Effective prediction of SnO2 conduction band edge potential: The key role of surface oxygen vacancies.

Several theoretical studies at different levels of theory have attempted to calculate the absolute position of the SnO2 conduction band, whose knowledge is key for its effective application in optoelectronic devices such us, for example, perovskite solar cells. However, the predicted band edges fall outside the experimentally measured range. In this work, we introduce a computational scheme designed to calculate the conduction band minimum values of SnO2, yielding results aligned with experiments. Our analysis points out the fundamental role of encompassing surface oxygen vacancies to properly describe the electronic profile of this material. We explore the impact of both bridge and in-plane oxygen vacancy defects on the structural and electronic properties of SnO2, explaining from an atomistic perspective the experimental observables. The results underscore the importance of simulating both types of defects to accurately predict SnO2 features and provide new fundamental insights that can guide future studies concerning design and optimization of SnO2-based materials and functional interfaces.

Antimony-Bismuth Alloying: The Key to a Major Boost in the Efficiency of Lead-Free Perovskite-Inspired Photovoltaics.

The perovskite-inspired Cu2 AgBiI6 (CABI) material has been gaining increasing momentum as photovoltaic (PV) absorber due to its low toxicity, intrinsic air stability, direct bandgap, and a high absorption coefficient in the range of 105  cm-1 . However, the power conversion efficiency (PCE) of existing CABI-based PVs is still seriously constrained by the presence of both intrinsic and surface defects. Herein, antimony (III) (Sb3+ ) is introduced into the octahedral lattice sites of the CABI structure, leading to CABI-Sb with larger crystalline domains than CABI. The alloying of Sb3+ with bismuth (III) (Bi3+ ) induces changes in the local structural symmetry that dramatically increase the formation energy of intrinsic defects. Light-intensity dependence and electron impedance spectroscopic studies show reduced trap-assisted recombination in the CABI-Sb PV devices. CABI-Sb solar cells feature a nearly 40% PCE enhancement (from 1.31% to 1.82%) with respect to the CABI devices mainly due to improvement in short-circuit current density. This work will promote future compositional design studies to enhance the intrinsic defect tolerance of next-generation wide-bandgap absorbers for high-performance and stable PVs.

A One Health approach revealed the long-term role of Mycobacterium caprae as the hidden cause of human tuberculosis in a region of Spain, 2003 to 2022.

IntroductionMycobacterium caprae is a member of the Mycobacterium tuberculosis complex (MTBC) not routinely identified to species level. It lacks specific clinical features of presentation and may therefore not be identified as the causative agent of tuberculosis. Use of whole genome sequencing (WGS) in the investigation of a family microepidemic of tuberculosis in Almería, Spain, unexpectedly identified the involvement of M. caprae.AimWe aimed to evaluate the presence of additional unidentified M. caprae cases and to determine the magnitude of this occurrence.MethodsFirst-line characterisation of the MTBC isolates was done by MIRU-VNTR, followed by WGS. Human and animal M. caprae isolates were integrated in the analysis.ResultsA comprehensive One Health strategy allowed us to (i) detect other 11 M. caprae infections in humans in a period of 18 years, (ii) systematically analyse M. caprae infections on an epidemiologically related goat farm and (iii) geographically expand the study by including 16 M. caprae isolates from other provinces. Integrative genomic analysis of 41 human and animal M. caprae isolates showed a high diversity of strains. The animal isolates' diversity was compatible with long-term infection, and close genomic relationships existed between isolates from goats on the farm and recent cases of M. caprae infection in humans.DiscussionZoonotic circulation of M. caprae strains had gone unnoticed for 18 years. Systematic characterisation of MTBC at species level and/or extended investigation of the possible sources of exposure in all tuberculosis cases would minimise the risk of overlooking similar zoonotic events.

In Situ Formation of Zwitterionic Ligands: Changing the Passivation Paradigms of CsPbBr3 Nanocrystals.

CsPbBr3 nanocrystals (NCs) passivated by conventional lipophilic capping ligands suffer from colloidal and optical instability under ambient conditions, commonly due to the surface rearrangements induced by the polar solvents used for the NC purification steps. To avoid onerous postsynthetic approaches, ascertained as the only viable stability-improvement strategy, the surface passivation paradigms of as-prepared CsPbBr3 NCs should be revisited. In this work, the addition of an extra halide source (8-bromooctanoic acid) to the typical CsPbBr3 synthesis precursors and surfactants leads to the in situ formation of a zwitterionic ligand already before cesium injection. As a result, CsPbBr3 NCs become insoluble in nonpolar hexane, with which they can be washed and purified, and form stable colloidal solutions in a relatively polar medium (dichloromethane), even when longly exposed to ambient conditions. The improved NC stability stems from the effective bidentate adsorption of the zwitterionic ligand on the perovskite surfaces, as supported by theoretical investigations. Furthermore, the bidentate functionalization of the zwitterionic ligand enables the obtainment of blue-emitting perovskite NCs with high PLQYs by UV-irradiation in dichloromethane, functioning as the photoinduced chlorine source.

Dye-sensitized solar cells strike back.

Dye-sensitized solar cells (DSCs) are celebrating their 30th birthday and they are attracting a wealth of research efforts aimed at unleashing their full potential. In recent years, DSCs and dye-sensitized photoelectrochemical cells (DSPECs) have experienced a renaissance as the best technology for several niche applications that take advantage of DSCs' unique combination of properties: at low cost, they are composed of non-toxic materials, are colorful, transparent, and very efficient in low light conditions. This review summarizes the advancements in the field over the last decade, encompassing all aspects of the DSC technology: theoretical studies, characterization techniques, materials, applications as solar cells and as drivers for the synthesis of solar fuels, and commercialization efforts from various companies.

Identification of Transcriptional Networks Involved in De Novo Organ Formation in Tomato Hypocotyl Explants.

Some of the hormone crosstalk and transcription factors (TFs) involved in wound-induced organ regeneration have been extensively studied in the model plant Arabidopsis thaliana. In previous work, we established Solanum lycopersicum "Micro-Tom" explants without the addition of exogenous hormones as a model to investigate wound-induced de novo organ formation. The current working model indicates that cell reprogramming and founder cell activation requires spatial and temporal regulation of auxin-to-cytokinin (CK) gradients in the apical and basal regions of the hypocotyl combined with extensive metabolic reprogramming of some cells in the apical region. In this work, we extended our transcriptomic analysis to identify some of the gene regulatory networks involved in wound-induced organ regeneration in tomato. Our results highlight a functional conservation of key TF modules whose function is conserved during de novo organ formation in plants, which will serve as a valuable resource for future studies.

An auxin-mediated regulatory framework for wound-induced adventitious root formation in tomato shoot explants.

Adventitious roots (ARs) are produced from non-root tissues in response to different environmental signals, such as abiotic stresses, or after wounding, in a complex developmental process that requires hormonal crosstalk. Here, we characterized AR formation in young seedlings of Solanum lycopersicum cv. 'Micro-Tom' after whole root excision by means of physiological, genetic and molecular approaches. We found that a regulated basipetal auxin transport from the shoot and local auxin biosynthesis triggered by wounding are both required for the re-establishment of internal auxin gradients within the vasculature. This promotes cell proliferation at the distal cambium near the wound in well-defined positions of the basal hypocotyl and during a narrow developmental window. In addition, a pre-established pattern of differential auxin responses along the apical-basal axis of the hypocotyl and an as of yet unknown cell-autonomous inhibitory pathway contribute to the temporal and spatial patterning of the newly formed ARs on isolated hypocotyl explants. Our work provides an experimental outline for the dissection of wound-induced AR formation in tomato, a species that is suitable for molecular identification of gene regulatory networks via forward and reverse genetics approaches.

Tissue-Specific Metabolic Reprogramming during Wound-Induced Organ Formation in Tomato Hypocotyl Explants.

Plants have remarkable regenerative capacity, which allows them to survive tissue damage after exposure to biotic and abiotic stresses. Some of the key transcription factors and hormone crosstalk mechanisms involved in wound-induced organ regeneration have been extensively studied in the model plant Arabidopsis thaliana. However, little is known about the role of metabolism in wound-induced organ formation. Here, we performed detailed transcriptome analysis and used a targeted metabolomics approach to study de novo organ formation in tomato hypocotyl explants and found tissue-specific metabolic differences and divergent developmental pathways. Our results indicate that successful regeneration in the apical region of the hypocotyl depends on a specific metabolic switch involving the upregulation of photorespiratory pathway components and the differential regulation of photosynthesis-related gene expression and gluconeogenesis pathway activation. These findings provide a useful resource for further investigation of the molecular mechanisms involved in wound-induced organ formation in crop species such as tomato.

Dynamic Hormone Gradients Regulate Wound-Induced de novo Organ Formation in Tomato Hypocotyl Explants.

Plants have a remarkable regenerative capacity, which allows them to survive tissue damage after biotic and abiotic stresses. In this study, we use Solanum lycopersicum 'Micro-Tom' explants as a model to investigate wound-induced de novo organ formation, as these explants can regenerate the missing structures without the exogenous application of plant hormones. Here, we performed simultaneous targeted profiling of 22 phytohormone-related metabolites during de novo organ formation and found that endogenous hormone levels dynamically changed after root and shoot excision, according to region-specific patterns. Our results indicate that a defined temporal window of high auxin-to-cytokinin accumulation in the basal region of the explants was required for adventitious root formation and that was dependent on a concerted regulation of polar auxin transport through the hypocotyl, of local induction of auxin biosynthesis, and of local inhibition of auxin degradation. In the apical region, though, a minimum of auxin-to-cytokinin ratio is established shortly after wounding both by decreasing active auxin levels and by draining auxin via its basipetal transport and internalization. Cross-validation with transcriptomic data highlighted the main hormonal gradients involved in wound-induced de novo organ formation in tomato hypocotyl explants.

Using a B-Phycoerythrin Extract as a Natural Colorant: Application in Milk-Based Products.

Nowadays, there is a growing interest in finding new coloring molecules of natural origin that can increase and diversify the offer of natural food dyes already present in the market. In the present work, a B-phycoerythrin extract from the microalgae Porphyridium cruentum was tested as a food colorant in milk-based products. Using spectroscopy and colorimetry, the extract was characterized and gave evidence of good properties and good stability in the pH range between 4.0 and 9.0. Coloring studies were conducted to demonstrate that samples carrying the pink extract could be used for simulating the pink color of marketed milk-based products. The staining factors, representing the amount of pink protein to be added to reproduce the color of strawberry commercial products, ranged between 1.6 mg/L and 49.5 mg/L, being sufficiently low in all samples. Additionally, color stability during a short period of cold storage was studied: it demonstrated that the three tested types of dairy products remained stable throughout the 11-day analysis period with no significant changes. These results prove the potential of the B-phycoerythrin extract as a natural colorant and alternative ingredient to synthetic coloring molecules.

First report of Grapevine asteroid mosaic associated virus in grapevine in Spain.

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

Arabidopsis MAS2, an Essential Gene That Encodes a Homolog of Animal NF-κ B Activating Protein, Is Involved in 45S Ribosomal DNA Silencing.

Ribosome biogenesis requires stoichiometric amounts of ribosomal proteins and rRNAs. Synthesis of rRNAs consumes most of the transcriptional activity of eukaryotic cells, but its regulation remains largely unclear in plants. We conducted a screen for ethyl methanesulfonate-induced suppressors of Arabidopsis thaliana ago1-52, a hypomorphic allele of AGO1 (ARGONAUTE1), a key gene in microRNA pathways. We identified nine extragenic suppressors as alleles of MAS2 (MORPHOLOGY OF AGO1-52 SUPPRESSED2). Positional cloning showed that MAS2 encodes the putative ortholog of NKAP (NF-κ B activating protein), a conserved eukaryotic protein involved in transcriptional repression and splicing in animals. The mas2 point mutations behave as informational suppressors of ago1 alleles that cause missplicing. MAS2 is a single-copy gene whose insertional alleles are embryonic lethal. In yeast two-hybrid assays, MAS2 interacted with splicing and ribosome biogenesis proteins, and fluorescence in situ hybridization showed that MAS2 colocalizes with the 45S rDNA at the nucleolar organizer regions (NORs). The artificial microRNA amiR-MAS2 partially repressed MAS2 and caused hypomethylation of 45S rDNA promoters as well as partial NOR decondensation, indicating that MAS2 negatively regulates 45S rDNA expression. Our results thus reveal a key player in the regulation of rRNA synthesis in plants.

Drug-to-drug interactions of tyrosine kinase inhibitors in chronic myeloid leukemia patients. Is it a real problem?

With tyrosine kinase inhibitors (TKI), chronic myeloid leukemia (CML) patients are achieving similar rates of survival to the general population and some treatment aspects such as adherence and drug-to-drug interactions (DDI) are becoming increasingly important. Our aim was to investigate the frequency and real clinical consequences of DDI between TKI and concurrent medications in CML. We performed a retrospective multicenter study including 105 patients receiving 134 TKI treatments. Sixty-three patients (60%) had at least one potential DDI. The mean number of concomitant medications was 4.8 (0-19). The mean number of DDI by TKI treatment was 1.2 (0-8); it increased with the number of concomitant medications and age in a significant manner. A total of 159 DDI were detected, involving 55 different drugs. The most common drug classes involved were proton pump inhibitors, statins, and antidepressants. A DDI-related clinical effect (toxicity and/or lack of efficacy) was suspected during the common course of patient follow-up in only five patients (4.7%). This number increased to 20% when data were centrally reviewed. Most of the adverse events (AE) attributed to DDIs were mild. The most common were diarrhea, vomiting, edema, cramps, and transaminitis. Nilotinib and dasatinib showed a tendency towards a higher risk of DDI compared with imatinib. There were no significant differences in AE frequency or in treatment response between patients with or without DDI. Due to their frequency, and their potential to cause clinically relevant effects, DDI are an important aspect of CML management.

Grapevine virus T is relatively widespread in Slovakia and Czech Republic and genetically diverse.

A recently described putative foveavirus, grapevine virus T (GVT), was detected in a Slovak grapevine accession (SK704) using high-throughput sequencing, prompting further studies. Full-length genome sequence of isolate GVT-SK704 was determined. Analyses revealed 86.1% nucleotide identity with the Italian GVT isolate, currently the only available nearly complete sequence of GVT in GenBank. A virus-specific RT-PCR assay was developed, which enabled a survey of GVT incidence in grapevine samples from Slovakia and Czech Republic. Unexpectedly, GVT was present in ~ 30% of tested samples. Analysis of complete CP gene sequences of 20 Slovak and Czech GVT isolates detected in the survey revealed relatively high intra-species variability (up to 11.2% nucleotide divergence), suggesting multiple introductions from different sources, possibly over an extended period of time.

Copper Bipyridyl Redox Mediators for Dye-Sensitized Solar Cells with High Photovoltage.

Redox mediators play a major role determining the photocurrent and the photovoltage in dye-sensitized solar cells (DSCs). To maintain the photocurrent, the reduction of oxidized dye by the redox mediator should be significantly faster than the electron back transfer between TiO2 and the oxidized dye. The driving force for dye regeneration with the redox mediator should be sufficiently low to provide high photovoltages. With the introduction of our new copper complexes as promising redox mediators in DSCs both criteria are satisfied to enhance power conversion efficiencies. In this study, two copper bipyridyl complexes, Cu(II/I)(dmby)2TFSI2/1 (0.97 V vs SHE, dmby = 6,6'-dimethyl-2,2'-bipyridine) and Cu(II/I)(tmby)2TFSI2/1 (0.87 V vs SHE, tmby = 4,4',6,6'-tetramethyl-2,2'-bipyridine), are presented as new redox couples for DSCs. They are compared to previously reported Cu(II/I)(dmp)2TFSI2/1 (0.93 V vs SHE, dmp = bis(2,9-dimethyl-1,10-phenanthroline). Due to the small reorganization energy between Cu(I) and Cu(II) species, these copper complexes can sufficiently regenerate the oxidized dye molecules with close to unity yield at driving force potentials as low as 0.1 V. The high photovoltages of over 1.0 V were achieved by the series of copper complex based redox mediators without compromising photocurrent densities. Despite the small driving forces for dye regeneration, fast and efficient dye regeneration (2-3 µs) was observed for both complexes. As another advantage, the electron back transfer (recombination) rates were slower with Cu(II/I)(tmby)2TFSI2/1 as evidenced by longer lifetimes. The solar-to-electrical power conversion efficiencies for [Cu(tmby)2]2+/1+, [Cu(dmby)2]2+/1+, and [Cu(dmp)2]2+/1+ based electrolytes were 10.3%, 10.0%, and 10.3%, respectively, using the organic Y123 dye under 1000 W m-2 AM1.5G illumination. The high photovoltaic performance of Cu-based redox mediators underlines the significant potential of the new redox mediators and points to a new research and development direction for DSCs.

Effective scheme for partitioning covalent bonds in density-functional embedding theory: From molecules to extended covalent systems.

Density-functional embedding theory provides a general way to perform multi-physics quantum mechanics simulations of large-scale materials by dividing the total system's electron density into a cluster's density and its environment's density. It is then possible to compute the accurate local electronic structures and energetics of the embedded cluster with high-level methods, meanwhile retaining a low-level description of the environment. The prerequisite step in the density-functional embedding theory is the cluster definition. In covalent systems, cutting across the covalent bonds that connect the cluster and its environment leads to dangling bonds (unpaired electrons). These represent a major obstacle for the application of density-functional embedding theory to study extended covalent systems. In this work, we developed a simple scheme to define the cluster in covalent systems. Instead of cutting covalent bonds, we directly split the boundary atoms for maintaining the valency of the cluster. With this new covalent embedding scheme, we compute the dehydrogenation energies of several different molecules, as well as the binding energy of a cobalt atom on graphene. Well localized cluster densities are observed, which can facilitate the use of localized basis sets in high-level calculations. The results are found to converge faster with the embedding method than the other multi-physics approach ONIOM. This work paves the way to perform the density-functional embedding simulations of heterogeneous systems in which different types of chemical bonds are present.

Gene expression profiling during adventitious root formation in carnation stem cuttings.

BACKGROUND: Adventitious root (AR) formation is a critical step in vegetative propagation of most ornamental plants, such as carnation. AR formation from stem cuttings is usually divided into several stages according to physiological and metabolic markers. Auxin is often applied exogenously to promote the development of ARs on stem cuttings of difficult-to-root genotypes. RESULTS: By whole transcriptome sequencing, we identified the genes involved in AR formation in carnation cuttings and in response to exogenous auxin. Their expression profiles have been analysed through RNA-Seq during a time-course experiment in the stem cutting base of two cultivars with contrasting efficiencies of AR formation. We explored the kinetics of root primordia formation in these two cultivars and in response to exogenously-applied auxin through detailed histological and physiological analyses. CONCLUSIONS: Our results provide, for the first time, a number of molecular, histological and physiological markers that characterize the different stages of AR formation in this species and that could be used to monitor adventitious rooting on a wide collection of carnation germplasm with the aim to identify the best-rooting cultivars for breeding purposes.

Arabidopsis INCURVATA2 Regulates Salicylic Acid and Abscisic Acid Signaling, and Oxidative Stress Responses.

Epigenetic regulatory states can persist through mitosis and meiosis, but the connection between chromatin structure and DNA replication remains unclear. Arabidopsis INCURVATA2 (ICU2) encodes the catalytic subunit of DNA polymerase α, and null alleles of ICU2 have an embryo-lethal phenotype. Analysis of icu2-1, a hypomorphic allele of ICU2, demonstrated that ICU2 functions in chromatin-mediated cellular memory; icu2-1 strongly impairs ICU2 function in the maintenance of repressive epigenetic marks but does not seem to affect ICU2 polymerase activity. To better understand the global function of ICU2 in epigenetic regulation, here we performed a microarray analysis of icu2-1 mutant plants. We found that the genes up-regulated in the icu2-1 mutant included genes encoding transcription factors and targets of the Polycomb Repressive Complexes. The down-regulated genes included many known players in salicylic acid (SA) biosynthesis and accumulation, ABA signaling and ABA-mediated responses. In addition, we found that icu2-1 plants had reduced SA levels in normal conditions; infection by Fusarium oxysporum induced SA accumulation in the En-2 wild type but not in the icu2-1 mutant. The icu2-1 plants were also hypersensitive to salt stress and exogenous ABA in seedling establishment, post-germination growth and stomatal closure, and accumulated more ABA than the wild type in response to salt stress. The icu2-1 mutant also showed high tolerance to the oxidative stress produced by 3-amino-1,2,4-triazole (3-AT). Our results uncover a role for ICU2 in the regulation of genes involved in ABA signaling as well as in SA biosynthesis and accumulation.

Examining the benefits of learning based on an audience response system when confronting emergency situations.

This article presents an empirical study on the effectiveness of the use of an audience response system called SIstema De Respuesta inmediata de la Audiencia on a nursing course. A total of 130 students of mixed gender, age, and computer experience and educational background on a third-year course in nursing administration and management participated in the study. The benefits of an audience response system as regards learning how to confront emergency situations were studied. The innovative aspect of the proposal is twofold: (1) the use of a smartphone to respond to the questions and (2) the analysis of the students' response time when confronting critical situations while managing nursing resources. A positive impact on the students' performance was revealed in their final assessments. Our findings show that SIstema De Respuesta inmediata de la Audiencia increases student participation and aids in identifying and correcting misconceptions. The students found SIstema De Respuesta inmediata de la Audiencia to be very motivating and wanted it to be used in additional lectures. Further research is required to study the effectiveness of SIstema De Respuesta inmediata de la Audiencia for it to be widely used in other disciplines.