Randomized, parallel placebo-controlled trial of primaquine for malaria prophylaxis in Papua, Indonesia.

Malaria causes illness or death in unprotected travelers. Primaquine prevents malaria by attacking liver-stage parasites, a property distinguishing it from most chemoprophylactics and obviating 4-week postexposure dosing. A daily adult regimen of 30 mg primaquine prevented malaria caused by Plasmodium falciparum and P. vivax for 20 weeks in 95 of 97 glucose-6-phosphate dehydrogenase (G6PD)-normal Javanese transmigrants in Papua, Indonesia. In comparison, 37 of 149 subjects taking placebo in a parallel trial became parasitemic. The protective efficacy of primaquine against malaria was 93% (95% confidence interval [CI] 71%-98%); against P. falciparum it was 88% (95% CI 48%-97%), and >92% for P. vivax (95% CI >37%-99%). Primaquine was as well tolerated as placebo. Mild methemoglobinemia (mean of 3.4%) returned to normal within 2 weeks. Blood chemistry and hematological parameters revealed no evidence of toxicity. Good safety, tolerance, and efficacy, along with key advantages in dosing requirements, make primaquine an excellent drug for preventing malaria in nonpregnant, G6PD-normal travelers.

Repeated infection of Aotus monkeys with Plasmodium falciparum induces protection against subsequent challenge with homologous and heterologous strains of parasite.

We evaluated repeated blood-stage infections with Plasmodium falciparum in eight Aotus lemurinus lemurinus monkeys. Over the course of seven infections with 10(4) P. falciparum (the Vietnam Oak Knoll [FVO] strain), the pre-patent period lengthened from 8.2 to 30.8 days; the peak parasitemia decreased from 4.5 x 10(5) to 0 parasites/microl (Challenges 6 and 7), and the requirement for treatment decreased from 100% to 0% (Challenges 3 to 7). Five weeks after the seventh FVO challenge, the eight immune and three naïve monkeys received 10(4) parasitized erythrocytes infected with P. falciparum (CAMP strain). The three control animals experienced uncontrolled parasitemias reaching between 4.8 and 7.7 x 10(5) parasites/microl (pre-patency = 6.3 days) and all required drug treatment; six of the eight immune monkeys became parasitemic (pre-patency = 8.8 days), but self-cured. Two of three of the monkeys having the greatest reductions in hematocrit (50-60%) also had the highest parasitemias (approximately 10(4) parasites/microl) before self-curing. Repeated homologous infections induced sterile immunity to homologous challenge; during heterologous challenge the monkeys developed clinically relevant, but not life-threatening, parasitemias and anemia.

Susceptibility of Panamanian Aotus lemurinus lemurinus to sporozoite-induced Plasmodium falciparum (Santa Lucia) infection.

Aotus monkeys are good models for erythrocyte-induced Plasmodium falciparum and P. vivax infections and have been extensively used in malarial drug and vaccine development. Recently, it has been shown that certain species of Aotus can be infected with sporozoites, and that the degree of susceptibility varies among species. We demonstrate here that Panamanian Aotus lemurinus lemurinus are susceptible to a sporozoite-induced infection, opening the possibility that this species of Aotus could be used as models for testing the efficacy of pre-erythrocytic P. falciparum vaccines and drug candidates directed at the pre-erythrocytic stages of P. falciparum and P. vivax malaria. In this species, we compared sporozoite infection rates. Two of four animals splenectomized prior to infection with sporozoites developed patent parasitemias. Seven of eight animals splenectomized either 7 or 35 days after infection became parasitemic. Additionally, we used a P. falciparum-specific polymerase chain reaction (PCR) method to detect the early appearance of parasitized erythrocytes in the blood prior to detection by conventional microscopy, and found that the parasitemia was detected first in five animals by the PCR method, first in three animals by blood film, with one parasitemia detected simultaneously. We also demonstrated the feasibility of infecting monkeys located in Panama with sporozoites isolated at an insectary in Atlanta, thus documenting the feasibility of similar studies where the insectary and monkey colony are not in the same location. A subsequent attempt to infect these monkeys using sporozoites was not successful, suggesting that this model of human malaria is not yet ready for routine use in vaccine or drug efficacy screening. This model merits further study because of the importance of testing pre-erythrocytic P. falciparum malaria vaccines and drugs in animals.

DNA vaccines against malaria: immunogenicity and protection in a rodent model.

Since the first demonstration of the technology a few years ago, DNA vaccines have emerged as a promising method of vaccination. In a variety of experimental systems, DNA vaccines have been shown not only to induce potent immune responses, but also to offer many advantages in terms of ease of construction, testing, and production. In this article we summarize the progress achieved in development of DNA vaccines that can protect mice from infection by the rodent malaria parasite Plasmodium yoelii, describe initial studies of immunogenicity of a malaria DNA vaccine in a primate model, and outline the strategies being employed to design the next generation of malaria DNA vaccines.

Human fibroblast tissue factor is inhibited by lipoprotein-associated coagulation inhibitor and placental anticoagulant protein but not by apolipoprotein A-II.

Studies of proteins that inhibit tissue factor activity have generally been conducted using either an extracted tissue homogenate ("thromboplastin") or tissue factor protein reconstituted into phospholipid vesicles rather than with tissue factor expressed in cell membranes (its physiological environment). In the present study, a human fibroblast cell strain was used to evaluate the effects of lipoprotein associated coagulation inhibitor (LACI), placental anticoagulant protein (PAP), and apolipoprotein A-II (apo A-II) on human tissue factor in cell membranes. LACI was tested from 7.8 to 500 pmol/L on fibroblasts cultured at cell densities ranging from 3,500 to 9,925 cells/well, and caused a progressive inhibition of tissue factor activity. PAP was tested from 3.9 nmol/L to 1 mumol/L at cell densities ranging from 4,500 to 15,400 cells/well and caused up to 83% inhibition of tissue factor activity. Inhibition by these proteins appeared to be influenced by cell density as well as whether the cells were intact or disrupted. Apo A-II, up to 1 mumol/L, did not inhibit the tissue factor activity of intact or disrupted fibroblasts at any cell density examined even though it did inhibit the activity of tissue factor in phospholipid vesicles. Of these inhibitors of tissue factor-dependent activation of factor X, LACI was the most effective in suppressing the generation of factor Xa activity. The effects obtained with apo A-II are clearly dependent on the nature of the tissue factor preparation with which it is tested. The disparity between the inhibitory effect of apo A-II on the activity of tissue factor reconstituted into lipid vesicles and the absence of effect on the activity of tissue factor remaining in cell membranes serves to reemphasize the necessity of reexamining results obtained with model systems using as nearly physiological reagents as possible.

Protein co-isolated with human tissue factor impairs recovery of activity.

Preparations of human tissue factor isolated by immunoaffinity chromatography contain variable amounts of 47,000 mol wt, 55,000 mol wt, and multimeric tissue factor when analyzed without reduction on polyacrylamide gels in sodium dodecyl sulfate (SDS). When analyzed after reduction, the 47,000 mol wt tissue factor apoprotein and a protein of about 12,000 mol wt are observed. Elution of tissue factor from polyacrylamide gel slices, followed by reassociation with lipids, restored proportionately much greater tissue factor activity with the 47,000-mol wt protein than with the 55,000-mol wt form. Cyanogen bromide cleavage at the single tissue factor methionine revealed that the 12,000-mol wt protein is associated with the carboxyl-terminal peptide derived from the 47,000-mol wt protein. These results reveal that association of the 12,000-mol wt protein with the cytoplasmic domain of tissue factor can modulate its activity in vitro.

Amine oxidases, programmed cell death, and tissue renewal.

Embryonal carcinoma cells, with embryonic (ECaE) or trophectodermal (ECaT) potential, have been used in a colony assay to determine regulatory mechanisms in the blastocyst. The mechanism that regulates ECaE and results in chimera formation is dependent upon a soluble factor in blastocoele fluid and contact with trophectoderm. Two mechanisms contribute to the regulation of ECaT: one involves a factor in blastocoele fluid and the other contact with either trophectoderm or inner cell mass which results in differentiation of the cells into trophectoderm, and the other involves the killing of at least 40% of the cells by blastocoele fluid alone. This cytotoxic activity probably causes the programmed cell death that occurs in the inner cell mass during blastulation as it loses the potential to differentiate into trophectoderm. A toxic activity similar to that of normal blastocysts has been obtained from embryoid bodies. This activity is caused by amine oxidase-dependent catabolism of polyamines, and it is postulated that programmed cell death in the embryo and chalone activity in the adult may have similar mechanisms.

Neoplastic embryoid bodies of embryonal carcinoma C44 as a source of blastocele-like fluid.

There is a cytotoxic activity in blastocele fluid that kills embryonal carcinoma cells with trophectodermal potential but spares those with embryonic potential. This activity is present when programmed cell death occurs in the inner cell mass (ICM), and the ICM loses its trophectodermal potential. Because of the paucity of blastocele fluid, cystic embryoid bodies of embryonal carcinoma C44 were examined ultrastructurally and in tissue culture to determine if they corresponded to late blastocysts and if their fluid corresponded to blastocele fluid. No trophectoderm was demonstrated in the embryoid bodies, but embryonal carcinoma and endoderm were present, leading to the conclusion that the embryonal carcinoma corresponded to late ICM that had expressed endodermal potential. As a result the cyst fluid might have contained the toxic activity of blastocele fluid. The cyst fluid of C44 embryoid bodies did contain a soluble, low-molecular-weight, cytotoxic activity that preferentially killed embryonal carcinoma cells with trophectodermal potential while sparing those with embryonic potential. Enough of this fluid was available to determine the chemical nature of this toxic activity.

Evidence linking programmed cell death in the blastocyst to polyamine oxidation.

Programmed cell death occurs in the inner cell mass during blastulation concomitant with the loss of its trophectodermal potential, and blastocele fluid kills malignant inner cell mass cells with trophectodermal potential (ECa 247) but spares those with embryonic potential (P19). A previous study had shown that blastocele-like fluid from embryoid bodies of the teratocarcinoma C44 contains a low-molecular-weight cytotoxin that exhibits the same target-cell selectivity as normal blastocele fluid. The current paper shows that the preferential killing of cells with trophectodermal potential is caused by hydrogen peroxide generated during the oxidation of polyamines in the cyst fluid by amine oxidases. The greater resistance of cells with embryonic potential to hydrogen peroxide is due to glutathione-dependent mechanisms. These data lead to the conclusion that an amine oxidase in the blastocyst oxidizes polyamines in blastocele fluid, generating hydrogen peroxide which causes programmed cell death of normal and malignant cells with trophectodermal potential.

Immune response to a hepatitis B DNA vaccine in Aotus monkeys: a comparison of vaccine formulation, route, and method of administration.

BACKGROUND: Attempts to optimize DNA vaccines in mice include using different routes of administration and different formulations. It may be more relevant to human use to carry such studies out in nonhuman primates. Here we compare different approaches to delivery of a DNA vaccine against the hepatitis B virus (HBV) in Aotus monkeys. MATERIALS AND METHODS: Thirty-two adult Aotus l. lemurinus monkeys divided into 8 groups of four were immunized with 400 microg of a DNA vaccine which encoded hepatitis B surface antigen (HBsAg). DNA in saline was administered by intradermal (ID) or intramuscular (IM) injection with needle and syringe, IM injection with the Biojector needleless injection system or combined ID (needle) and IM (Biojector). DNA formulated with cationic liposomes (CellFECTIN) was injected IM with needle or Biojector. DNA with added E. coli DNA (100 microg) was injected IM with the Biojector or ID. A ninth group of 4 monkeys was injected IM (needle) with Engerix-B, a commercial vaccine containing recombinant HBsAg (10 microg) adsorbed onto alum. Monkeys were boosted in an identical fashion to their prime at 8 weeks, but all received the protein vaccine (Engerix-B) at 16 weeks. Sera was assessed for antibodies against HBsAg (anti-HBs) by enzyme-linked imunosorbent assay (ELISA). RESULTS: The primary humoral response induced by IM delivery of the DNA vaccine was very poor. In most cases there was no detectable anti-HBs even after 2 DNA doses but the kinetics of the response to subsequent protein indicated that a memory B cell response had been induced. In contrast, following IM-administration of DNA using the Biojector, detectable anti-HBs were observed in 3 of 8 animals and evidence for immunological priming was apparent in an additional 4 of the 8 monkeys. ID injection of DNA vaccine in saline induced a potent antibody response which was augmented 6-fold by the addition of E. coli DNA. Combining ID and IM administration did not improve humoral immunity over ID injection alone. CONCLUSIONS: For immunization of primates with DNA vaccines, ID may be a preferable route to IM, although it is not clear whether the Aotus monkey is a relevant model for humans in this respect. Nevertheless, the use of the Biojector needleless injection system may improve responses with IM delivery of DNA vaccines. As well, the immunostimulatory action of E. coli DNA may be used to augment the humoral response induced by a DNA vaccine.

T-cell receptor gamma--delta lymphocytes and Eimeria vermiformis infection.

The role of T-cell receptor gamma--delta T lymphocytes in coccidiosis was examined by determining the course of infection with Eimeria vermiformis in BALB/c mice depleted of gamma--delta lymphocytes by treatment with GL3 monoclonal antibody. The replication of the parasite in primary infections was not greatly, or consistently, affected by this treatment, and there was no correlation between the extent of depletion of small intestinal intraepithelial lymphocytes and the number of oocysts produced. The resistance of immunized mice to challenge was not compromised by depletion of intraintestinal epithelial lymphocytes when their depletion was effected at the time of primary infection and/or administration of the challenge inoculum. Thus, T-cell receptor gamma--delta T lymphocytes do not appear to be crucial to the establishment, or the control, of primary infection with E. vermiformis and are not principal mediators of the solid immunity to challenge that this infection induces.

Avian coccidiosis: changes in intestinal lymphocyte populations associated with the development of immunity to Eimeria maxima.

The effect of infection and subsequent challenge with Eimeria maxima on the populations of lymphocytes in the small intestine of Light Sussex chickens was assessed by immunohistochemistry. T cells were characterized for CD3, CD4, CD8, TCR1 (gamma delta heterodimer) or TCR2 (alpha beta 1 heterodimer) markers, and B cells for the expression of IgM, IgA and IgG. After a primary inoculum there were, in both the epithelium and the lamina propria, two distinct increases in the numbers of T lymphocytes. The first peaked on days 3-5 and the second, greater influx, on day 11 after infection. CD4+ and CD8+ cells were represented in both peaks but, whereas CD4+ cells were found almost exclusively in the lamina propria, CD8+ cells were present in both sites. The area staining positive for CD8+ cells was somewhat greater than the value obtained for CD4+ cells. In the epithelium there was an early, small increase in TCR1(+)-staining, followed by a larger rise to the second peak, at which time there was also an increase in the lamina propria. Staining for TCR2+ cells followed the same pattern with a reversed distribution between epithelium and lamina propria. Changes after challenge were minimal and confined to the epithelium. The most notable changes in the expression of immunoglobulins were, in the lamina propria, a biphasic increase in the amount of IgM(+)-staining in the course of primary infection (corresponding approximately to that of the T cells), and in IgA+ cells shortly after challenge.

Interleukin-12- and gamma interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice.

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

T cell receptor-triggered activation of intraepithelial lymphocytes in vitro.

Intraepithelial lymphocytes (IEL) of the mouse small intestine were examined for their potential to respond to TCR signalling in vitro. Purified IEL subsets were activated using mAbs specific for CD3, TCR alpha beta or TCR gamma delta. Thy-1+ IEL, regardless of TCR type, proliferated equally well in response to anti-TCR mAb with or without exogenous IL-2. In contrast, Thy-1- TCR alpha beta, CD8 beta- IEL required exogenous IL-2 for proliferation. No such requirement was observed for Thy-1- TCR gamma delta IEL proliferation. IEL proliferation in the absence of added IL-2 was due to an IL-2 secretion/IL-2 receptor (IL-2R) autocrine pathway, since mAbs specific for IL-2 and IL-2R inhibited IEL proliferation. Thy-1+ CD8 beta- CD4+CD8+ IEL were unresponsive to TCR-induced proliferation but exhibited high levels of cytolytic activity upon TCR-triggering. Thy-1- non-cytolytic IEL were induced to express Thy-1 and cytolytic activity following activation in vitro. In addition, the involvement of the co-stimulatory molecule CD28 in IEL activation was tested. CD28 was weakly expressed by fresh IEL and anti-CD28 mAb had no effect on TCR-triggered proliferation. However, anti-TCR stimulation increased CD28 expression on a subset of TCR alpha beta IEL and the addition of anti-CD28 mAb resulted in increased IL-2 production, but not in increased proliferation. Our results indicate that IEL, including the purported extrathymic CD8 beta- subset, can respond to TCR-driven signals via proliferation and/or cytolytic activity.

Malaria DNA vaccines in Aotus monkeys.

In preparation for the development of DNA vaccines designed to produce protective antibodies against Plasmodium falciparum antigens (Ag), we conducted studies to optimize antibody responses in Aotus monkeys after immunization with the P. yoelli circumsporozoite (CSP) DNA vaccine. We demonstrate in Aotus monkeys that an intradermal route of immunization with a PyCSP plasmid DNA vaccine generates antibody responses equivalent to a multiple antigen peptide/adjuvant based vaccine, and that these data support the use of the intradermal route for initial studies of the efficacy of DNA vaccines in inducing protective antibodies against P. falciparum antigens in Aotus monkeys.

Synthetic oligodeoxynucleotides containing CpG motifs enhance immunogenicity of a peptide malaria vaccine in Aotus monkeys.

Synthetic peptide and recombinant protein vaccines are optimally immunogenic when delivered with an effective adjuvant. Candidate vaccines currently insufficiently immunogenic may induce a protective immunity if they could be delivered with more effective adjuvants. For example, immunogens that induce promising responses when administered to mice with complete and incomplete Freund's adjuvants perform less well in primate animal models where complete Freund's adjuvant is not used. We report the use of synthetic oligodeoxynucleotides containing CpG motifs, the sequences of which are based on immunostimulatory bacterial DNA sequences, to enhance the immune response in Aotus monkeys to a synthetic peptide malaria vaccine. Monkeys were immunized with the synthetic peptide PADRE 45, a synthetic peptide containing amino acid sequences derived from the circumsporozoite protein (CSP) from Plasmodium falciparum, and delivered in an emulsion of saline and Montanide 720, a mannide oleate in oil solution, that also contained one of three oligodeoxynucleotides. The animals receiving oligodeoxynucleotides containing either three or four CpG motifs produced antibodies that bound a recombinant CSP as measured in ELISA, and reacted with P. falciparum sporozoites in a sporozoite immunofluorescent test. These responses were significantly greater than those seen in animals receiving the oligodeoxynucleotide without CpG motifs. These data indicate that oligodeoxynucleotides containing CpG motifs improve immunogenicity of peptide immunogens in non-human primates, and may be immunopotentiators useful in humans.

Strategy for development of a pre-erythrocytic Plasmodium falciparum DNA vaccine for human use.

Data generated in the Plasmodium yoelii rodent model indicated that plasmid DNA vaccines encoding the P.yoelii circumsporozoite protein (PyCSP) or 17 kDa hepatocyte erythrocyte protein (PyHEP17) were potent inducers of protective CD8+ T cell responses directed against infected hepatocytes. Immunization with a mixture of these plasmids circumvented the genetic restriction of protective immunity and induced additive protection. A third DNA vaccine encoding the P. yoelii sporozoite surface protein 2 (PySSP2) also induced protection. The P. falciparum genes encoding the homologues of these three protective P. yoelii antigens as well as another P. falciparum gene encoding a protein that is expressed in infected hepatocytes have been chosen for the development of a human vaccine. The optimal plasmid constructs for human use will be selected on the basis of immunogenicity data generated in mice and nonhuman primates. We anticipate that optimization of multi-gene P. falciparum DNA vaccines designed to protect against malaria by inducing CD8+ T cells that target infected hepatocytes will require extensive clinical trials during the coming years.