RESUMO
In this study, we evaluated genetic factors related to the mineral density during post-menopause. We evaluated 110 women in the first 5 years post-menopause, without previous hormone replacement therapy. Cytochrome P450 17 (CYP17) (rs743572), catechol-O-methyl transferase (COMT) (rs4680), and estrogen receptor 1 (ESR1) (rs9322331) were examined for the presence of polymorphisms. Clinical data were collected by anamnesis; all patients had the osseous densitometry examined using a lunar instrument to determine mineral osseous densitometry in the lumbar column (L2-L4). CYP17, COMT, and ESR1 genotyping was carried out by polymerase chain reaction with DNA collected from buccal swabs. The average age was 51.96 years. The average weights of the patients in control and osteopenia groups were 70.25 ± 12.00 and 62.45 ± 11.64, respectively (P = 0.001) and body mass index (P = 0.006; control: 29.43 ± 5.25; osteopenia: 26.72 ± 4.57). Related to CYP17 polymorphisms, 28.18% of women were TT (wild-type homozygous), 60% were TC (heterozygous), and 11.82% were CC (mutated homozygous). Related to COMT polymorphisms, 53.64% of women were GG (wild-type homozygous), 37.27% were GA (heterozygous), and 9.09% were AA (mutated homozygous). Related to ESR1, 53.64% of women were CC (wild-type homozygous), 40.91% were CT (heterozygous), and 5.45% were TT (mutated homozygous). The ESR1 variant allele was significantly higher in the osteopenia group when compared with women in the normal group (P = 0.02). ESR1 may be associated with low mineral osseous densitometry, while CYP17 and COMT gene polymorphisms were not associated with mineral osseous densitometry.
Assuntos
Densidade Óssea/genética , Catecol O-Metiltransferase/genética , Receptor alfa de Estrogênio/genética , Estudos de Associação Genética , Polimorfismo de Nucleotídeo Único , Pós-Menopausa , Esteroide 17-alfa-Hidroxilase/genética , Adulto , Alelos , Doenças Ósseas Metabólicas/etiologia , Doenças Ósseas Metabólicas/patologia , Feminino , Genótipo , Humanos , Pessoa de Meia-Idade , Razão de Chances , Fatores de RiscoRESUMO
OBJECTIVE: To evaluate whether soybean extracts and estrogens present additive effects on adult rat uterus. METHODS: Fifty ovariectomized rats were randomly divided into five equal groups of ten animals: Control, treated with vehicle; SE46 and SE120, treated with 46 and 120 mg/kg soybean concentrated extract (SE), respectively; EE, treated with conjugated equine estrogens (CE) 50 µg/kg; SE120 + EE, treated with 50 µg/kg (CE) plus 120 mg/kg SE. The substances were administered daily by gavage for 21 consecutive days. Thereafter the animals were weighed and killed by decapitation; trunk blood was collected for hormone determinations. Uteri were removed immediately and fixed in 10% formaldehyde, followed by dehydration, embedding in paraffin and 6-m sections staining with hematoxylin and eosin for histomorphometric analyses of myometrium and endometrium. After ANOVA analysis of the data, the study was complemented with the Tukey-Kramer test for multiple comparisons. RESULTS: The concentrated extract of soybean at high concentration (SE 120 kg/mg) and estrogens proved to have a trophic effect on the uterus (endometrium and myometrium) of castrated rats. In groups SE120, EE and SE120 + EE, all morphometric parameters examined (number of glands, eosinophils, blood vessels and the glandular area) were increased. No significant addictive effects of soybean extract plus estrogens were detected in the SE120 + EE group. CONCLUSIONS: Our results indicate that soy extract has a trophic effect on rat uterine structures. Treatment of ovariectomized rats with a concentrated soy extract in combination with conjugated estrogens had no addictive effect on the uterine response.
Assuntos
Estrogênios Conjugados (USP)/farmacologia , Estrogênios/farmacologia , Fitoestrógenos/farmacologia , Extratos Vegetais/farmacologia , Útero/anatomia & histologia , Útero/efeitos dos fármacos , Análise de Variância , Animais , Endométrio/anatomia & histologia , Endométrio/efeitos dos fármacos , Estradiol/sangue , Feminino , Genisteína/farmacologia , Isoflavonas/farmacologia , Miométrio/anatomia & histologia , Miométrio/efeitos dos fármacos , Tamanho do Órgão , Ovariectomia , Progesterona/sangue , Ratos , Glycine maxRESUMO
OBJECTIVE: To identify clinical, physical, life quality and nutritional aspects of Brazilian women during menopausal transition and postmenopausal periods. METHODS: 115 women agreed to participate in the study. They were divided into two groups: GI--menopausal transition (n = 48) and GII--postmenopause (n = 67). The Kupperman-Blatt Menopausal Index (IMK) and Women's Health Questionnaire (WHQ), Food Frequency Questionnaire and functional capacity were used. All patients were examined and underwent clinical and gynecological examination. RESULTS: There was no significant difference in IMK, WHQ and functional capacity in either group. There was a higher caloric intake, especially in sugars, in postmenopause women than in menopausal transition women. Both groups presented reduced parameters in life quality and functional capacity. CONCLUSION: Our data suggests that there is no significant difference between women in menopausal transition and postmenopause, except in relation to the nutritional parameter. In both groups, the women presented low quality of life and reduced functional capacity.
Assuntos
Dieta , Menopausa/fisiologia , Pós-Menopausa/fisiologia , Qualidade de Vida , Índice de Massa Corporal , Brasil , Sacarose Alimentar/administração & dosagem , Ingestão de Energia , Feminino , Humanos , Estado Civil , Pessoa de Meia-Idade , Fenômenos Fisiológicos da NutriçãoRESUMO
OBJECTIVE: To investigate the association between the CYP17alpha gene polymorphism and hot flushes in postmenopausal women. METHODS: Ninety-three non-hysterectomized, postmenopausal women were enrolled in this study. Vasomotor symptoms were assessed at the baseline visit and based on information provided by each participant. The genotypic polymorphism of CYP17alpha gene was analyzed by PCR-RFLP assay using genomic DNA isolated from peripheral blood lymphocytes. RESULTS: Thirty-six women reported hot flushes of mild intensity, 25 reported hot flushes of moderate intensity and 32 of severe intensity. There was no significant difference between the severity of hot flushes and the CYP17 genotype or allele frequencies, 0.58 and 0.67 respectively. No association was found between hot flush severity and the CYP17 allele (odds ratio = 1.17, p = 0.61). CONCLUSION: The results of this study suggest that the CYP17 MspAI polymorphism was not significantly associated with an increased risk of reporting hot flushes.
Assuntos
Fogachos/genética , Pós-Menopausa , Esteroide 17-alfa-Hidroxilase/genética , Feminino , Frequência do Gene , Genótipo , Humanos , Pessoa de Meia-Idade , Reação em Cadeia da Polimerase , Polimorfismo de Fragmento de Restrição , Índice de Gravidade de DoençaRESUMO
Two cis-acting elements in the p120 gene play important roles in transcription; the region from -537 to -278 is necessary for initiation of transcription, and the region from -1426 to -1223 is necessary for efficient transcription. The distal element(s) which lies upstream of -278 is required for initiation of transcription.
Assuntos
Antígenos/genética , Genes Reguladores , Proteínas Nucleares/genética , Regiões Promotoras Genéticas , Transcrição Gênica , Sequência de Bases , Nucléolo Celular/imunologia , Deleção Cromossômica , Humanos , Dados de Sequência Molecular , Mutação , Sondas de Oligonucleotídeos , Mapeamento por Restrição , Fatores de Transcrição/metabolismoRESUMO
In this report we evaluated the action of conjugated equine estrogens (CEE) on vaginal symptoms, cytology, pH, and flora in late postmenopausal women without any previous hormone therapy. The study was a randomized, double-blind, placebo-controlled trial with 48 late postmenopausal women who received placebo or unopposed CEE (0.625mg/day of CEE orally) during three months of treatment. Vaginal and sexual complaints were evaluated through daily diary cards. We analyzed vaginal changes through cytology and pH measurements. After three months of treatment, 20% of placebo-treated patients and 80% of the CEE-treated patients reported improvement in vaginal dryness and irritation. In the latter group, the vaginal cells and Lactobacillus increased and the vaginal pH decreased, without other changes in sexual complaints. We concluded that estrogen ameliorated the genital tract of late postmenopausal women without any previous hormone therapy.
Assuntos
Estrogênios Conjugados (USP)/uso terapêutico , Estrogênios/uso terapêutico , Pós-Menopausa , Vagina/efeitos dos fármacos , Atrofia/tratamento farmacológico , Método Duplo-Cego , Endométrio/diagnóstico por imagem , Estradiol/sangue , Feminino , Hormônio Foliculoestimulante/sangue , Humanos , Concentração de Íons de Hidrogênio , Lactobacillus/crescimento & desenvolvimento , Lactobacillus/isolamento & purificação , Pessoa de Meia-Idade , Disfunções Sexuais Fisiológicas/tratamento farmacológico , Ultrassonografia , Vagina/química , Vagina/microbiologia , Vagina/patologia , Esfregaço VaginalRESUMO
We recently demonstrated lymphoma development in transgenic mice deficient in retinoic acid receptor alpha (RARalpha). High incidence of lymphoma development in this transgenic mouse model system was similar to lymphoma development in p53 knockout mice. In an effort to understand the molecular basis of lymphomagenesis in RARalpha-deficient transgenic mice, we compared the levels of RARalpha to the levels of p53 mRNA, and Bcl-2, and Bax proteins in lymphoid and non-lymphoid tissues and in lymphomas derived from the RARalpha-deficient transgenic mice. The p53 mRNA levels were depleted in various tissues including spleen ( approximately 96%), thymus ( approximately 29%) and bone marrow ( approximately 62%) of RARalpha-deficient transgenic mice when compared with the normal littermates, and the reduction in p53 mRNA expression in the various tissues examined was proportional to the reduction in RARalpha expression. Bcl-2 to Bax ratios were highly increased in the lymphoid compartments (spleen >bone marrow >thymus) because of selective overexpression of Bcl-2 protein. In summary, RARalpha downmodulation in this transgenic mouse model system was accompanied by p53 downmodulation and deregulation of Bcl-2 to Bax ratios in the lymphoid compartments.
Assuntos
Regulação da Expressão Gênica , Genes bcl-2 , Genes p53 , Receptores do Ácido Retinoico/fisiologia , Animais , Humanos , Camundongos , Camundongos Transgênicos , Proteínas Proto-Oncogênicas/análise , Proteínas Proto-Oncogênicas c-bcl-2/análise , RNA Mensageiro/análise , Receptor alfa de Ácido Retinoico , Proteína X Associada a bcl-2RESUMO
The human analogue of the mouse double minute-2 (MDM-2) protein binds to p53 protein and abrogates its tumor-suppressing activity. MDM-2 overexpression may represent an alternative mechanism to p53 mutation for escaping the p53-mediated growth control. Interestingly, multiple MDM-2 protein isoforms have been described and the possibility of functional differences between various isoforms has been raised. Previously, we demonstrated significant MDM-2 mRNA overexpression in human leukemias and suggested that MDM-2 overexpression may be a marker of aggressiveness of the disease. Polyclonal antibodies (Ab) have been generated to detect various isoforms of the MDM-2 protein. Using these Abs, we confirmed MDM-2 protein overexpression in leukemias. Furthermore, we observed heterogeneity in the isoforms expressed in various types of leukemias. In addition, we demonstrated that analysis by flow cytometry could be used as a diagnostic tool for detecting altered MDM-2 protein expression in leukemias. Here we review and expand our initial observations and confirm MDM-2 mRNA and protein overexpression by reverse transcription-polymerase chain reaction (RT-PCR), flow cytometry, and western blot analyses. Understanding the possible role of MDM-2 oncogene expression in leukemias may establish the scientific basis for new therapeutic approaches.
Assuntos
Regulação Leucêmica da Expressão Gênica , Leucemia/genética , Proteínas Nucleares , Proteínas Proto-Oncogênicas/genética , Humanos , Prognóstico , Proteínas Proto-Oncogênicas c-mdm2RESUMO
The effects of gonadal steroids or tamoxifen over the synaptic density of the CA1 region of the hippocampus was investigated in ovariectomized (OVX) rats. Chronic oral administration of conjugated equine estrogen, conjugated equine medroxyprogesterone, a combination of both or tamoxifen was performed in ovariectomized (OVX) rats over a period of 60 days. Synaptic density of the stratum radiatum of the CA1 region was evaluated by means of electron microscopy. Significant increases in the range of 34-49% were found for treated animals as compared to OVX controls not subject to hormonal replacement. Our results confirm previously reported effects of estradiol over synaptic density in this region and reports for the first time an effect of medroxyprogesterone (alone or in combination with estrogen) and tamoxifen. Our findings support the notion that hormonal replacement therapy and tamoxifen might have beneficial effects for cognitive function.
Assuntos
Estrogênios/administração & dosagem , Hipocampo/efeitos dos fármacos , Medroxiprogesterona/administração & dosagem , Sinapses/efeitos dos fármacos , Tamoxifeno/administração & dosagem , Administração Oral , Animais , Contagem de Células , Esquema de Medicação , Antagonistas de Estrogênios/farmacologia , Feminino , Hipocampo/ultraestrutura , Ovariectomia , Congêneres da Progesterona/farmacologia , Ratos , Ratos Wistar , Sinapses/ultraestruturaRESUMO
OBJECTIVE: The aim of the study is to observe the morphology and morphometry of the endometrium of postmenopausal women treated with cyclic conjugated oestrogens. STUDY DESIGN: Three groups of nine postmenopausal women received cyclic conjugated oestrogens for 21 days (with a seven-day pause) during six months. The endometrial specimens were obtained using a modified Novak suction curet, in the second or third day of the period of drug washout. The slides were stained with haematoxylin and eosin (H.E.) in order to measure epithelial height and determine the gland/stroma ratio. RESULTS: Morphologic examination showed that single daily doses of 0.3 mg of conjugated oestrogens caused discrete endometrial proliferation after three and six months of treatment. However, a more intense effect was observed in women receiving doses of 0.625 and 1.25 mg/day of the hormone, in the same period. Morphometric study revealed significant increases both in epithelial thickness and in the gland-stroma ratio, specially in women receiving higher doses of the conjugated oestrogen (0.625 and 1.25 mg/day). CONCLUSIONS: We concluded that there were marked proliferative alterations without atypias in the endometrium of women that received 0.625 and 1.25 mg of conjugated oestrogens during six months.
Assuntos
Endométrio/citologia , Terapia de Reposição de Estrogênios , Pós-Menopausa , Divisão Celular , Endométrio/patologia , Células Epiteliais , Estrogênios Conjugados (USP)/administração & dosagem , Feminino , Humanos , Hiperplasia , Pessoa de Meia-Idade , Mucosa/citologia , Células Estromais/citologiaRESUMO
In this report we examined the ultrastructural features of the postmenopausal endometrial cells of women treated with different doses of conjugated equine estrogen (CEE), or transdermal 17beta-estradiol. Eight women with uterine prolapse and at least 5 years of menopause were randomly divided into four groups and treated as follows: (I) no hormonal treatment; (II) 0.625mg/day of CEE orally; (III) 1.25mg/day of CEE orally; (IV) 50microg/day of 17beta-estradiol transdermally. Hormones were administered for 28 days followed by vaginal hysterectomy. Fragments of the endometrium were prepared for transmission electron microscopic analysis. We observed that the postmenopausal endometrium of the untreated group was atrophic with lined superficial epithelial cuboidal cells. The presence of gland and stroma cells with clear cytoplasm containing few organelles and heterochromatin nuclei were also observed. On the contrary, the endometrium of the group that received 0.625mg/day of CEE showed signs of proliferative cells such as the presence of numerous organelles in the cytoplasm and euchromatic nuclei. All of the proliferative effects on the endometrium were more pronounced in the groups that received 1.25mg/day of CEE and 50microg/day of transdermal 17beta-estradiol. We concluded that the ultrastructural proliferative changes of the postmenopausal endometrium induced by 1.25mg/day of CEE were similar to 50microg/day of transdermal 17beta-estradiol.
Assuntos
Endométrio/efeitos dos fármacos , Endométrio/ultraestrutura , Estradiol/farmacologia , Estrogênios Conjugados (USP)/farmacologia , Administração Cutânea , Administração Oral , Estradiol/administração & dosagem , Estrogênios Conjugados (USP)/administração & dosagem , Feminino , Humanos , Pessoa de Meia-Idade , Pós-MenopausaRESUMO
The ACTH test has been used to confirm the diagnosis of adrenal insufficiency and the classic and the non-classic adrenal hyperplasia due to the 3-HSD, 21 OH e 110H deficiencies. This article reviews the historical aspects of the use of ACTH in the diagnosis of hirsutism and points out its mains indications. In spite of new biological molecular advances in the diagnosis of adrenal enzymatic deficiencies, the use of the ACTH test can help the physician to predict both genothipus and fenothipus in populations with hyperandrogenic manifestations due to non-classical or late-onset congenital adrenal hyperplasia.
Assuntos
Hormônio Adrenocorticotrópico , Hirsutismo/diagnóstico , Humanos , Sistema Hipófise-Suprarrenal/enzimologiaRESUMO
OBJECTIVE: To evaluate clinically, and with laboratory, tests, women with polycystic ovary syndrome (PCO). PATIENTS: One hundred and twelve women with PCO were studied. METHODS: The following data was recorded: Current age; age at menarche; menstrual irregularity, occurrence of similar cases in the family; fertility, obstetric history; body mass index (BMI); and presence of hirsutism. Serum measurements of follicle stimulating hormone (FSH), luteinizing hormone (LH), prolactin, free testosterone, and dehydroepiandrosterone sulfate were taken. RESULTS: All patients presented either oligomenorrhea (31 percent), periods of secondary amenorrhea (9 percent), or both alterations (60 percent). The majority of the patients were infertile (75.6 percent). The LH/FSH ratio was higher than 2:1 in 55 percent of the patients and higher than 3:1 in 26.2 percent. The ultrasonographic aspect of the ovaries was considered to be normal in 31 percent. CONCLUSION: The main clinical feature of the PCO is the irregularity of menses since menarche, and that the laboratory tests would be important to exclude other disorders such as hyperprolactinemia or hyperandrogenemia caused by late-onset congenital adrenal hyperplasia.
Assuntos
Síndrome do Ovário Policístico/diagnóstico , Adolescente , Adulto , Feminino , Humanos , Estudos RetrospectivosRESUMO
The authors documented by means of light and transmission electron microscopy that the ovaries of women with premature ovarian failure (POF) displayed dense connective tissue and rare corpora albicantia. Eight of the ten studied cases did not present ovarian follicles; in two cases, it was verified the presence of ovarian follicles, atypical primordial follicles and in one case, a corpus luteum was identified (after stimulation with exogenous gonadotrophin). Regarding the ultrastructural analysis, it was noted that the fibroblasts were united one to each other by cellular prolongations that formed a woof, constituting a cellular syncicius.
Assuntos
Insuficiência Ovariana Primária/patologia , Adulto , Biópsia , Feminino , Humanos , Microscopia EletrônicaRESUMO
OBJECTIVE: To investigate the ovarian activity before and after gonadal suppression with GnRH-analog in patients with PCO, hyperandrogenism, hyperinsulinism and acanthosis nigricans. DESIGN: Controlled clinical study. SETTING: Tertiary academic medical center. PATIENTS: Six patients with clinical findings of PCO, hirsutism and acanthosis nigricans. INTERVENTIONS: Morning blood samples in the follicular phase to determine the steroid levels, glucose and insulin curve, comparing to a control group. Administration for 2 consecutive months of a GnRH-analog, comparing, in the study group, the free testosterone levels before and after ovarian suppression. MAIN OUTCOME MEASURE: Determination of insulin levels in PCO, hirsutism and acanthotic patients and the free-testosterone levels before and after gonadal suppression. RESULTS: Insulin levels were significantly higher in the study group when compared to normal women during the glycemic test. We also found a significant decrease in the free-testosterone levels after 2 months of gonadal suppression with GnRH-analog when compared to the initial time. CONCLUSIONS: Patients with PCO, hirsutism and acanthosis nigricans present high levels of insulin, suggesting an ovarian hyperesponsiveness, which is not sustained when gonadotrophic blockage was achieved.
Assuntos
Acantose Nigricans/metabolismo , Doenças do Sistema Endócrino/metabolismo , Hormônio Liberador de Gonadotropina/análise , Síndrome do Ovário Policístico/metabolismo , Adolescente , Adulto , Feminino , Teste de Tolerância a Glucose , Hormônio Liberador de Gonadotropina/análogos & derivados , Humanos , Hiperandrogenismo/metabolismo , Hiperinsulinismo/metabolismo , Insulina/análise , Ovário/fisiopatologiaRESUMO
Studies have shown that estrogen replacement therapy and estrogen plus progestin replacement therapy alter serum levels of total, LDL and HDL cholesterol levels. However, HDL cholesterol levels in women vary considerably in response to hormone replacement therapy (HRT). A significant portion of the variability of these levels has been attributed to genetic factors. Therefore, we investigated the influence of estrogen receptor-alpha (ESR1) gene polymorphisms on HDL levels in response to postmenopausal HRT. We performed a prospective cohort study on 54 postmenopausal women who had not used HRT before the study and had no significant general medical illness. HRT consisted of conjugated equine estrogen and medroxyprogesterone acetate continuously for 1 year. The lipoprotein levels were measured from blood samples taken before the start of therapy and after 1 year of HRT. ESR1 polymorphism (MspI C>T, HaeIII C>T, PvuII C>T, and XbaI A>G) frequencies were assayed by restriction fragment length polymorphism. A general linear model was used to describe the relationships between HDL levels and genotypes after adjusting for age. A significant increase in HDL levels was observed after HRT (P = 0.029). Women with the ESR1 PvuII TT genotype showed a statistically significant increase in HDL levels after HRT (P = 0.032). No association was found between other ESR1 polymorphisms and HDL levels. According to our results, the ESR1 PvuII TT genotype was associated with increased levels of HDL after 1 year of HRT.
Assuntos
HDL-Colesterol/sangue , Receptor alfa de Estrogênio/genética , Terapia de Reposição de Estrogênios , Estrogênios Conjugados (USP)/uso terapêutico , Acetato de Medroxiprogesterona/uso terapêutico , Polimorfismo Genético/genética , HDL-Colesterol/genética , Estudos de Coortes , Feminino , Genótipo , Humanos , Pessoa de Meia-Idade , Polimorfismo de Fragmento de Restrição , Estudos ProspectivosRESUMO
For the purpose of attempting to generalize the rules concerning morphogenesis of helical viruses, the in vitro reconstitution of the CAM strain of TRV was studied. The conditions for reconstitution and the importance of the aggregation state of the protein for initiation and elongation are compared with those of TMV. The initiation step consisting of the binding of RNA with the 36S disk of protein was easily accomplished. The polarity and the specificity of encapsidation of TRV RNA by homologous and heterologous viral protein is discussed.
Assuntos
Vírus de Plantas/metabolismo , Vírus de RNA/metabolismo , RNA Viral/metabolismo , Proteínas Virais/metabolismo , Técnicas In Vitro , Vírus de Plantas/ultraestrutura , Vírus de RNA/ultraestruturaRESUMO
Studies on the thyroid-hormone receptors in the nuclei of developing chick brain revealed a single class of binding sites for tri-iodothyronine (T3) and thyroxine (T4) at all embryonic and adult ages. High-affinity [Ka = (1.85-3.3) X 10(9)M-1 and (0.3-0.6 X 10(9)M-1 for T3 and T4 respectively] receptors were detected in the brain as early as day 7 of embryonic development; their level increased progressively rapidly until day 13, and thereafter the value remained essentially constant during development. Occupancy of the receptor site with endogenous hormone was 75-90% at 7-11 days, 50-60% during the late phase of embryogenesis (13-17 days), and 80% after hatching. Comparison of the binding properties of the receptors with T3 and T4 indicates that, although the binding capacities per nucleus are almost identical, T4 has four to five times less binding affinity than T3. The half-lives of dissociation of solubilized T3- receptor complexes were 20-30h between 0 degrees and 7 degrees C, about 4h at 20 degrees C and less than 15 min at 37 degrees C. Studies of the regional distribution of receptors in the brain indicate that cerebrum has the highest concentration of T3 receptors (4000-7000 sites per nucleus); this concentration is 2-4-fold higher than that in the cerebellum, optic lobe or medulla oblongata. The overall results indicate that between 7 and 13 days of embryonic development the thyroid-hormone receptors in the embryonic chick brain, particularly in the cerebrum, assume a very high level and appear to be mostly saturated with endogenous hormone. This, and the temporal correspondence of the phenomenon with the period of neuronal growth and synaptogenesis, strongly indicate the influence of the hormone in the maturation of the developing brain.
Assuntos
Encéfalo/metabolismo , Receptores de Superfície Celular/metabolismo , Animais , Encéfalo/embriologia , Encéfalo/crescimento & desenvolvimento , Núcleo Celular/metabolismo , Embrião de Galinha , Galinhas , Cinética , Substâncias Macromoleculares , Receptores dos Hormônios Tireóideos , Tiroxina/metabolismo , Distribuição Tecidual , Tri-Iodotironina/metabolismoRESUMO
The relative concentration of the triiodothyronine (T3) receptors in the neuronal and glial nuclei of developing chick brain have been studied. Scatchard analysis indicate that the number of T3 binding sites in the neuronal nuclei increases from 400 to 1600 sites/nucleus between 7-11 day of embryonic development without any concomitant change in the level of glial nuclear receptors (130 - 200 sites/nucleus). Both sites are of high affinity (Ka = 1-3 x 10(9) M-1) at all ages examined. The abundance of the T3- receptors in the neuronal nuclei and the close coincidence of the period of rise in the level of these receptors in these nuclei (7-11 day) with that of maximal neuronal growth and synaptogenesis (7-13 day) suggest that the neurons are the primary site of action of T3 in the developing brain.
Assuntos
Encéfalo/embriologia , Neurônios/metabolismo , Receptores de Superfície Celular/metabolismo , Animais , Encéfalo/metabolismo , Química Encefálica , Núcleo Celular/metabolismo , Embrião de Galinha , Neuroglia/metabolismo , Receptores dos Hormônios TireóideosRESUMO
Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription.