mL, p = 0.009) than nonlacunar IS. Central BP, aPWV, and AIx were not different between lacunar and nonlacunar IS, neither the rate of target organ damage. In conclusion, patients with a first episode of lacunar IS have higher BP values at admission and during the subacute phase of stroke and lower levels of NT-proBNP, suggesting a closer relationship with hypertension of this IS subtype.

First Report of Tomato torrado virus Infecting Tomato in Single and Mixed Infections with Cucumber mosaic virus in Panama.

In February of 2008, in open-field-grown tomato crops (Solanum lycopersicum L.) from the central regions of Coclé, Herrera, Los Santos, and Veraguas of Panama, unusual disease symptoms, including deformation, necrosis, purple margins, interveinal yellowing, downward and upward curling of the leaflets alternately, necrotic lines in sepals and branches, fruits distorted with necrotic lines on the surface, and severe stunting, were observed. Tomato production was seriously damaged. To verify the identity of the disease, five symptomatic tomato plants from four fields of these regions were selected and analyzed by double-antibody sandwich (DAS)-ELISA using specific antibodies to Cucumber mosaic virus (CMV), Potato virus X (PVX), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from all plants and tested using reverse transcription (RT)-PCR with three pairs of specific primers: one pair designed to amplify 586 bp of the coat protein gene of CMV (CMV-F 5'-CCTCCGCGGATGCTAACTT-3' and CMV-R 5'-CGGAATCAGACTGGGAGCA-3') and the other two pairs to Tomato torrado virus (ToTV) that amplify 580 and 574 bp of the polyprotein (4) and coat protein (Vp23) (3) region of RNA2, respectively; and by dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the aforementioned polyprotein. The serological analysis for PVX, PVY, ToMV, TSWV, and PepMV were negative. ToTV was detected in all samples analyzed. Three of these samples were also positive for CMV by serological and molecular analysis. No differences in symptom expression were observed between plants infected with both viruses or with ToTV alone. RT-PCR products were purified and directly sequenced. BLAST analysis of one CMV sequence (GenBank Accession No. EU934036) showed 98% identity with a CMV sequence from Brazil (most closely related sequence) (GenBank Accession No. AY380812) and 97% with the Fny isolate (CMV subgroup I) (GenBank Accession No. U20668). Two ToTV sequences were obtained (GenBank Accession Nos. EU934037 and FJ357161) and showed 99% and 98% identities with the polyprotein and coat protein region of ToTV from Spain (GenBank Accession No. DQ388880), respectively. CMV is transmitted by aphids and is distributed worldwide with a wide host range (2), while ToTV is transmitted by whiteflies and has only been reported in tomato crops in Spain and Poland and recently on weeds in Spain (1). To our knowledge, this is the first time ToTV has been detected in Panama and the first report of CMV/ToTV mixed infection. References: (1) A. Alfaro-Fernández et al. Plant Dis. 92:831, 2008. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

First Report of Tobacco mild green mosaic virus Infecting Capsicum annuum in Tunisia.

During the springs of 2007 and 2008, leaf deformations as well as symptoms of mild green and chlorotic mosaic were observed on pepper (Capsicum annuum) plants grown in Monastir (northwest Tunisia) and Kebili (southeast Tunisia). With the support of projects A/5269/06 and A/8584/07 from the Spanish Agency for International Cooperation (AECI), symptomatic leaf samples were analyzed by transmission electron microscopy (TEM) of leaf-dip preparations. Typical tobamovirus-like particles (rigid rods ≈300 nm long) were observed in crude plant extracts. According to literature, at least six tobamoviruses infect peppers: Paprika mild mottle virus (PaMMV); Pepper mild mottle virus (PMMoV); Ribgrass mosaic virus (RMV); Tobacco mild green mosaic virus (TMGMV); Tobacco mosaic virus (TMV); and Tomato mosaic virus (ToMV) (1). Extracts from six symptomatic plants from Monastir and four from Kebili fields tested negative for ToMV, TMV, and PMMoV and tested positive for TMGMV by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany). To confirm the positive TMGMV results, total RNAs from 10 symptomatic plants that tested positive by ELISA were extracted and analyzed by reverse transcription (RT)-PCR using primers designed to specifically amplify a region of the coat protein gene (CP) of TMGMV (2). The 524-bp TMGMV-CP specific DNA fragment was amplified from all samples, but was not amplified from healthy plants or the sterile water used with negative controls. RT-PCR products were purified and directly sequenced. BLAST analysis of the obtained sequence (GenBank No. EU770626) showed 99 to 98% nucleotide identity with TMGMV isolates PAN-1, DSMZ PV-0113, TMGMV-Pt, and VZ1 (GenBank Nos. EU934035, EF469769, AM262165, and DQ460731, respectively) and less than 69% with PaMMV and PMMoV isolates (GenBank Nos. X72586 and AF103777, respectively). Two TMGMV-positive, singly, infected symptomatic pepper plants collected from Monastir and Kebili were used in mechanical transmissions to new pepper and tomato plants. Inoculated pepper plants exhibited mild chlorosis symptoms and tested positive for TMGMV only; however, inoculated tomato plants cv. Marmande were asymptomatic and tested negative as expected for TMGMV infection (1). To our knowledge, although C. annuum has been shown as a natural host for TMGMV (2), this is the first report of TMGMV in Tunisia. Reference: (1) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20th August 1996. Online publication, 1996. (2) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

Blood-borne tissue factor activity predicts major cerebrovascular events in patients undergoing carotid endarterectomy: results from a 1-year follow-up study.

BACKGROUND: Tissue factor (TF) expression is increased in inflammatory atherosclerotic plaques and has been related to plaque thrombogenicity. Blood-borne TF activity seems to contribute to a procoagulant state in patients with vascular risk factors. The aim of this study was to assess whether the expression of TF in carotid plaques from patients undergoing carotid endarterectomy (CEA) or/and blood-borne ('circulating') TF activity could predict future vascular complications. METHODS: A total of 105 consecutive patients (85 male and 20 female aged 61-77 years)undergoing CEA for high-grade internal carotid artery were included in the study. Carotid artery specimens were classified into active (n = 52; rich in inflammatory cells) and nonactive plaques (n = 53; poor in inflammatory cells or fibrous). TF mRNA levels in carotid plaques were assessed by real-time PCR (TaqMan Low-Density Arrays) and TF protein levels by Western blot. Blood-borne TF activity and other biochemical parameters, including low-density lipoprotein cholesterol (LDLc) levels and high-sensitivity C-reactive protein, were measured prior to surgery. Patients were followed up for 1 year and vascular and nonvascular complications were scored. RESULTS: TF expression was higher in active CEA plaques. Patients with active CEA plaques exhibited higher plasma LDLc levels (3.6 +/- 0.7 vs. 2.1 +/- 1 mM, p < 0.05) that positively correlated with plaque TF mRNA levels (p = 0.0125; r = 0.9). Blood-borne TF activity did not correlate with plasma LDLc levels and was unrelated to the anatomo-pathological characteristic of the CEA plaques (thrombosis, rupture, inflammation, lipid core, necrosis or calcification). Circulating TF activity predicted vascular complications at 1 year, including fatal (OR, 1.18; 95% CI, 0.6-2.2, p < 0.01) and nonfatal ischemic stroke (OR, 1.22; 95% CI, 0.5-2.0, p < 0.05) and symptomatic peripheral vascular disease (OR, 1.48; 95% CI, 0.4-2.6, p < 0.005). CONCLUSIONS: Blood-borne TF activity prior to CEA but not local TF expression or plasma LDLc levels predict cerebrovascular and peripheral vascular disease events at 1 year in elderly patients subjected to CEA for high-grade carotid stenosis.

Atherothrombosis and plaque heterology: different location or a unique disease?

Formation of unstable plaques frequently results in atherothrombosis, the major cause for ischaemic stroke, myocardial infarction and peripheral arterial disease. Patients who have symptomatic thrombosis in one vascular bed are at increased risk of disease in other beds. However, the development of the disease in carotid, coronary and peripheral arteries may have different pathophysiology suggesting that more complex treatment protocols may have to be designed to reduce plaque development at different locations. In this review we describe the known risk factors, compare the developmental features of coronary and carotid plaque development and determine their association with end-point ischaemic events. Differences are also seen in the genetic contribution to plaque development as well as in the deregulation of gene and protein expression and cellular signal transduction activity of active cells in regions susceptible to thrombosis. Differences between carotid and coronary artery plaque development might help to explain the differences in anatomopathological appearance and risk of rupture.

Phenotypic differences on the outcome of the host-parasite relationship: behavior of mice of the CBi stock in natural and experimental infections.

Investigation of defined animal models may help to elucidate the role of the host genetic background in the development and establishment of a parasitic infection. Four lines of mice obtained by disruptive selection for body conformation (CBi+, CBi-, CBi/C and CBi/L) and the unselected control line CBi were examined in their response to different parasites to assess whether these distinct genotypes showed differences in their resistance to natural and experimental parasitosis. Protozoans (Trichomonas muris and Spironucleus muris) and nemathelminths (Syphacia obvelata and Aspiculurus tetraptera) were found naturally parasitizing the mice's intestines. CBi/C and CBi were the only genotypes in which T. muris was found. CBi- was least resistant to S. muris. The helminth parasitic burden showed differences between sexes within genotypes (males had a higher burden than females) and among genotypes (CBi/L males had the lowest burden). CBi/L animals were also most resistant to experimental challenge with Heligmosomoides polygyrus and Trypanosoma cruzi. Since all the animals examined shared a common habitat throughout the study and were equally exposed to infection, the phenotypic differences in the natural enteroparasitism herein described evince genetic differences among lines in the host-parasite relationship. This interpretation is further supported by the differences in the response to the experimental challenge to H. polygyrus and T. cruzi.