Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 269
Filtrar
1.
Cancer Sci ; 115(1): 155-169, 2024 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-37972389

RESUMO

Cancer-associated fibroblasts (CAFs), as important components of the tumor microenvironment, can regulate intercellular communication and tumor development by secreting extracellular vesicles (EVs). However, the role of CAF-derived EVs in ovarian cancer has not been fully elucidated. Here, using an EV-microRNA sequencing analysis, we reveal specific overexpression of microRNA (miR)-296-3p in activated CAF-derived EVs, which can be transferred to tumor cells to regulate the malignant phenotypes of ovarian cancer cells. Moreover, overexpression of miR-296-3p significantly promotes the proliferation, migration, invasion, and drug resistance of ovarian cancer cells in vitro, as well as tumor growth in vivo, while its inhibition has the opposite effects. Further mechanistic studies reveal that miR-296-3p promotes ovarian cancer progression by directly targeting PTEN and SOCS6 and activating AKT and STAT3 signaling pathways. Importantly, increased expression of miR-296-3p encapsulated in plasma EVs is closely correlated with tumorigenesis and chemoresistance in patients with ovarian cancer. Our results highlight the cancer-promoting role of CAF-derived EVs carrying miR-296-3p in ovarian cancer progression for the first time, and suggest that miR-296-3p encapsulated in CAF-derived EVs could be a diagnostic biomarker and therapeutic target for ovarian cancer.


Assuntos
Fibroblastos Associados a Câncer , Vesículas Extracelulares , MicroRNAs , Neoplasias Ovarianas , Humanos , Feminino , Proteínas Proto-Oncogênicas c-akt , Neoplasias Ovarianas/genética , Vesículas Extracelulares/genética , MicroRNAs/genética , Proliferação de Células/genética , Microambiente Tumoral/genética , Proteínas Supressoras da Sinalização de Citocina , PTEN Fosfo-Hidrolase/genética , Fator de Transcrição STAT3/genética
2.
Hum Mol Genet ; 31(12): 2023-2034, 2022 06 22.
Artigo em Inglês | MEDLINE | ID: mdl-35022732

RESUMO

Acute pancreatitis (AP) is widely recognized to be an inflammation-related disease, in which HDAC was upregulated. The anti-inflammatory role of suberoylanilide hydroxamic acid (SAHA), a HDAC inhibitor, has been documented. In this context, this research was implemented to figure out whether SAHA manipulated inflammation in AP. Subsequent to induction of AP mouse model, HDAC5 expression was detected. The binding of HDAC5 and SLIT2 was detected by Co-Immunoprecipitation and Chromatin immunoprecipitation assays. SAHA treatment and gain- and loss-of-function approaches were used in AP mice and lipopolysaccharide (LPS)-induced pancreatic acinar cells. In mice, biochemical methods were implemented to measure activities of pancreatic lipase, trypsin, myeloperoxidase (MPO) and pancreatic edema, TUNEL staining to determine pancreatic cell apoptosis, and flow cytometry to assess the total number of leukocytes and neutrophils in pancreas. In pancreatic acinar cells, CCK-8 was performed to evaluate cell viability. HDAC5 exhibited overexpression in AP mice. Mechanical analysis showed that HDAC5 facilitated SLIT2 deacetylation to downregulate SLIT2, thus activating Akt/ß-catenin pathway in pancreatic acinar cells. SAHA treatment, HDAC5 silencing or SLIT2 overexpression diminished inflammation in AP in vivo and in vitro. SAHA treatment, HDAC5 silencing or SLIT2 overexpression reduced activities of pancreatic lipase, trypsin, MPO, pancreatic edema and cell apoptosis in AP mice as well as elevated viability of LPS-induced pancreatic acinar cells. SAHA might exert anti-inflammatory effects in AP mice via HDAC5/SLIT2/Akt/ß-catenin axis.


Assuntos
Anti-Inflamatórios , Pancreatite , Vorinostat , Doença Aguda , Animais , Anti-Inflamatórios/farmacologia , Histona Desacetilases/genética , Histona Desacetilases/metabolismo , Inflamação/metabolismo , Peptídeos e Proteínas de Sinalização Intercelular/genética , Peptídeos e Proteínas de Sinalização Intercelular/metabolismo , Lipase/genética , Lipase/metabolismo , Lipopolissacarídeos , Camundongos , Camundongos Endogâmicos C57BL , Proteínas do Tecido Nervoso/genética , Proteínas do Tecido Nervoso/metabolismo , Pâncreas , Pancreatite/induzido quimicamente , Pancreatite/genética , Pancreatite/metabolismo , Proteínas Proto-Oncogênicas c-akt/genética , Proteínas Proto-Oncogênicas c-akt/metabolismo , Tripsina/metabolismo , Vorinostat/farmacologia , beta Catenina/genética , beta Catenina/metabolismo
3.
Br J Cancer ; 130(11): 1819-1827, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38594370

RESUMO

BACKGROUND: Although DHFR gene amplification has long been known as a major mechanism for methotrexate (MTX) resistance in cancer, the early changes and detailed development of the resistance are not yet fully understood. METHODS: We performed genomic, transcriptional and proteomic analyses of human colon cancer cells with sequentially increasing levels of MTX-resistance. RESULTS: The genomic amplification evolved in three phases (pre-amplification, homogenously staining region (HSR) and extrachromosomal DNA (ecDNA)). We confirm that genomic amplification and increased expression of DHFR, with formation of HSRs and especially ecDNAs, is the major driver of resistance. However, DHFR did not play a detectable role in the early phase. In the late phase (ecDNA), increase in FAM151B protein level may also have an important role by decreasing sensitivity to MTX. In addition, although MSH3 and ZFYVE16 may be subject to different posttranscriptional regulations and therefore protein expressions are decreased in ecDNA stages compared to HSR stages, they still play important roles in MTX resistance. CONCLUSION: The study provides a detailed evolutionary trajectory of MTX-resistance and identifies new targets, especially ecDNAs, which could help to prevent drug resistance. It also presents a proof-of-principal approach which could be applied to other cancer drug resistance studies.


Assuntos
Resistencia a Medicamentos Antineoplásicos , Amplificação de Genes , Metotrexato , Tetra-Hidrofolato Desidrogenase , Humanos , Metotrexato/farmacologia , Resistencia a Medicamentos Antineoplásicos/genética , Tetra-Hidrofolato Desidrogenase/genética , Tetra-Hidrofolato Desidrogenase/metabolismo , Linhagem Celular Tumoral , Neoplasias do Colo/genética , Neoplasias do Colo/tratamento farmacológico , Neoplasias do Colo/patologia , Antimetabólitos Antineoplásicos/farmacologia , Regulação Neoplásica da Expressão Gênica/efeitos dos fármacos , Genômica/métodos
4.
BMC Cancer ; 24(1): 1130, 2024 Sep 11.
Artigo em Inglês | MEDLINE | ID: mdl-39261761

RESUMO

Gastric cancer is one of the most malignant digestive tract tumors worldwide and its progression is associated with gene expression and metabolic alteration. We revealed that the gastric cancer patients with lower expression level of TOB1 exhibited poorer overall survivals according to the data in Kaplan-Meier Plotter. The unphosphorylated TOB1 protein which is effective expressed lower in gastric cancer cells. The gastric cancer cells with TOB1 gene depletion performed higher abilities of proliferation, migration and invasion and lower ability of apoptosis in vitro. The TOB1 gene depletion also promoted the tumorigenesis of gastric cancer cells in vivo. The gastric cancer cells with TOB1 gene overexpression had the converse behaviors. The transcriptional and metabolic sequencing was performed. The analyzation results showed that genes correlate-expressed with TOB1 gene were enriched in the pathways related to ERK pathway, including focal adhesion pathway, which was verified using real-time quantitative PCR. After inhibiting ERK pathway, the proliferation, colony formation and migration abilities were reduced in gastric cancer cells with low phosphorylated TOB1 protein expression level. Moreover, Pearson correlation analysis was adopted to further analyze the correlation of enriched metabolic products and differentially expressed genes. The expression of Choline, UDP-N-acetylglucosamine, Adenosine and GMP were related to the function of TOB1. This study demonstrates the genes and metabolites related to focal adhesion pathway and ERK pathway are the potential diagnosis and therapeutic targets to gastric cancer with TOB1 depletion.


Assuntos
Movimento Celular , Proliferação de Células , Progressão da Doença , Regulação Neoplásica da Expressão Gênica , Sistema de Sinalização das MAP Quinases , Neoplasias Gástricas , Proteínas Supressoras de Tumor , Humanos , Neoplasias Gástricas/genética , Neoplasias Gástricas/patologia , Neoplasias Gástricas/metabolismo , Neoplasias Gástricas/mortalidade , Proteínas Supressoras de Tumor/genética , Proteínas Supressoras de Tumor/metabolismo , Movimento Celular/genética , Linhagem Celular Tumoral , Animais , Camundongos , Peptídeos e Proteínas de Sinalização Intracelular/genética , Peptídeos e Proteínas de Sinalização Intracelular/metabolismo , Adesões Focais/genética , Adesões Focais/metabolismo , Apoptose/genética
5.
Cell Commun Signal ; 22(1): 470, 2024 Oct 01.
Artigo em Inglês | MEDLINE | ID: mdl-39354571

RESUMO

PURPOSE: DNA methylation prominently inactivates tumor suppressor genes and facilitates oncogenesis. Previously, we delineated a chromosome 18 deletion encompassing the erythrocyte membrane protein band 4.1-like 3 (EPB41L3) gene, a progenitor for the tumor suppressor that is differentially expressed in adenocarcinoma of the lung-1 (DAL-1) in gastric cancer (GC). METHODS: Our current investigation aimed to elucidate EPB41L3 expression and methylation in GC, identify regulatory transcription factors, and identify affected downstream pathways. Immunohistochemistry demonstrated that DAL-1 expression is markedly reduced in GC tissues, with its downregulation serving as an independent prognostic marker. RESULTS: High-throughput bisulfite sequencing of 70 GC patient tissue pairs revealed that higher methylation of non-CpGs in the EPB41L3 promoter was correlated with more malignant tumor progression and higher-grade tissue classification. Such hypermethylation was shown to diminish DAL-1 expression, thus contributing to the malignancy of GC phenotypes. The DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine (5-aza-CdR) was found to partially restore DAL-1 expression. Moreover, direct binding of the transcription factor CDC5L to the upstream region of the EPB41L3 promoter was identified via chromosome immunoprecipitation (ChIP)-qPCR and luciferase reporter assays. Immunohistochemistry confirmed the positive correlation between CDC5L and DAL-1 protein levels. Subsequent RNA-seq analysis revealed that DAL-1 significantly influences the extracellular matrix and space-related pathways. GC cell RNA-seq post-5-Aza-CdR treatment and single-cell RNA-seq data of GC tissues confirmed the upregulation of AREG and COL17A1, pivotal tumor suppressors, in response to EPB41L3 demethylation or overexpression in GC epithelial cells. CONCLUSION: In conclusion, this study elucidates the association between non-CpG methylation of EPB41L3 and GC progression and identifies the key transcription factors and downstream molecules involved. These findings enhance our understanding of the role of EPB41L3 in gastric cancer and provide a solid theoretical foundation for future research and potential clinical applications.


The EPB41L3 gene, frequently exhibiting haplotype deletions and reduced expression in gastric cancer tissues, points to its potential role as a tumor suppressor. However, tumor suppressor genes are not only influenced by genomic deletions but also by their methylation status. Our study highlights the significantly lower expression of EPB41L3 in gastric cancer compared to adjacent non-cancerous tissues across 262 patients. We also discovered that elevated non-CpG island methylation of EPB41L3 correlates strongly with tumor malignancy progression, based on the analysis of 70 paired gastric cancer samples. Moreover, we identified CDC5L as a crucial transcription factor interacting with the EPB41L3 promoter. Integrative analyses of transcriptomic and single-cell sequencing data further revealed that AREG and COL17A1 are key downstream molecules regulated by DAL-1, with their expression tightly controlled by EPB41L3 methylation and expression levels. These insights enhance our understanding of EPB41L3's role in gastric cancer and could open new avenues for targeted therapies.


Assuntos
Metilação de DNA , Regulação Neoplásica da Expressão Gênica , Regiões Promotoras Genéticas , Neoplasias Gástricas , Neoplasias Gástricas/genética , Neoplasias Gástricas/patologia , Neoplasias Gástricas/metabolismo , Humanos , Metilação de DNA/genética , Feminino , Masculino , Pessoa de Meia-Idade , Regiões Promotoras Genéticas/genética , Linhagem Celular Tumoral , Idoso , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Proteínas dos Microfilamentos
6.
J Proteome Res ; 22(11): 3570-3579, 2023 11 03.
Artigo em Inglês | MEDLINE | ID: mdl-37831546

RESUMO

Identification of unique and specific biomarkers to better detect and quantify senescent cells remains challenging. By a global proteomic profiling of senescent human skin BJ fibroblasts induced by ionizing radiation (IR), the cellular level of pregnancy zone protein (PZP), a presumable pan-protease inhibitor never been linked to cellular senescence before, was found to be decreased by more than 10-fold, while the level of PZP in the conditioned medium was increased concomitantly. This observation was confirmed in a variety of senescent cells induced by IR or DNA-damaging drugs, indicating that high-level secretion of PZP is a novel senescence-associated secretory phenotype. RT-PCR examination verified that the transcription of the PZP gene is enhanced in various cells at senescence or upregulated following DNA damage treatment in a p53-independent manner. Moreover, pretreatment with late pregnancy serum containing a high level of PZP led to inhibition of doxorubicin-induced senescence in A549 cells, and depletion of PZP in the pregnancy serum could enhance such inhibition. Finally, the addition of immuno-precipitated PZP complexes into tissue culture attenuated the growth of A549 cells and promoted the spontaneous senescence. Therefore, we revealed that high-level secretion of PZP is a novel and unique feature associated with DNA damage-induced senescence, and secreted PZP is a positive regulator of cellular senescence, particularly during the late stage of gestation.


Assuntos
Senescência Celular , Dano ao DNA , Proteínas da Gravidez , Humanos , Biomarcadores/metabolismo , Senescência Celular/genética , Proteômica , Pele/metabolismo , Proteínas da Gravidez/metabolismo , Fibroblastos , Células A549
7.
J Cell Mol Med ; 27(16): 2424-2436, 2023 08.
Artigo em Inglês | MEDLINE | ID: mdl-37386793

RESUMO

The locus at 17q12 erb-b2 receptor tyrosine kinase 2 (ERBB2) has been heavily amplificated and overexpressed in gastric cancer (GC), but it remains to be elucidated about the clinical significance of the co-amplification and co-overexpression of PGAP3 gene located around ERBB2 in GC. The profile of PGAP3 and ERBB2 in four GC cell lines and tissue microarrays containing 418 primary GC tissues was assessed to investigate the co-overexpression and clinical significance of the co-amplified genes, and to evaluate the impact of the co-amplified genes on the malignancy of GC. Co-amplification of PGAP3 and ERBB2 accompanied with co-overexpression was observed in a haploid chromosome 17 of NCI-N87 cells with double minutes (DMs). PGAP3 and ERBB2 were overexpressed and positively correlated in 418 GC patients. Co-overexpression of the PGAP3 and ERBB2 was correlated with T stage, TNM stage, tumour size, intestinal histological type and poor survival proportion in 141 GC patients. In vitro, knockdown of the endogenous PGAP3 or ERBB2 decreased cell proliferation and invasion, increased G1 phase accumulation and induced apoptosis in NCI-N87 cells. Furthermore, combined silencing of PGAP3 and ERBB2 showed an additive effect on resisting proliferation of NCI-N87 cells compared with targeting ERBB2 or PGAP3 alone. Taken together, the co-overexpression of PGAP3 and ERBB2 may be crucial due to its significant correlation with clinicopathological factors of GC. Haploid gain of PGAP3 co-amplified with ERBB2 is sufficient to facilitate the malignancy and progression of GC cells in a synergistic way.


Assuntos
Receptor ErbB-2 , Neoplasias Gástricas , Humanos , Receptor ErbB-2/genética , Receptor ErbB-2/metabolismo , Neoplasias Gástricas/patologia , Linhagem Celular Tumoral , Proliferação de Células/genética , Hidrolases de Éster Carboxílico , Receptores de Superfície Celular
8.
AIDS Res Ther ; 20(1): 51, 2023 07 19.
Artigo em Inglês | MEDLINE | ID: mdl-37468905

RESUMO

BACKGROUND: MSM are at high risk of HIV infection. Previous studies have shown that the cell cycle regulation plays an important role in HIV-1 infection, especially at the G2/M checkpoint. ATR, Chk1, Cdc25C and CDK1 are key genes of G2/M checkpoint. However, the association between SNPs of these genes and susceptibility to HIV-1 infection and AIDS progression remains unknown. METHODS: In this study, 42 tSNPs from the above four G2/M checkpoint genes were genotyped in 529 MSM and 529 control subjects from northern China to analyze this association. RESULTS: The results showed that rs34660854 A and rs75368165 A in ATR gene and rs3756766 A in Cdc25C gene could increase the risk of HIV-1 infection (P = 0.049, OR = 1.234, 95% CI 1.001-1.521; P = 0.020, OR = 1.296, 95% CI 1.042-1.611; P = 0.011, OR = 1.392, 95% CI 1.080-1.794, respectively), while Chk1 rs10893405 (P = 0.029, OR = 1.629, 95% CI 1.051-2.523) were significantly associated with AIDS progression. Besides, rs34660854 (P = 0.019, OR = 1.364, 95% CI 1.052-1.769; P = 0.022, OR = 1.337, 95% CI 1.042-1.716, under Codominant model and Dominant model, respectively) and rs75368165 (P = 0.006, OR = 1.445, 95% CI = 1.114-1.899; P = 0.007, OR = 1.418, 95% CI 1.099-1.831, under Codominant model and Dominant model, respectively) in ATR gene, rs12576279 (P = 0.013, OR = 0.343, 95% CI 0.147-0.800; P = 0.048, OR = 0.437, 95% CI 0.192-0.991, under Codominant model and Dominant model, respectively) and rs540436 (P = 0.012, OR = 1.407, 95% CI 1.077-1.836; P = 0.021, OR = 1.359, 95% CI 1.048-1.762, under Codominant model and Dominant model, respectively) in Chk1 gene, rs3756766 (P = 0.013, OR = 1.455, 95% CI 1.083-1.954; P = 0.009, OR = 1.460, 95% CI 1.098-1.940, under Codominant model and Dominant model, respectively) in Cdc25C gene and rs139245206 (P = 0.022, OR = 5.011, 95% CI 1.267-19.816; P = 0.020, OR = 5.067, 95% CI 1.286-19.970, under Codominant model and Recessive model, respectively) in CDK1 gene were significantly associated with HIV-1 infection under different models. CONCLUSIONS: We found that genetic variants of G2/M checkpoint genes had a molecular influence on the occurrence of HIV-1 infection and AIDS progression in a northern Chinese MSM population.


Assuntos
Síndrome da Imunodeficiência Adquirida , Pontos de Checagem do Ciclo Celular , Infecções por HIV , Minorias Sexuais e de Gênero , Humanos , Masculino , Síndrome da Imunodeficiência Adquirida/epidemiologia , Síndrome da Imunodeficiência Adquirida/genética , População do Leste Asiático , Infecções por HIV/epidemiologia , Infecções por HIV/genética , HIV-1 , Homossexualidade Masculina , Pontos de Checagem do Ciclo Celular/genética
9.
BMC Genomics ; 23(1): 769, 2022 Nov 24.
Artigo em Inglês | MEDLINE | ID: mdl-36418931

RESUMO

BACKGROUND: Most susceptible loci of hepatocellular carcinoma (HCC) identified by genome-wide association studies (GWAS) are located in non-coding regions, and the mechanism of action remains unclear. The objective of this study was to explore the association of single nucleotide polymorphisms (SNPs) on long non-coding RNAs (lncRNAs) that affect competing endogenous RNAs (ceRNA) regulation mechanism with the risk and prognosis of HCC. METHODS: Based on a set of bioinformatics strategies, eight lncRNA genes that affect HCC through the mechanism of lncRNA-mediated ceRNA were systematically screened, and 15 SNPs that affect microRNA (miRNA) binding in these lncRNA genes were annotated. Genotyping was performed in 800 HCC cases and 801 healthy controls to examine associations of these SNPs with HCC in a northeastern Chinese Han population. RESULTS: The GG, GC and GG + GC genotypes of HOTAIR rs7958904 were associated with a 0.65, 0.59 and 0.63-fold decreased HCC risk, respectively. In addition, HCC patients with PVT1 rs3931282 AA + GA genotypes were less prone to develop late-stage cancers in a stratified analysis of clinical characteristics. When stratified by clinical biochemical indexes, rs1134492 and rs10589312 in PVT1 and rs84557 in EGFR-AS1 showed significant associations with aspartate aminotransferase (AST), alanine aminotransferase (ALT) or AST/ALT ratio in HCC patients. Furthermore, we constructed potential ceRNA regulatory axes that might be affected by five positive SNPs to explain the causes of these genetic associations. CONCLUSIONS: HOTAIR rs7958904, PVT1 rs3931282, rs1134492 and rs10589312, and EGFR-AS1 rs84557 might be predictors for HCC risk or prognosis. Our results provide new insights into how SNPs on lncRNA-mediated ceRNAs confer interindividual differences to occurrence and progression of HCC.


Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , RNA Longo não Codificante , Humanos , RNA Longo não Codificante/genética , Carcinoma Hepatocelular/genética , Polimorfismo de Nucleotídeo Único , Estudo de Associação Genômica Ampla , Neoplasias Hepáticas/genética , Prognóstico , Receptores ErbB
10.
Mol Carcinog ; 61(10): 910-923, 2022 10.
Artigo em Inglês | MEDLINE | ID: mdl-35801406

RESUMO

Ovarian cancer is the most lethal gynecological malignancy worldwide with high metastasis and poor prognosis rates. Cancer-associated fibroblasts (CAFs), a heterogeneous population of cells that constitutes a major component of the tumor microenvironment, secrete extracellular vesicles (EVs) loading with proteins, lipids, and RNAs to promote tumorigenesis. However, the specific roles of CAF-derived proteins contained in EVs in ovarian cancer remain poorly understood at present. Using the gene expression microarray analysis, we identified a list of dysregulated genes between the α-SMA+ CAF and FAP+ CAF subpopulations, from which secretory leukocyte protease inhibitor (SLPI) was chosen for further validation. Quantitative PCR, western blot, immunohistochemistry, and enzyme-linked immunosorbent assays were used to assess SLPI expression in ovarian cancer cells, tissues, CAFs, and EVs. Additionally, we evaluated the effects of exogenous SLPI on proliferation, migration, invasion, and adhesion of ovarian cancer cells in vitro. Our results showed SLPI protein was upregulated in CAFs, particularly in the FAPhigh α-SMAlow CAF subpopulation, and associated with increased tumor grade and decreased overall survival (OS). Importantly, CAF-derived SLPI protein could be encapsulated in EVs for delivery to ovarian cancer cells, thus facilitating cell proliferation, migration, invasion, and adhesion via activating the PI3K/AKT and downstream signaling pathways. Moreover, high plasma expression of SLPI encapsulated in EVs was closely correlated with tumor stage in ovarian cancer patients. Our collective results highlight an oncogenic role of plasma EV-encapsulated SLPI secreted by CAFs in tumor progression for the first time, supporting its potential utility as a prognostic biomarker of ovarian cancer.


Assuntos
Fibroblastos Associados a Câncer , Vesículas Extracelulares , Neoplasias Ovarianas , Fibroblastos Associados a Câncer/metabolismo , Carcinoma Epitelial do Ovário/metabolismo , Linhagem Celular Tumoral , Vesículas Extracelulares/genética , Vesículas Extracelulares/metabolismo , Feminino , Humanos , Neoplasias Ovarianas/genética , Neoplasias Ovarianas/metabolismo , Fosfatidilinositol 3-Quinases/metabolismo , Proteínas Proto-Oncogênicas c-akt/metabolismo , Inibidor Secretado de Peptidases Leucocitárias/metabolismo , Transdução de Sinais , Microambiente Tumoral
11.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 39(4): 438-441, 2022 Apr 10.
Artigo em Chinês | MEDLINE | ID: mdl-35446984

RESUMO

Genetic factors play a key role in human athletic ability, and endurance quality and explosive power quality are the important components of athletic ability. In this review, we aimed to reveal the biological genetic mechanism of human athletic ability at the molecular level through summarizing the relationship between genetic variants and human athletic ability, including endurance quality related genetic markers angiotensin converting enzyme (ACE) gene, creatine kinase MM (CKMM) gene and explosive power quality related genetic markers alpha actinin 3 (ACTN3) gene, angiotensinogen (AGT) gene and interleukin6 (IL6) gene. Meanwhile, we also summarized the distribution of allele frequencies among various populations.


Assuntos
Desempenho Atlético , Actinina/genética , Frequência do Gene , Marcadores Genéticos , Genótipo , Humanos , Polimorfismo Genético
12.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 39(1): 108-111, 2022 Jan 10.
Artigo em Chinês | MEDLINE | ID: mdl-34964980

RESUMO

Genetic background can lead to differences in drug effects among different populations when they use the same drug. To delineate the pharmacogenomics and population genetic differences may help to clarify the role of polymorphisms of drug metabolism-related genes in drug effect heterogeneity among different populations. This article has summarized the latest progress on the polymorphisms of drug metabolism-related genes among different populations in China.


Assuntos
Preparações Farmacêuticas , Polimorfismo Genético , China , Humanos , Farmacogenética
13.
Blood ; 133(20): 2222-2232, 2019 05 16.
Artigo em Inglês | MEDLINE | ID: mdl-30819925

RESUMO

l-Asparaginase (l-ASNase) is a strategic component of treatment protocols for acute lymphoblastic leukemia (ALL). It causes asparagine deficit, resulting in protein synthesis inhibition and subsequent leukemic cell death and ALL remission. However, patients often relapse because of the development of resistance, but the underlying mechanism of ALL cell resistance to l-asparaginase remains unknown. Through unbiased genome-wide RNA interference screening, we identified huntingtin associated protein 1 (HAP1) as an ALL biomarker for l-asparaginase resistance. Knocking down HAP1 induces l-asparaginase resistance. HAP1 interacts with huntingtin and the intracellular Ca2+ channel, inositol 1,4,5-triphosphate receptor to form a ternary complex that mediates endoplasmic reticulum (ER) Ca2+ release upon stimulation with inositol 1,4,5-triphosphate3 Loss of HAP1 prevents the formation of the ternary complex and thus l-asparaginase-mediated ER Ca2+ release. HAP1 loss also inhibits external Ca2+ entry, blocking an excessive rise in [Ca2+]i, and reduces activation of the Ca2+-dependent calpain-1, Bid, and caspase-3 and caspase-12, leading to reduced number of apoptotic cells. These findings indicate that HAP1 loss prevents l-asparaginase-induced apoptosis through downregulation of the Ca2+-mediated calpain-1-Bid-caspase-3/12 apoptotic pathway. Treatment with BAPTA-AM [1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid tetrakis(acetoxymethyl ester)] reverses the l-asparaginase apoptotic effect in control cells, supporting a link between l-asparaginase-induced [Ca2+]i increase and apoptotic cell death. Consistent with these findings, ALL patient leukemic cells with lower HAP1 levels showed resistance to l-asparaginase, indicating the clinical relevance of HAP1 loss in the development of l-asparaginase resistance, and pointing to HAP1 as a functional l-asparaginase resistance biomarker that may be used for the design of effective treatment of l-asparaginase-resistant ALL.


Assuntos
Antineoplásicos/uso terapêutico , Asparaginase/uso terapêutico , Proteínas do Tecido Nervoso/genética , Leucemia-Linfoma Linfoblástico de Células Precursoras/tratamento farmacológico , Adulto , Calpaína/metabolismo , Caspases/metabolismo , Regulação para Baixo/efeitos dos fármacos , Resistencia a Medicamentos Antineoplásicos , Feminino , Técnicas de Silenciamento de Genes , Humanos , Masculino , Leucemia-Linfoma Linfoblástico de Células Precursoras/genética , Leucemia-Linfoma Linfoblástico de Células Precursoras/metabolismo , Transdução de Sinais/efeitos dos fármacos , Células Tumorais Cultivadas , Adulto Jovem
14.
J Cell Mol Med ; 24(24): 14205-14216, 2020 12.
Artigo em Inglês | MEDLINE | ID: mdl-33124133

RESUMO

Gene amplification chiefly manifests as homogeneously stained regions (HSRs) or double minutes (DMs) in cytogenetically and extrachromosomal DNA (ecDNA) in molecular genetics. Evidence suggests that gene amplification is becoming a hotspot for cancer research, which may be a new treatment strategy for cancer. DMs usually carry oncogenes or chemoresistant genes that are associated with cancer progression, occurrence and prognosis. Defining the molecular structure of DMs will facilitate understanding of the molecular mechanism of tumorigenesis. In this study, we re-identified the origin and integral sequence of DMs in human colorectal adenocarcinoma cell line NCI-H716 by genetic mapping and sequencing strategy, employing high-resolution array-based comparative genomic hybridization, high-throughput sequencing, multiplex-fluorescence in situ hybridization and chromosome walking techniques. We identified two distinct populations of DMs in NCI-H716, confirming their heterogeneity in cancer cells, and managed to construct their molecular structure, which were not investigated before. Research evidence of amplicons distribution in two different populations of DMs suggested that a multi-step evolutionary model could fit the module of DM genesis better in NCI-H716 cell line. In conclusion, our data implicated that DMs play a very important role in cancer progression and further investigation is necessary to uncover the role of the DMs.


Assuntos
Neoplasias Colorretais/genética , Evolução Molecular , Amplificação de Genes , Sequência de Bases , Linhagem Celular Tumoral , Aberrações Cromossômicas , Pontos de Quebra do Cromossomo , Passeio de Cromossomo , Cromossomos Humanos Par 10 , Cromossomos Humanos Par 8 , Neoplasias Colorretais/patologia , Hibridização Genômica Comparativa , Análise Citogenética/métodos , Humanos , Hibridização in Situ Fluorescente
15.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 37(3): 308-312, 2020 Mar 10.
Artigo em Chinês | MEDLINE | ID: mdl-32128749

RESUMO

Rett syndrome (RTT) is a neurodevelopmental disorder mainly affecting the females. It is closely associated with mutations of methylated CpG binding protein 2 ((MeCP2))] gene on the X chromosome. The incidence of RTT in females is 1/15 000 - 1/10 000. Its clinical features include mental retardation, loss of language function, rigid movement of hands, and abnormal gait. Currently there is no cure for the disease but only symptomatic treatment. The compilation of this guideline has referred to the third edition of Diagnostic Standard of RTT as revised in 2010, and integrated the latest findings of clinical research at home and abroad, in addition with conditions and clinical practice in China, with an aim to provide guidance for the clinical diagnosis, treatment and genetic counseling of patients with RTT.


Assuntos
Guias de Prática Clínica como Assunto , Síndrome de Rett/diagnóstico , Síndrome de Rett/terapia , China , Feminino , Humanos , Proteína 2 de Ligação a Metil-CpG/genética , Mutação
16.
Int J Cancer ; 144(5): 1037-1048, 2019 03 01.
Artigo em Inglês | MEDLINE | ID: mdl-30070702

RESUMO

Gene amplification, which involves the two major topographical structures double minutes (DMs) and homegeneously stained region (HSR), is a common mechanism of treatment resistance in cancer and is initiated by DNA double-strand breaks. NHEJ, one of DSB repair pathways, is involved in gene amplification as we demonstrated previously. However, the involvement of homologous recombination, another DSB repair pathway, in gene amplification remains to be explored. To better understand the association between HR and gene amplification, we detected HR activity in DM- and HSR-containing MTX-resistant HT-29 colon cancer cells. In DM-containing MTX-resistant cells, we found increased homologous recombination activity compared with that in MTX-sensitive cells. Therefore, we suppressed HR activity by silencing BRCA1, the key player in the HR pathway. The attenuation of HR activity decreased the numbers of DMs and DM-form amplified gene copies and increased the exclusion of micronuclei and nuclear buds that contained DM-form amplification; these changes were accompanied by cell cycle acceleration and increased MTX sensitivity. In contrast, BRCA1 silencing did not influence the number of amplified genes and MTX sensitivity in HSR-containing MTX-resistant cells. In conclusion, our results suggest that the HR pathway plays different roles in extrachromosomal and intrachromosomal gene amplification and may be a new target to improve chemotherapeutic outcome by decreasing extrachromosomal amplification in cancer.


Assuntos
Cromossomos/genética , Neoplasias do Colo/tratamento farmacológico , Neoplasias do Colo/genética , Resistencia a Medicamentos Antineoplásicos/genética , Amplificação de Genes/genética , Recombinação Homóloga/genética , Metotrexato/farmacologia , Ciclo Celular/genética , Linhagem Celular Tumoral , Núcleo Celular/genética , Aberrações Cromossômicas , Quebras de DNA de Cadeia Dupla , Células HT29 , Humanos
17.
J Antimicrob Chemother ; 74(7): 2009-2018, 2019 07 01.
Artigo em Inglês | MEDLINE | ID: mdl-30989233

RESUMO

BACKGROUND: Previous studies reported that DNA damage repair (DDR) genes may play an important role in HIV-1 infection. The MRE11 gene, a member of the MRN complex, plays an essential part in the homologous recombination pathway, which is one of the classical DDR pathways. Previous reports have demonstrated that MRE11 has an effect on HIV-1 replication. However, the role of SNPs in the MRE11 gene and their impact on HIV-1 infection and AIDS progression remain unknown. METHODS: In this study, 434 MSM HIV-1-infected patients in northern China and 431 age-matched healthy controls were enrolled. Five SNPs (rs2155209, rs10831234, rs13447720, rs601341 and rs11020803) at the MRE11 gene were genotyped. Another series of cases (409 MSM HIV-1-infected patients) and controls (403 age-matched healthy males) were recruited as the validation set. RESULTS: In our study, rs10831234 showed differences in allele frequencies between cases and controls (P = 0.005). Additionally, there was an association between rs10831234 and HIV-1 infection susceptibility in dominant and additive models (P = 0.005 and P = 0.006, respectively). All significant associations were replicated in the validation set, and the associations were still significant after Bonferroni correction for multiple testing when the two data sets were combined. Furthermore, in haplotype association analyses between the case and control groups, the frequencies of the haplotypes Crs11020803Crs10831234 and Trs11020803Trs10831234 showed significant differences (P = 0.0181 and P = 0.0068, respectively). CONCLUSIONS: We demonstrated that the MRE11 rs10831234-T allele may confer increased risk of HIV-1 infection.


Assuntos
Predisposição Genética para Doença , Infecções por HIV/genética , Infecções por HIV/virologia , HIV-1/fisiologia , Homossexualidade Masculina , Proteína Homóloga a MRE11/genética , Polimorfismo de Nucleotídeo Único , Síndrome da Imunodeficiência Adquirida/epidemiologia , Síndrome da Imunodeficiência Adquirida/genética , Síndrome da Imunodeficiência Adquirida/virologia , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Alelos , Estudos de Casos e Controles , China/epidemiologia , Frequência do Gene , Genótipo , Infecções por HIV/epidemiologia , Infecções por HIV/imunologia , Haplótipos , Humanos , Desequilíbrio de Ligação , Masculino , Pessoa de Meia-Idade , Razão de Chances , Carga Viral , Adulto Jovem
18.
BMC Med Genet ; 20(1): 203, 2019 12 23.
Artigo em Inglês | MEDLINE | ID: mdl-31870337

RESUMO

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.


Assuntos
Duplicação Gênica , Heterozigoto , Proteínas de Homeodomínio/genética , Mutação , Sindactilia/genética , Fatores de Transcrição/genética , Criança , China , Éxons , Feminino , Humanos , Masculino , Linhagem
19.
BMC Cancer ; 19(1): 613, 2019 Jun 21.
Artigo em Inglês | MEDLINE | ID: mdl-31226964

RESUMO

BACKGROUND: Hereditary cancer syndromes have inherited germline mutations which predispose to benign and malignant tumors. Understanding of the molecular causes in hereditary cancer syndromes has advanced cancer treatment and prevention. However, the causal genes of many hereditary cancer syndromes remain unknown due to their rare frequency of mutation. METHODS: A large Chinese family with a history of hereditary liver-colon cancer syndrome was studied. The genomic DNA was extracted from the blood samples of involved family members, whole-exome sequencing was performed to identify genetic variants. Functional validation of a candidate variant was carried out using gene expression, gene knockout and immunohistochemistry. RESULTS: The whole-exome of the proband diagnosed with colon cancer was sequenced in comparison with his mother. A total of 13 SNVs and 16 InDels were identified. Among these variants, we focused on a mutation of Rab43 gene, a GTPase family member involving in protein trafficking, for further validation. Sanger DNA sequencing confirmed a mutation (c: 128810106C > T, p: A158T) occurred in one allele of Rab43 gene from the proband, that heterozygous mutation also was verified in the genome of the proband's deceased father with liver cancer, but not in his healthy mother and sister. Ectopic expression of the Rab43 A158T mutant in Huh7 cells led to more enhanced cell growth, proliferation and migration compared to the expression of wild type Rab43. Conversely, knockout of Rab43 in HepG2 cells resulted in slow cell growth and multiple nuclei formation and impaired activation of Akt. Finally, a positive correlation between the expression levels of Rab43 protein and cancer development in that family was confirmed. CONCLUSIONS: A germline mutation of Rab43 gene is identified to be associated with the onset of a familial liver-colon cancer syndrome. Our finding points to a potential role of protein trafficking in the tumorigenesis of the familial cancer syndrome, and helps the genetic counseling to the affected family members.


Assuntos
Neoplasias do Colo/genética , Predisposição Genética para Doença , Mutação em Linhagem Germinativa , Neoplasias Hepáticas/genética , Síndromes Neoplásicas Hereditárias/genética , Proteínas rab de Ligação ao GTP/genética , Alelos , Carcinogênese/genética , Neoplasias do Colo/sangue , Feminino , Técnicas de Inativação de Genes , Células HeLa , Células Hep G2 , Humanos , Neoplasias Hepáticas/sangue , Masculino , Pessoa de Meia-Idade , Síndromes Neoplásicas Hereditárias/sangue , Linhagem , Proteínas Proto-Oncogênicas c-akt/metabolismo , Análise de Sequência de DNA , Sequenciamento do Exoma
20.
BMC Genomics ; 19(1): 134, 2018 02 12.
Artigo em Inglês | MEDLINE | ID: mdl-29433421

RESUMO

BACKGROUND: Heilongjiang Province located in northeast China is a multi-ethnic region with people who have lived in cold conditions for several generations. Fatty acids are important to people with cold resistance. CPT1A encodes a protein that imports long-chain fatty acids into the mitochondria for fatty-acid oxidation. FADS is an essential enzyme for the synthesis of long-chain polyunsaturated fatty acids. RESULTS: In the present study, we investigated the distributions of three cold resistance-related SNPs (rs80356779 G > A in CPT1A, rs7115739 T > G in FADS3 and rs174570 C > T in FADS2) from six populations that included 1093 individuals who have lived in Heilongjiang Province for at least three generations. The frequencies of rs174570 and rs7115739 were different in our six north minorities compared to the Chinese Dai in Xishuangbanna (CDX) in southern China. All the SNPs in Hezhen were significantly different from other five studied populations. In addition, the genetic distribution of rs174570 in Daur was significantly different from Manchu and Korea, and the frequency of rs7115739 in Ewenki was significantly different from the other populations. The results also showed that the frequencies of the three SNPs in the six minorities were different from those of Greenlandic Inuit and Siberian population. CONCLUSIONS: Our results showed the distributions of the three cold resistance-related SNPs from six populations that included 1093 individuals in northern China. Distributions of the allele frequencies for the cold resistance-related SNPs in northern China were statistically different from those in southern China. These data help to establish the DNA genome database for the six populations and fully preserve existing minority genetic information.


Assuntos
Adaptação Fisiológica/genética , Temperatura Baixa , Etnicidade/genética , Polimorfismo de Nucleotídeo Único , Povo Asiático/genética , Carnitina O-Palmitoiltransferase/genética , China , Etnicidade/classificação , Ácidos Graxos Dessaturases/genética , Frequência do Gene , Genótipo , Humanos , Desequilíbrio de Ligação , Filogenia
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA