Single-cell transcriptomic signatures and gene regulatory networks modulated by Wls in mammalian midline facial formation and clefts.

Formation of highly unique and complex facial structures is controlled by genetic programs that are responsible for the precise coordination of three-dimensional tissue morphogenesis. However, the underlying mechanisms governing these processes remain poorly understood. We combined mouse genetic and genomic approaches to define the mechanisms underlying normal and defective midfacial morphogenesis. Conditional inactivation of the Wnt secretion protein Wls in Pax3-expressing lineage cells disrupted frontonasal primordial patterning, cell survival and directional outgrowth, resulting in altered facial structures, including midfacial hypoplasia and midline facial clefts. Single-cell RNA sequencing revealed unique transcriptomic atlases of mesenchymal subpopulations in the midfacial primordia, which are disrupted in the conditional Wls mutants. Differentially expressed genes and cis-regulatory sequence analyses uncovered that Wls modulates and integrates a core gene regulatory network, consisting of key midfacial regulatory transcription factors (including Msx1, Pax3 and Pax7) and their downstream targets (including Wnt, Shh, Tgfß and retinoic acid signaling components), in a mesenchymal subpopulation of the medial nasal prominences that is responsible for midline facial formation and fusion. These results reveal fundamental mechanisms underlying mammalian midfacial morphogenesis and related defects at single-cell resolution.

Insights on the NF-κB system in polycystic ovary syndrome, attractive therapeutic targets.

The nuclear factor κappa B (NF-κB) signaling plays a well-known function in inflammation and regulates a wide variety of biological processes. Low-grade chronic inflammation is gradually considered to be closely related to the pathogenesis of Polycystic ovary syndrome (PCOS). In this review, we provide an overview on the involvement of NF-κB in the progression of PCOS particularly, such as hyperandrogenemia, insulin resistance, cardiovascular diseases, and endometrial dysfunction. From a clinical perspective, progressive recognition of NF-κB pathway provides opportunities for therapeutic interventions aimed at inhibiting pathway-specific mechanisms. With the accumulation of basic experimental and clinical data, NF-κB signaling pathway was recognized as a therapeutic target. Although there have been no specific small molecule NF-κB inhibitors in PCOS, a plethora of natural and synthetic compound have emerged for the pharmacologic intervention of the pathway. The traditional herbs developed for NF-κB pathway have become increasingly popular in recent years. Abundant evidence elucidated that NF-κB inhibitors can significantly improve the symptoms of PCOS. Herein, we summarized evidence relating to how NF-κB pathway is involved in the development and progression of PCOS. Furthermore, we present an in-depth overview of NF-κB inhibitors for therapy interventions of PCOS. Taken together, the NF-κB signaling may be a futuristic treatment strategy for PCOS.

Differential diagnosis of breast mucinous carcinoma with an oval shape from fibroadenoma based on ultrasonographic features.

BACKGROUND: Approximately 50% of breast mucinous carcinomas (MCs) are oval and have the possibility of being misdiagnosed as fibroadenomas (FAs). We aimed to identify the key features that can help differentiate breast MC with an oval shape from FA on ultrasonography (US). METHODS: Seventy-six MCs from 71 consecutive patients and 50 FAs with an oval shape from 50 consecutive patients were included in our study. All lesions pathologically diagnosed. According to the Breast Imaging Reporting and Data System (BI-RADS), first, the ultrasonographic features of the MCs and FAs were recorded and a final category was assessed. Then, the differences in ultrasonographic characteristics between category 4 A (low-risk group) and category 4B-5 (medium-high- risk group) MCs were identified. Finally, other ultrasonographic features of MC and FA both with an oval shape were compared to determine the key factors for differential diagnosis. The Mann-Whitney test, χ2 test or Fisher's exact test was used to compare data between groups. RESULTS: MCs with an oval shape (81.2%) and a circumscribed margin (25%) on US were more commonly assessed in the low-risk group (BI-RADS 4 A) than in the medium-high-risk group (BI-RADS 4B-5) (20%, p < 0.001 and 0%, p = 0.001, respectively). Compared with those with FA, patients with MC were older, and tended to have masses with non-hypoechoic patterns, not circumscribed margins, and a posterior echo enhancement on US (p < 0.001, p < 0.001, and p = 0.003, respectively). CONCLUSION: The oval shape was the main reason for the underestimation of MCs. On US, an oval mass found in the breast of women of older age with non-hypoechoic patterns, not circumscribed margins, and a posterior echo enhancement was associated with an increased risk of being an MC, and should be subjected to active biopsy.

IL-27 attenuates IL-23 mediated inflammatory arthritis.

Interleukin 27 has both pro-inflammatory and anti-inflammatory properties in autoimmunity. The anti-inflammatory effects of IL-27 are linked with inhibition of Th17 differentiation but the IL-27 effect on myeloid cells is less studied. Herein we demonstrate that IL-27 inhibits IL-23-induced inflammation associated not only with Th17 cells but also with myeloid cell infiltration in the joints and splenic myeloid populations of CD11b+ GR1+ and CD3-CD11b+CD11c-GR1- cells. The IL-27 anti-inflammatory response was associated with reduced levels of myeloid cells in the spleen and bone marrow. Overall, our data demonstrate that IL-27 has an immunosuppressive role that affects IL-23-dependent myelopoiesis in the bone marrow and its progression to inflammatory arthritis and plays a crucial role in controlling IL-23 driven joint inflammation by negatively regulating the expansion of myeloid cell subsets.

Gene regulatory network controlling carpel number variation in cucumber.

The WUSCHEL-CLAVATA3 pathway genes play an essential role in shoot apical meristem maintenance and floral organ development, and under intense selection during crop domestication. The carpel number is an important fruit trait that affects fruit shape, size and internal quality in cucumber, but the molecular mechanism remains elusive. Here, we found that CsCLV3 expression was negatively correlated with carpel number in cucumber cultivars. CsCLV3-RNAi led to increased number of petals and carpels, whereas overexpression of CsWUS resulted in more sepals, petals and carpels, suggesting that CsCLV3 and CsWUS function as a negative and a positive regulator for carpel number variation, respectively. Biochemical analyses indicated that CsWUS directly bound to the promoter of CsCLV3 and activated its expression. Overexpression of CsFUL1A , a FRUITFULL-like MADS-box gene, resulted in more petals and carpels. CsFUL1A can directly bind to the CsWUS promoter to stimulate its expression. Furthermore, we found that auxin participated in carpel number variation in cucumber through interaction of CsARF14 with CsWUS. Therefore, we have identified a gene regulatory pathway involving CsCLV3, CsWUS, CsFUL1A and CsARF14 in determining carpel number variation in an important vegetable crop - cucumber.

First Report of radish tubers rot caused by Enterobacter asburiae in China.

Radish (Raphanus sativus L.) is a widely consumed vegetable in China. However, radish is susceptible to diseases, which limits its yield and development in Harbin, China. In September 2021, rotten white radish tubers were observed in the field. The incidence of this disease reached 70% in October 2021, which led to huge economic losses (i.e., 30%-40%). Water-soaked lesions appeared on the radish tubers and appeared brown-yellow, which looked similar to ginger tuber rot caused by Enterobacter asburiae (Zhang et al. 2020). The interior was rotten with no considerable smell. Over time, the lesions gradually spread into all tubers of radish. Small square pieces of radish (0.5 cm × 0.5 cm) were excised from the junction of diseased and healthy tuber, disinfected with 75% alcohol, and washed three times with distilled water then ground to prepare tissue suspensions for plating. Under 28 ℃ for 16h, single colonies were isolated from the beef extract culture medium. Single colonies appeared oval, white, and smooth, with bright and slightly raised surfaces, and with moist neat edges. Gram-negative bacterial strain CCGL 988 was obtained, with an average size of 1-2 µm × 0.5-1 µm, and 3-4 flagella. Physiological and biological test results showed that strain CCGL 988 produced acid utilizing sucrose, glucose, maltobiose, D-Sorbitol, and mannitol; negative for Voges-Proskauer, methyl red, malanate, ornithine decarboxylase, arginine decarboxylase, and lysine decarboxylase. According to the results, strain CCGL 988 was identified as Enterobacter asburiae (Hoffmann et al. 2005). The 16S rDNA region of the strain was amplified using PCR with 27F/1492R primers (López et al. 2019), and partial gyrB, atpD, rpoB genes were amplified according to Zhang et al. (2020), infB gene was amplified with primers (F:TCAATGCGTGCTCGTGGTGCTC; R: TCGATACAGTGCCACTTCACG). The 16S rDNA, gyrB, atpD, rpoB and infB sequences were deposited in GenBank under accession numbers: ON999069, OP006448, OP006449, OP006450, and OP542231, respectively. These five sequences shared 99.80%, 100%, 100%, 100% and 100% of identity with E. asburiae (GenBank Accession: NO. CP011863). Maximum-likelihood phylogenetic tree clustered CCGL 988 with E. asburiae (MEGA7, bootstrap n = 1,000). Strain CCGL 988 was able to produce pectate lyases, polygalacturonases, cellulases, proteases, and extracellular polysaccharide using the methods described by Hugouviex-Cotte-Pattat et al. (2014), and Condemine et al. (1999). Koch's postulates were conducted by inoculating 20 µl of the bacterial suspension (108 CFU/ml) on the needle wound on the surface of six healthy radish tubers; six radish tubers incubated with sterile water were negative controls. Radish tubers were incubated at 28 ℃ with 80% humidity. The inoculated radish was slightly rotten after 7 days. Water-soaked lesions with light yellow were initially observed; after 12 days, the lesions expanded gradually and appeared deep yellow. No symptoms were found in the control radish. This experiment was carried out three times, each time with three replications. The bacterium was reisolated from infected radish tuber and was confirmed to be E. asburiae by the same molecular and morphological characterization as described above. This study is the first report of E. asburiae causing radish tuber rot in China. It serves as a basis for future studies to develop management strategies for the disease to prevent radish yield loss.

Effects of stay-at-home orders on skill requirements in vacancy postings.

The COVID-19 pandemic and containment policies have had profound economic impacts on the labor market. Stay-at-home orders (SAHOs) implemented across most of the United States changed the way of people worked. In this paper, we quantify the effect of SAHO durations on skill demands to study how firms adjust labor demand within occupation. We use skill requirement information from the 2018 to 2021 online job vacancy posting data from Burning Glass Technologies, exploit the spatial variations in the SAHO duration, and use instrumental variables to correct for the endogeneity in the policy duration related to local social and economic factors. We find that policy durations have persistent impacts on the labor demand after restrictions are lifted. Longer SAHOs motivate management style transformation from people-oriented to operation-oriented by requiring more of operational and administrative skills and less of personality and people management skills to carry out standard workflows. SAHOs also change the focus of interpersonal skill demands from specific customer services to general communication such as social and writing skills. SAHOs more thoroughly affect occupations with partial work-from-home capacity. The evidence suggests SAHOs change management structure and communication in firms.

Predicting the risk of axillary lymph node metastasis in early breast cancer patients based on ultrasonographic-clinicopathologic features and the use of nomograms: a prospective single-center observational study.

OBJECTIVES: The purpose of this study was to establish two preoperative nomograms to evaluate the risk for axillary lymph node (ALN) metastasis in early breast cancer patients based on ultrasonographic-clinicopathologic features. METHODS: We prospectively evaluated 593 consecutive female participants who were diagnosed with cT1-3N0-1M0 breast cancer between March 2018 and May 2019 at Sun Yat-Sen Memorial Hospital. The participants were randomly classified into training and validation sets in a 4:1 ratio for the development and validation of the nomograms, respectively. Multivariate logistic regression analysis was performed to identify independent predictors of ALN status. We developed Nomogram A and Nomogram B to predict ALN metastasis (presence vs. absence) and the number of metastatic ALNs (≤ 2 vs. > 2), respectively. RESULTS: A total of 528 participants were evaluated in the final analyses. Multivariable analysis revealed that the number of suspicious lymph nodes, long axis, short-to-long axis ratio, cortical thickness, tumor location, and histological grade were independent predictors of ALN status. The AUCs of nomogram A in the training and validation groups were 0.83 and 0.78, respectively. The AUCs of nomogram B in the training and validation groups were 0.87 and 0.87, respectively. Both nomograms were well-calibrated. CONCLUSION: We developed two preoperative nomograms that can be used to predict ALN metastasis (presence vs. absence) and the number of metastatic ALNs (≤ 2 vs. > 2) in early breast cancer patients. Both nomograms are useful tools that will help clinicians predict the risk of ALN metastasis and facilitate therapy decision-making about axillary surgery. KEY POINTS: • We developed two preoperative nomograms to predict axillary lymph node status based on ultrasonographic-clinicopathologic features. • Nomogram A was used to predict axillary lymph node metastasis (presence vs. absence). The AUCs in the training and validation groups were 0.83 and 0.78, respectively. Nomogram B was used to estimate the number of metastatic lymph nodes ( ≤ 2 vs. > 2). The AUCs in the training and validation group were 0.87 and 0.87, respectively. • Our nomograms may help clinicians weigh the risks and benefits of axillary surgery more appropriately.

CsBRC1 inhibits axillary bud outgrowth by directly repressing the auxin efflux carrier CsPIN3 in cucumber.

Shoot branching is an important agronomic trait that directly determines plant architecture and affects crop productivity. To promote crop yield and quality, axillary branches need to be manually removed during cucumber production for fresh market and thus are undesirable. Auxin is well known as the primary signal imposing for apical dominance and acts as a repressor for lateral bud outgrowth indirectly. The TEOSINTE BRANCHED1/CYCLOIDEA/PCF (TCP) family gene BRANCHED1 (BRC1) has been shown to be the central integrator for multiple environmental and developmental factors that functions locally to inhibit shoot branching. However, the direct molecular link between auxin and BRC1 remains elusive. Here we find that cucumber BRANCHED1 (CsBRC1) is expressed in axillary buds and displays a higher expression level in cultivated cucumber than in its wild ancestor. Knockdown of CsBRC1 by RNAi leads to increased bud outgrowth and reduced auxin accumulation in buds. We further show that CsBRC1 directly binds to the auxin efflux carrier PIN-FORMED (CsPIN3) and negatively regulates its expression in vitro and in vivo. Elevated expression of CsPIN3 driven by the CsBRC1 promoter results in highly branched cucumber with decreased auxin levels in lateral buds. Therefore, our data suggest that CsBRC1 inhibits lateral bud outgrowth by direct suppression of CsPIN3 functioning and thus auxin accumulation in axillary buds in cucumber, providing a strategy to breed for cultivars with varying degrees of shoot branching grown in different cucumber production systems.

First Report of Flower Stalk Wilting Caused by Rhizopus oryzae on Chinese cabbage in China.

Chinese cabbage (Brassica rapa L. ssp. pekinensis) is one of the main biennial vegetables in China and its flowers can be produced in the second year. In May 2021, approximately 50% of the flower stalks of Chinese cabbage wilted in a field in Laizhou, China. Water-soaked lesions were first observed on the lateral shoots of flower stalks, leading to wilting at a later stage. Small diseased tissues were excised from the margin of lesions, surface disinfected in 75% alcohol, rinsed in distilled water twice, and transferred onto potato dextrose agar (PDA) medium for incubation at 28 ℃. Five fungal isolates were obtained using single spore isolation method. The fungal colonies were initially white and became gray or black within 5 days. The columella was globose to subglobose and 82.86±5.25 µm (n=5) in diameter; sporangiophores were smooth-walled, simple or branched; the globose sporangia were 86.06±15.37 µm (n=5) in diameter and black; the sporangiospores were subglobose and abundant and 5.23±0.98 µm (n=5) in diameter; and the rhizoids were dark brown and 5.69±1.82 µm (n=5) wide. A cetyl tri-methyl ammonium bromide method was used to extract DNA from 3-day-old hyphae (Ausubel et al. 1987). PCR was performed for ITS (White et al. 1990), the RNA polymerase II large subunit (RPB1) gene (Voigt et al. 2000) and the actin (ACT) gene (Stiller et al. 1997). The DNA sequences of the five isolates were identical, therefore, the sequence of Isolate RO21 was submitted to GenBank. According to BLAST search, the ITS (MZ452687), RPB1 (OK431470), and ACT (OK431471) sequences showed 99.66% similarity to Rhizopus oryzae Strain CBS 112.07 (NR103595), 100% to Strain CBS 127.08 (KJ566325) and 100% to Strain CBS 102660 (KJ551423), respectively. A neighbor-joining phylogenetic tree was reconstructed based on the ITS of Isolate RO21 and 14 other Rhizopus species sequences obtained from GenBank. Isolate RO21 was found to be most closely related to R. oryzae and far from other species. Based on morphological and phylogenetic characteristics, Isolate RO21 was identified as R. oryzae (Dolatabadi et al. 2014, Kwon et al. 2015, Palemón-Alberto et al. 2020). Sporangiospores were harvested from 5-day-old PDA cultures, suspended in sterilized distilled water, adjusted to 106 spores/ml and amended with 0.1% Tween-80. Chinese cabbage inbred line "A54-1" was inoculated near the middle of the flower stalk by applying 20 µl of spore suspension (106 spores/ml) to each of three sites wounded using a sterilized knife or to the unwounded site. Sterilized distilled water was used as the control. Forty flower stalks (20 for the inoculation treatment and the rest for the control) selected from ten plants were used for pathogenicity test. All plants were incubated in a growth chamber at 28/22 °C (day/night), with 80 to 90% of relative humidity. Wilting symptoms similar to those in the field were observed in the wounded flower stalks after 5 days and in the non-wounded flower stalks after 15 days. All control flower stalks remained asymptomatic. The fungus was re-isolated from the artificially infected flower stalks and identified as R. oryzae by morphological characteristics and sequencing to fulfill the Koch's postulates. To our knowledge, this is the first report that R. oryzae causes flower stalk wilting on Chinese cabbage in China. The results can provide the basis for future studies on the occurrence, prevention and management of this disease.

Catalpol relieved angiotensin II-induced blood-brain barrier destruction via inhibiting the TLR4 pathway in brain endothelial cells.

CONTEXT: Catalpol is a major bioactive constituent of Rehmannia glutinosa Libosch (Scrophulariaceae), a traditional Chinese medicine, which is widely used in multiple diseases, including hypertension. OBJECTIVES: To explore whether catalpol protects against angiotensin II (Ang II)-triggered blood-brain barrier (BBB) leakage. MATERIALS AND METHODS: The bEnd.3 cells and BBB models were pre-treated with or without catalpol (50, 200 and 500 µM) or TAK-242 (1 µM) for 2 h and then with Ang II (0.1 µM) or LPS (1 µg/mL) for 24 h. Cell viability was determined by the MTT assay. The levels of Toll-like receptor 4 (TLR4), myeloid differentiation factor 88 (MyD88), inducible nitric oxide synthase (iNOS), tumour necrosis factor-α (TNF-α), caveolin-1 (Cav-1) and p-eNOS/eNOS were tested by western blot. The BBB permeability was evaluated by the flux of bovine serum albumin-fluorescein isothiocyanate (BSA-FITC) across monolayers. nuclear factor kappa-B (NF-κB) p65 nuclear translocation was explored by immunofluorescence staining. RESULTS: Ang II (0.1 µM) decreased the cell viability to 86.52 ± 1.79%, elevated the levels of TLR4, MyD88, iNOS, TNF-α and Cav-1 respectively to 3.7-, 1.5-, 2.3-, 2.2- and 2.7-fold, reduced the level of p-eNOS/eNOS to 1.6-fold in bEnd.3 cells, and eventually increased BBB permeability. Catalpol dose-dependently reversed these changes at 50-500 µM. Meanwhile, catalpol (500 µM) inhibited the upregulated levels of TLR4 pathway-related proteins and NF-κB p65 nuclear translocation, decreased the enhanced transcytosis, and relieved the BBB disruption caused by both LPS (the TLR4 activator) and Ang II. The effects are same as TAK-242 (the TLR4 inhibitor). CONCLUSIONS: Catalpol relieved the Ang II-induced BBB damage, which indicated catalpol has high potential for the treatment of hypertension-induced cerebral small vessel disease (cSVD).

Ultrasound-Guided Vacuum-assisted Biopsy Versus Surgical Resection in Patients With Breast Desmoid Tumor.

BACKGROUND: Recent studies suggest that desmoid tumors can be managed more conservatively rather than undergoing wide surgical resection (SR). Ultrasound-guided vacuum-assisted biopsy (UGVAB) is a minimally invasive technique. This retrospective study aimed to compare the outcome in patients with breast desmoid tumor (BDT) who received UGVAB alone versus SR. MATERIALS AND METHODS: The pathology database was searched for patients diagnosed with BDT ≤ 3 cm from 2007 to 2019. All patients underwent breast ultrasound examination and were then performed UGVAB alone or local SR. The Kaplan-Meier method with a log-rank test was used as a univariate analysis to compare the relapse-free survival (RFS) rates between UGVAB and SR groups. Cox regression analysis was used for multivariate analysis. RESULTS: A total of 39 patients were included. The median follow-up was 41 mo (range, 5-110 mo). The incidence of tumor recurrence was 23.1% (9/39). The 3-y cumulative RFS was 83.1% and 95.8% in the UGVAB and SR group, respectively, which was not significantly different between the two groups (P = 0.131, log-rank test). Multivariate analysis also revealed that treatment strategy (UGVAB versus SR) was not associated with an increased risk of relapse events (P = 0.274). CONCLUSIONS: Small desmoid tumors (≤3 cm) after UGVAB alone did not have a significantly compromised RFS compared with those who underwent SR. UGVAB may be an alternative and relatively conservative method for the diagnosis and local control of BDT with a smaller size. A prospective, randomized study with large sample size is needed to confirm this observation.

Olig2 regulates terminal differentiation and maturation of peripheral olfactory sensory neurons.

The bHLH transcription factor Olig2 is required for sequential cell fate determination of both motor neurons and oligodendrocytes and for progenitor proliferation in the central nervous system. However, the role of Olig2 in peripheral sensory neurogenesis remains unknown. We report that Olig2 is transiently expressed in the newly differentiated olfactory sensory neurons (OSNs) and is down-regulated in the mature OSNs in mice from early gestation to adulthood. Genetic fate mapping demonstrates that Olig2-expressing cells solely give rise to OSNs in the peripheral olfactory system. Olig2 depletion does not affect the proliferation of peripheral olfactory progenitors and the fate determination of OSNs, sustentacular cells, and the olfactory ensheathing cells. However, the terminal differentiation and maturation of OSNs are compromised in either Olig2 single or Olig1/Olig2 double knockout mice, associated with significantly diminished expression of multiple OSN maturation and odorant signaling genes, including Omp, Gnal, Adcy3, and Olfr15. We further demonstrate that Olig2 binds to the E-box in the Omp promoter region to regulate its expression. Taken together, our results reveal a distinctly novel function of Olig2 in the periphery nervous system to regulate the terminal differentiation and maturation of olfactory sensory neurons.

The protective effect of harpagoside on angiotensin II (Ang II)-induced blood-brain barrier leakage in vitro.

Hypertension and its associated dysfunction of the blood-brain barrier (BBB) contribute to cerebral small vessel disease (cSVD). Angiotensin II (Ang II), a vasoactive peptide of the renin-angiotensin system (RAS), is not only a pivotal molecular signal in hypertension but also causes BBB leakage, cSVD, and cognitive impair. Harpagoside, the major bioactive constituent of Scrophulariae Radix, has been commonly used for the treatment of multiple diseases including hypertension in China. The effect of harpagoside on Ang II-induced BBB damage is unclear. We employed an immortalized endothelial cell line (bEnd.3) to mimic a BBB monolayer model in vitro and investigated the effect of harpagoside on BBB and found that harpagoside alleviated Ang II-induced BBB destruction, inhibited Ang II-associated cytotoxicity in a concentration-dependent manner and attenuated Ang II-induced reactive oxygen species (ROS) impair by downregulation of Nox2, Nox4, and COX-2. Harpagoside prevented Ang II-induced apoptosis via keeping Bax/Bcl-2 balance, decreasing cytochrome c release, and inactivation of caspase-8, caspase-9, and caspase-3 (the mitochondria-dependent and death receptor-mediated apoptosis pathways). Moreover, harpagoside can alleviate Ang II-induced BBB damage through upregulation of tight junction proteins and decrease of caveolae-mediated endocytosis. Thus, harpagoside might be a potential drug to treat Ang II-induced cSVD.

LncRNA RPPH1 attenuates Aß25-35-induced endoplasmic reticulum stress and apoptosis in SH-SY5Y cells via miR-326/PKM2.

BACKGROUND: The durative endoplasmic reticulum stress (ERS) and subsequent apoptosis contributes to the development and progression of Alzheimer's disease (AD). MiR-326 can reduce pyruvate kinase M2 (PKM2) expression, leading to ERS. Whereas, lncRNA RPPH1 is able to increase dendritic spine density and protect hippocampal pyramidal neurons through targeting miR-326. Our study aims to investigate the regulation of lncRNA RPPH1 and miR-326/PKM2 on ERS and related apoptosis in AD. METHODS: SH-SY5Y cells treated with Aß25-35 were selected as an in vitro AD model. RPPH1 and miR-326 overexpression and silencing cells were established by transforming vectors. The expression of RPPH1 and miR-326 were detected by qRT-PCR. MTT, flow cytometric, intracellular calcium assay and Western blot were used to test the functions of RPPH1 and miR-326 in SH-SY5Y cell proliferation, apoptosis and ERS. Dual-luciferase assay was used to detect the interaction among RPPH1, miR-326 and PKM2. RESULTS: RPPH1 overexpression enhanced the viability of SH-SY5Y cells, and attenuated the apoptosis of of SH-SY5Y cells. Moreover, RPPH1 overexpression down-regulated ER stress related proteins such as GRP78, CHOP and cleaved caspase-12. Mechanistically, RPPH1 directly targeted miR-326, thereby counteracting its inhibitory effect on PKM2 expression, contributing to attenuation of apoptosis and ERS induced by Aß25-35. CONCLUSION: Aß25-35-induced ERS and apoptosis in SH-SY5Y cells can be attenuated by lncRNA RPPH1 through regulating miR-326/PKM2 axis. This study provided therapeutic options for AD patients.

Cycloastragenol inhibits Aß1-42-induced blood-brain barrier disruption and enhances soluble Aß efflux in vitro.

This study aimed to evaluate the effect Cycloastragenol (CAG), a triterpenoid saponin isolated from the Radix astragali, on Aß-induced BBB damage. An immortalized endothelial cell line (bEnd.3) was employed to mimic a BBB. The Western blot, TUNEL staining, Flow cytometric analysis and Enzyme-linked immunosorbent assay were performed. The present results showed that CAG (10, 50, 75 µM) can alleviate oligomer Aß1-42 induced bEnd.3 cell apoptosis and increase tight junction scaffold proteins expression. The result also indicated that CAG increased soluble Aß efflux across BBB via upregulation of the P-gp and downregulation of RAGE expression.[Formula: see text].

Genome-Wide Identification and Analysis of CC-NBS-LRR Family in Response to Downy Mildew and Black Rot in Chinese Cabbage.

The nucleotide-binding site-leucine-rich repeat (NBS-LRR) gene family is the largest group of plant disease resistance (R) genes widespread in response to viruses, bacteria, and fungi usually involved in effector triggered immunity (ETI). Forty members of the Chinese cabbage CC type NBS-LRR family were investigated in this study. Gene and protein characteristics, such as distributed locations on chromosomes and gene structures, were explored through comprehensive analysis. CC-NBS-LRR proteins were classified according to their conserved domains, and the phylogenetic relationships of CC-NBS-LRR proteins in Brassica rapa, Arabidopsis thaliana, and Oryza sativa were compared. Moreover, the roles of BrCC-NBS-LRR genes involved in pathogenesis-related defense were studied and analyzed. First, the expression profiles of BrCC-NBS-LRR genes were detected by inoculating with downy mildew and black rot pathogens. Second, sensitive and resistant Chinese cabbage inbred lines were screened by downy mildew and black rot. Finally, the differential expression levels of BrCC-NBS-LRR genes were monitored at 0, 1, 3, 6, 12 and 24 h for short and 0, 3, 5, 7, 10 and 14 days for long inoculation time. Our study provides information on BrCC-NBS-LRR genes for the investigation of the functions and mechanisms of CC-NBS-LRR genes in Chinese cabbage.

Non-neural surface ectodermal rosette formation and F-actin dynamics drive mammalian neural tube closure.

The mechanisms underlying mammalian neural tube closure remain poorly understood. We report a unique cellular process involving multicellular rosette formation, convergent cellular protrusions, and F-actin cable network of the non-neural surface ectodermal cells encircling the closure site of the posterior neuropore, which are demonstrated by scanning electron microscopy and genetic fate mapping analyses during mouse spinal neurulation. These unique cellular structures are severely disrupted in the surface ectodermal transcription factor Grhl3 mutants that exhibit fully penetrant spina bifida. We propose a novel model of mammalian neural tube closure driven by surface ectodermal dynamics, which is computationally visualized.

LncRNA Rpph1 protects amyloid-ß induced neuronal injury in SK-N-SH cells via miR-122/Wnt1 axis.

Objective: To investigate the role of lncRNA Rpph1 on amyloid-ß induced neuronal injury in SK-N-SH cells and underlying mechanism.Methods: In vitro Alzheimer's disease (AD) model was established using the SK-N-SH cells treated with Aß25-35 peptide. APPswe/PS1ΔE9 double transgenic mice were used as AD animal model. Rpph1 was over-expressed and miR-122 was inhibited or overexpressed in SK-N-SH cells via transfection with pcDNA3.1-oe Rpph1 vector, miR-122 inhibitor or miR-122 mimic, respectively. Cell viabilities and apoptosis were evaluated using MTT or flow cytometry assay, respectively. Quantitative real-time PCR (RT-qPCR) was used to determine expression of Rpph1 and miR-122. Western blotting was used to determine the expression of apoptosis related proteins as well as Wnt/ß-catenin signaling related proteins. Dual luciferase reporter assay was conducted to confirm the binding of miR-122 with predictive binding site in 3' UTR of Rpph1 and Wnt1.Results: Both lncRNA Rpph1 and miR-122 were up-regulated in AD mouse. Either over-expression of Rpph1 or inhibition of miR-122 restored the cell viability or decreased cell apoptosis rate in Aß induced SK-N-SH cells. Overexpression of miR-122 inhibited the cell viability while did not influence the Aß level in SK-N-SH cells. Furthermore, over-expression of Rpph1, as well as inhibition of miR-122, elevated Bcl-2, c-myc, Survivin and decreased Bax expression via activating Wnt/ß-catenin signaling. Dual luciferase reporter assay showed that miR-122 could directly target to 3'UTR of Rpph1 and Wnt1.Conclusion: Both lncRNA Rpph1 and miR-122 were up-regulated in AD mouse and Rpph1 activated Wnt/ß-catenin signaling to ameliorate amyloid-ß induced neuronal apoptosis in SK-N-SH cells via direct targeting miR-122.

CsSPL functions as an adaptor between HD-ZIP III and CsWUS transcription factors regulating anther and ovule development in Cucumis sativus (cucumber).

Anther and ovule genesis preconditions crop fertilization and fruit production; however, coordinative regulation of anther and ovule development and underlying molecular pathways remain largely elusive. Here, we found that SPOROCYTELESS (SPL)/NOZZLE (NZZ) expression was nearly abolished in a Cucumis sativus (cucumber) mutant with severely defective anther and ovule development. CsSPL was expressed specifically in the developing anthers and ovules. Knock-down of CsSPL reduced male and female fertility with malformed pollen and suppressed ovule development. Importantly, CsSPL directly interacted with CsWUS (WUSCHEL) in the nucellus and YABBY family genes in integuments, and positively regulated CsWUS expression, meanwhile the HD-ZIP III gene CsPHB (PHABULOSA), expressed specifically in the nucellus, promoted CsSPL expression by binding to the CsSPL promoter. Thus, CsSPL acts as an adaptor to link CsPHB and CsWUS functioning, underpinning a previously unidentified regulatory pathway orchestrating sex organ development in planta. In addition, auxin accumulation was reduced in the reproductive organs of CsSPL knock-down plants. Biochemical analyses further showed that CsSPL stimulated the expression of AUXIN RESPONSE FACTOR 3 (CsARF3), and was positively regulated by CsARF13 during reproductive organ development, indicating sequential interactions of CsSPL with auxin signaling components in orchestrating anther and ovule development.