Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 79
Filtrar
1.
Cancer Sci ; 2024 Jun 15.
Artigo em Inglês | MEDLINE | ID: mdl-38877783

RESUMO

Application of physical forces, ranging from ultrasound to electric fields, is recommended in various clinical practice guidelines, including those for treating cancers and bone fractures. However, the mechanistic details of such treatments are often inadequately understood, primarily due to the absence of comprehensive study models. In this study, we demonstrate that an alternating magnetic field (AMF) inherently possesses a direct anti-cancer effect by enhancing oxidative phosphorylation (OXPHOS) and thereby inducing metabolic reprogramming. We observed that the proliferation of human glioblastoma multiforme (GBM) cells (U87 and LN229) was inhibited upon exposure to AMF within a specific narrow frequency range, including around 227 kHz. In contrast, this exposure did not affect normal human astrocytes (NHA). Additionally, in mouse models implanted with human GBM cells in the brain, daily exposure to AMF for 30 min over 21 days significantly suppressed tumor growth and prolonged overall survival. This effect was associated with heightened reactive oxygen species (ROS) production and increased manganese superoxide dismutase (MnSOD) expression. The anti-cancer efficacy of AMF was diminished by either a mitochondrial complex IV inhibitor or a ROS scavenger. Along with these observations, there was a decrease in the extracellular acidification rate (ECAR) and an increase in the oxygen consumption rate (OCR). This suggests that AMF-induced metabolic reprogramming occurs in GBM cells but not in normal cells. Our results suggest that AMF exposure may offer a straightforward strategy to inhibit cancer cell growth by leveraging oxidative stress through metabolic reprogramming.

2.
Jpn J Clin Oncol ; 2024 Jun 12.
Artigo em Inglês | MEDLINE | ID: mdl-38864246

RESUMO

BACKGROUND: PET/CT imaging with Zirconium-89 labeled [89Zr]Zr-DFO-girentuximab, which targets tumor antigen CAIX, may aid in the differentiation and characterization of clear cell renal cell carcinomas (RCC) and other renal and extrarenal lesions, and has been studied in European and American cohorts. We report results from a phase I study that evaluated the safety profile, biodistribution, and dosimetry of [89Zr]Zr-DFO-girentuximab in Japanese patients with suspected RCC. METHODS: Eligible adult patients received 37 MBq (± 10%; 10 mg mass dose) of intravenous [89Zr]Zr-DFO-girentuximab. Safety and tolerability profile was assessed based on adverse events, concomitant medications, physical examination, vital signs, hematology, serum chemistry, urinalysis, human anti-chimeric antibody measurement, and 12-lead electrocardiograms at predefined intervals. Biodistribution and normal organ and tumor dosimetry were evaluated with PET/CT images acquired at 0.5, 4, 24, 72 h and Day 5 ± 2 d after administration. RESULTS: [89Zr]Zr-DFO-girentuximab was administered in six patients as per protocol. No treatment-emergent adverse events were reported. Dosimetry analysis showed that radioactivity was widely distributed in the body, and that the absorbed dose in healthy organs was highest in the liver (mean ± standard deviation) (1.365 ± 0.245 mGy/MBq), kidney (1.126 ± 0.190 mGy/MBq), heart wall (1.096 ± 0.232 mGy/MBq), and spleen (1.072 ± 0.466 mGy/MBq). The mean effective dose, adjusted by the radioactive dose administered, was 0.470 mSv/MBq. The radiation dose was highly accumulated in the targeted tumor, while any abnormal accumulation in other organs was not reported. CONCLUSIONS: This study demonstrates that [89Zr]Zr-DFO-girentuximab administered to Japanese patients with suspected RCC has a favorable safety profile and is well tolerated and has a similar dosimetry profile to previously studied populations.

3.
Int J Urol ; 31(6): 678-684, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38402449

RESUMO

OBJECTIVE: In December 2021, enfortumab vedotin (EV), an antibody-drug conjugate directed against nectin-4, was approved in Japan as a new treatment after platinum-containing chemotherapy and PD-1/PD-L1 inhibitors. This study evaluated, using real-world data, the efficacy and safety of EV therapy in patients with metastatic urothelial carcinoma (mUC). MATERIALS AND METHODS: Fifty-five patients with mUC who discontinued pembrolizumab therapy due to disease progression between June 2018 and April 2023 at Yokohama City University Hospital were evaluated retrospectively. Of the 55 patients, 25 received EV therapy (EV group) and 30 did not (non-EV group). All patients who underwent EV therapy were diagnosed with disease progression after the approval of EV in Japan. RESULTS: The median (range) follow-up period after pembrolizumab discontinuation was 6.3 (0.7-31.1) months. There were eight (32.0%) deaths due to cancer in the EV group and 27 (90.0%) in the non-EV group. The overall survival (OS) after pembrolizumab discontinuation was not reached in the EV group versus 2.6 months in the non-EV group (p < 0.001). A multivariate analysis revealed that EV therapy (EV vs. non-EV group; hazard ratio 0.26; 95% confidence interval 0.16-0.41; p < 0.001) was an independent prognostic factor for OS. CONCLUSION: EV prolonged OS in mUC following pembrolizumab therapy in real-world data.


Assuntos
Anticorpos Monoclonais Humanizados , Antineoplásicos Imunológicos , Carcinoma de Células de Transição , Humanos , Anticorpos Monoclonais Humanizados/uso terapêutico , Anticorpos Monoclonais Humanizados/efeitos adversos , Masculino , Feminino , Idoso , Estudos Retrospectivos , Pessoa de Meia-Idade , Carcinoma de Células de Transição/tratamento farmacológico , Carcinoma de Células de Transição/mortalidade , Carcinoma de Células de Transição/secundário , Idoso de 80 Anos ou mais , Antineoplásicos Imunológicos/uso terapêutico , Antineoplásicos Imunológicos/efeitos adversos , Japão/epidemiologia , Neoplasias da Bexiga Urinária/tratamento farmacológico , Neoplasias da Bexiga Urinária/mortalidade , Neoplasias da Bexiga Urinária/patologia , Anticorpos Monoclonais/uso terapêutico , Anticorpos Monoclonais/efeitos adversos , Neoplasias Urológicas/tratamento farmacológico , Neoplasias Urológicas/mortalidade , Neoplasias Urológicas/patologia , Progressão da Doença , Taxa de Sobrevida , Imunoconjugados/uso terapêutico , Imunoconjugados/efeitos adversos
4.
Int J Urol ; 30(12): 1096-1102, 2023 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-37592739

RESUMO

OBJECTIVES: To investigate the predictive factors for pentafecta achievement of robot-assisted partial nephrectomy (RAPN) for intermediate highly complex renal tumors (RENAL score ≥ 7). METHODS: We retrospectively analyzed the data of 247 patients with renal tumors with a RENAL score ≥ 7 who underwent RAPN. Baseline characteristics and perioperative outcomes were compared between the pentafecta achieved group and the unachieved group. A multivariable logistic regression model was used to identify the predictive factors for pentafecta achievement for cT1 renal tumors with a RENAL score ≥ 7. RESULTS: Of the 247 patients, 75 (30.3%) patients were in the achieved group and 172 (69.7%) patients were in the unachieved group. The median warm ischemia time and total operation time were 18 min versus 23 min (p < 0.001) and 179 min versus 201 min (p < 0.001) in the achieved and unachieved groups, respectively. In the unachieved group, six patients (3.4%) had major perioperative complications (Clavien-Dindo classification system ≥3). The median preservation rates of estimated GFR at the 1-year postoperative period were 96.5% versus 83.0% (p < 0.001) in the achieved and unachieved groups. Multivariable logistic regression models revealed that age and tumor size were independent predictive factors for pentafecta achievement for cT1 renal tumors with a RENAL score ≥ 7. There were no significant differences in cancer-free survival between the two groups (p = 0.456). CONCLUSION: Age and tumor size were independent predictive factors for pentafecta achievement, although there was no difference in oncological outcomes between the pentafecta achieved group and the unachieved group in RAPN for cT1 renal tumors with a RENAL score ≥ 7.


Assuntos
Neoplasias Renais , Procedimentos Cirúrgicos Robóticos , Robótica , Humanos , Estudos Retrospectivos , Resultado do Tratamento , Neoplasias Renais/cirurgia , Neoplasias Renais/patologia , Nefrectomia/efeitos adversos , Procedimentos Cirúrgicos Robóticos/efeitos adversos
5.
Int J Mol Sci ; 24(24)2023 Dec 07.
Artigo em Inglês | MEDLINE | ID: mdl-38139039

RESUMO

The human mitochondrial genome (mtDNA) is a circular DNA molecule with a length of 16.6 kb, which contains a total of 37 genes. Somatic mtDNA mutations accumulate with age and environmental exposure, and some types of mtDNA variants may play a role in carcinogenesis. Recent studies observed mtDNA variants not only in kidney tumors but also in adjacent kidney tissues, and mtDNA dysfunction results in kidney injury, including chronic kidney disease (CKD). To investigate whether a relationship exists between heteroplasmic mtDNA variants and kidney function, we performed ultra-deep sequencing (30,000×) based on long-range PCR of DNA from 77 non-tumor kidney tissues of kidney cancer patients with CKD (stages G1 to G5). In total, this analysis detected 697 single-nucleotide variants (SNVs) and 504 indels as heteroplasmic (0.5% ≤ variant allele frequency (VAF) < 95%), and the total number of detected SNVs/indels did not differ between CKD stages. However, the number of deleterious low-level heteroplasmic variants (pathogenic missense, nonsense, frameshift and tRNA) significantly increased with CKD progression (p < 0.01). In addition, mtDNA copy numbers (mtDNA-CNs) decreased with CKD progression (p < 0.001). This study demonstrates that mtDNA damage, which affects mitochondrial genes, may be involved in reductions in mitochondrial mass and associated with CKD progression and kidney dysfunction.


Assuntos
Carcinoma de Células Renais , Genoma Mitocondrial , Neoplasias Renais , Insuficiência Renal Crônica , Humanos , DNA Mitocondrial/genética , Heteroplasmia , Variações do Número de Cópias de DNA , Carcinoma de Células Renais/genética , Neoplasias Renais/genética , Insuficiência Renal Crônica/genética
6.
Cancer Sci ; 113(7): 2352-2367, 2022 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-35396773

RESUMO

Renal cell carcinoma with Xp11.2 translocation involving the TFE3 gene (TFE3-RCC) is a recently identified subset of RCC with unique morphology and clinical presentation. The chimeric PRCC-TFE3 protein produced by Xp11.2 translocation has been shown to transcriptionally activate its downstream target genes that play important roles in carcinogenesis and tumor development of TFE3-RCC. However, the underlying molecular mechanisms remain poorly understood. Here we show that in TFE3-RCC cells, PRCC-TFE3 controls heme oxygenase 1 (HMOX1) expression to confer chemoresistance. Inhibition of HMOX1 sensitized the PRCC-TFE3 expressing cells to genotoxic reagents. We screened for a novel chlorambucil-polyamide conjugate (Chb) to target PRCC-TFE3-dependent transcription, and identified Chb16 as a PRCC-TFE3-dependent transcriptional inhibitor of HMOX1 expression. Treatment of the patient-derived cancer cells with Chb16 exhibited senescence and growth arrest, and increased sensitivity of the TFE3-RCC cells to the genotoxic reagent etoposide. Thus, our data showed that the TFE3-RCC cells acquired chemoresistance through HMOX1 expression and that inhibition of HMOX1 by Chb16 may be an effective therapeutic strategy for TFE3-RCC.


Assuntos
Carcinoma de Células Renais , Neoplasias Renais , Fatores de Transcrição de Zíper de Leucina e Hélice-Alça-Hélix Básicos/genética , Fatores de Transcrição de Zíper de Leucina e Hélice-Alça-Hélix Básicos/metabolismo , Carcinoma de Células Renais/tratamento farmacológico , Carcinoma de Células Renais/genética , Carcinoma de Células Renais/metabolismo , Clorambucila/farmacologia , Cromossomos Humanos X , Resistencia a Medicamentos Antineoplásicos/genética , Humanos , Neoplasias Renais/tratamento farmacológico , Neoplasias Renais/genética , Neoplasias Renais/metabolismo , Nylons , Translocação Genética
7.
Int J Urol ; 29(9): 1079-1084, 2022 09.
Artigo em Inglês | MEDLINE | ID: mdl-35976620

RESUMO

BACKGROUND: The ALSYMPCA trial revealed radium-223 (Ra-223) to be a life-prolonging agent for bone metastatic castration-resistant prostate cancer (CRPC). However, only 2.8% of enrolled patients in that clinical trial were Asian, and no Japanese patients were enrolled. Several retrospective studies have been published concerning Japanese bone metastatic CRPC patients receiving Ra-223. However, no study has yet reported the correlation between Ra-223 induction and the survival in Japanese bone metastatic CRPC patients. This study investigated the effect of Ra-223 as a life-prolonging agent in a large Japanese healthcare fee database. METHODS: A total of around 410 000 prostate cancer patients were extracted from this database, and 25 934 were diagnosed with CRPC. In these patients, the age, date of the CRPC diagnosis, date of Ra-223 induction, and prognosis were analyzed. RESULTS: A total of 1628 patients received Ra-223, and 6693 patients were diagnosed with bone metastasis CRPC, with the remaining 17 613 patients diagnosed with CRPC without bone metastasis. The patients who completed six courses of Ra-223 showed a significantly more favorable overall and cancer-specific survival than those who received ≤5 courses (p < 0.0001 and p < 0.0001, respectively). For time from CRPC diagnosis date to death, the Ra-223 induction group showed a significantly more favorable prognosis with regard to both the overall and cancer-specific survival than the bone metastatic CRPC patients without Ra-223 (p < 0.0001 and p < 0.0001, respectively). CONCLUSIONS: Bone metastatic CRPC patients who received Ra-223 showed a significantly better prognosis than bone metastatic CPRC patients who did not receive Ra-223.


Assuntos
Neoplasias Ósseas , Neoplasias de Próstata Resistentes à Castração , Rádio (Elemento) , Neoplasias Ósseas/radioterapia , Neoplasias Ósseas/secundário , Ensaios Clínicos como Assunto , Humanos , Masculino , Prognóstico , Rádio (Elemento)/uso terapêutico , Estudos Retrospectivos
8.
Int J Urol ; 28(4): 440-443, 2021 04.
Artigo em Inglês | MEDLINE | ID: mdl-33508874

RESUMO

OBJECTIVES: To assess the correlation of urine loss rate after catheter removal with long-term continence after robot-assisted radical prostatectomy. METHODS: We enrolled 163 patients on whom robot-assisted radical prostatectomy was carried out and whose urine loss rate we were able to evaluate after catheter removal. Urinary incontinence was evaluated from immediately after removal of the catheter to the date of discharge, and at 1, 3, 6 and 12 months after surgery. Urine loss rate was defined as the urine loss volume divided by the total urine volume. RESULTS: The continence rates of patients with ≤1% urine loss rate on the day of catheter removal were 100% at 6 and 12 months after surgery. A multivariate analysis proved that ≤10% urine loss rate on the day of catheter removal was a significant predictor of continence at 3 months after surgery. Furthermore, the continence rate at 12 months of patients who did not achieve ≤10% urine loss rate on the day of catheter removal was 79.5%. Among them, the continence rate at 12 months of patients who achieved ≥15% urine loss rate improvement from the day of catheter removal to the next day was 95.2%; the factor differed significantly between the continence and incontinence groups at 12 months after surgery. CONCLUSIONS: The urine loss rate on the day of catheter removal is significantly related to the acquisition of urinary continence. Furthermore, our findings suggest that long-term urinary continence can be expected, even in the event of poor urine loss rate on the day of catheter removal, if it improves on the next day.


Assuntos
Laparoscopia , Neoplasias da Próstata , Procedimentos Cirúrgicos Robóticos , Robótica , Catéteres , Humanos , Laparoscopia/efeitos adversos , Masculino , Prostatectomia/efeitos adversos , Neoplasias da Próstata/cirurgia , Recuperação de Função Fisiológica , Procedimentos Cirúrgicos Robóticos/efeitos adversos
9.
Cancer Sci ; 111(1): 15-22, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-31777168

RESUMO

Birt-Hogg-Dubé (BHD) syndrome is associated with the development of hereditary renal cell carcinoma (RCC) and is caused by a germline mutation in the folliculin gene. Most cases of BHD syndrome-associated RCC (BHD-RCC) are less aggressive than sporadic clear cell RCC and multifocal. Therefore, it is critical to distinguish BHD-RCC from its sporadic counterparts to identify and monitor affected families and to preserve renal function for as long as possible. The World Health Organization/International Society of Urological Pathology consensus classification defined distinct entities for certain hereditary RCC; however, BHD-RCC was not included in this classification. Although the clinical features and molecular mechanisms of BHD-RCC have been investigated intensively over the last two decades, pathologists and urologists occasionally face difficulties in the diagnosis of BHD-RCC that require genetic testing. Affected patients usually have miscellaneous benign disorders that often precede renal carcinogenesis. In the present review, we summarize the current understanding of the histopathological features of BHD-RCC based on our epidemiological studies of Japanese families and a literature review. Pathological diagnostic clues and differential diagnosis of BHD-RCC from other hereditary RCC are also briefly discussed.


Assuntos
Síndrome de Birt-Hogg-Dubé/diagnóstico , Síndrome de Birt-Hogg-Dubé/patologia , Carcinoma de Células Renais/diagnóstico , Carcinoma de Células Renais/patologia , Neoplasias Renais/diagnóstico , Neoplasias Renais/patologia , Animais , Diagnóstico Diferencial , Humanos
10.
Hum Mol Genet ; 27(15): 2712-2724, 2018 08 01.
Artigo em Inglês | MEDLINE | ID: mdl-29767721

RESUMO

Birt-Hogg-Dubé (BHD) syndrome is a hereditary kidney cancer syndrome, which predisposes patients to develop kidney cancer, cutaneous fibrofolliculomas and pulmonary cysts. The responsible gene FLCN is a tumor suppressor for kidney cancer, which plays an important role in energy homeostasis through the regulation of mitochondrial oxidative metabolism. However, the process by which FLCN-deficiency leads to renal tumorigenesis is unclear. In order to clarify molecular pathogenesis of BHD-associated kidney cancer, we conducted whole-exome sequencing analysis using next-generation sequencing technology as well as metabolite analysis using liquid chromatography-mass spectrometry and gas chromatography-mass spectrometry. Whole-exome sequencing analysis of BHD-associated kidney cancer revealed that copy number variations of BHD-associated kidney cancer are considerably different from those already reported in sporadic cases. In somatic variant analysis, very few variants were commonly observed in BHD-associated kidney cancer; however, variants in chromatin remodeling genes were frequently observed in BHD-associated kidney cancer (17/29 tumors, 59%). Metabolite analysis of BHD-associated kidney cancer revealed metabolic reprogramming toward upregulated redox regulation which may neutralize reactive oxygen species potentially produced from mitochondria with increased respiratory capacity under FLCN-deficiency. BHD-associated kidney cancer displays unique molecular characteristics that are completely different from sporadic kidney cancer, providing mechanistic insight into tumorigenesis under FLCN-deficiency as well as a foundation for development of novel therapeutics for kidney cancer.


Assuntos
Síndrome de Birt-Hogg-Dubé/patologia , Montagem e Desmontagem da Cromatina/genética , Neoplasias Renais/genética , Neoplasias Renais/metabolismo , Proteínas Proto-Oncogênicas/genética , Proteínas Supressoras de Tumor/genética , Síndrome de Birt-Hogg-Dubé/genética , Variações do Número de Cópias de DNA , Mutação em Linhagem Germinativa , Humanos , Neoplasias Renais/patologia , Proteínas Proto-Oncogênicas/metabolismo , Proteínas Supressoras de Tumor/metabolismo , Sequenciamento do Exoma
11.
Biochem Biophys Res Commun ; 522(4): 931-938, 2020 02 19.
Artigo em Inglês | MEDLINE | ID: mdl-31806376

RESUMO

FLCN is a tumor suppressor gene which controls energy homeostasis through regulation of a variety of metabolic pathways including mitochondrial oxidative metabolism and autophagy. Birt-Hogg-Dubé (BHD) syndrome which is driven by germline alteration of the FLCN gene, predisposes patients to develop kidney cancer, cutaneous fibrofolliculomas, pulmonary cysts and less frequently, salivary gland tumors. Here, we report metabolic roles for FLCN in the salivary gland as well as their clinical relevance. Screening of salivary glands of BHD patients using ultrasonography demonstrated increased cyst formation in the salivary gland. Salivary gland tumors that developed in BHD patients exhibited an upregulated mTOR-S6R pathway as well as increased GPNMB expression, which are characteristics of FLCN-deficient cells. Salivary gland-targeted Flcn knockout mice developed cytoplasmic clear cell formation in ductal cells with increased mitochondrial biogenesis, upregulated mTOR-S6K pathway, upregulated TFE3-GPNMB axis and upregulated lipid metabolism. Proteomic and metabolite analysis using LC/MS and GC/MS revealed that Flcn inactivation in salivary gland triggers metabolic reprogramming towards the pentose phosphate pathway which consequently upregulates nucleotide synthesis and redox regulation, further supporting that Flcn controls metabolic homeostasis in salivary gland. These data uncover important roles for FLCN in salivary gland; metabolic reprogramming under FLCN deficiency might increase nucleotide production which may feed FLCN-deficient salivary gland cells to trigger tumor initiation and progression, providing mechanistic insight into salivary gland tumorigenesis as well as a foundation for development of novel therapeutics for salivary gland tumors.


Assuntos
Cistos/metabolismo , Cistos/patologia , Nucleotídeos/biossíntese , Proteínas Proto-Oncogênicas/metabolismo , Glândulas Salivares/metabolismo , Glândulas Salivares/patologia , Proteínas Supressoras de Tumor/metabolismo , Adulto , Animais , Fatores de Transcrição de Zíper de Leucina e Hélice-Alça-Hélix Básicos/metabolismo , Cistos/diagnóstico por imagem , Feminino , Ontologia Genética , Glicólise , Humanos , Masculino , Camundongos Knockout , Pessoa de Meia-Idade , Biogênese de Organelas , Via de Pentose Fosfato , Proteínas Proto-Oncogênicas/deficiência , Glândulas Salivares/diagnóstico por imagem , Serina-Treonina Quinases TOR/metabolismo , Proteínas Supressoras de Tumor/deficiência , Regulação para Cima
12.
J Urol ; 203(1): 83-91, 2020 01.
Artigo em Inglês | MEDLINE | ID: mdl-31430244

RESUMO

PURPOSE: The PROPHET (Prostate Cancer: Prostate Health Index Trial) is a prospective study to clarify the diagnostic impact of laboratory based and prostate volume adjusted p2PSA ([-2] proenzyme prostate specific antigen) related indexes on prostate cancer and clinically significant prostate cancer with prostate specific antigen less than 10 ng/ml. MATERIALS AND METHODS: Between April 2015 and March 2017, 421 men 50 to 79 years old in the prostate specific antigen range above age specific cutoffs and below 10 ng/ml were registered in the PROPHET. We investigated the diagnostic impacts of various clinical laboratory based free prostate specific antigen related and p2PSA related indexes on any grade and high Gleason grade group prostate cancer. RESULTS: Of the 363 eligible participants 179, 141 and 80 were diagnosed with any grade, and Gleason Grade Group 2-5 and 3-5 prostate cancer, respectively. The AUC-ROCs distinguishing nonprostate cancer vs prostate cancer, nonprostate cancer plus low Gleason Grade Group and low volume vs remaining prostate cancer with a higher Gleason Grade group or a higher volume on the PHI (Prostate Health Index) were significantly superior to the AUC-ROCs of prostate specific antigen and free-to-total prostate specific antigen. At 90% sensitivity in all investigated p2PSA related indexes the false-positive rate was superior to that of prostate specific antigen and free-to-total prostate specific antigen in any group comparison in terms of the Gleason Grade Group and positive biopsy cores. In 35% to 42% of men without prostate cancer and/or those with less aggressive prostate cancer the PHI would avoid unnecessary biopsy. CONCLUSIONS: Laboratory based p2PSA related indexes were significantly superior for detecting clinically significant prostate cancer compared to free-to-total prostate specific antigen. The indexes those would avoid up to 42% of prostate biopsies in men without aggressive cancer while maintaining 90% sensitivity.


Assuntos
Biomarcadores Tumorais/sangue , Antígeno Prostático Específico/sangue , Neoplasias da Próstata/diagnóstico , Idoso , Biópsia , Diagnóstico Diferencial , Humanos , Masculino , Pessoa de Meia-Idade , Gradação de Tumores , Estudos Prospectivos , Neoplasias da Próstata/sangue , Neoplasias da Próstata/patologia , Precursores de Proteínas
13.
World J Urol ; 38(10): 2477-2484, 2020 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-31875247

RESUMO

OBJECTIVES: To compare the outcomes of radical prostatectomy (RP), intensity-modulated radiation therapy (IMRT), and low-dose-rate brachytherapy (BT) using propensity score matching analysis in patients with clinically localized prostate cancer. METHODS: A group of 2273 patients with clinically localized prostate cancer between January 2004 and December 2015 at the Yokohama City University hospital were identified. The records of 1817 of these patients, who were followed up for a minimum of 2 years, were reviewed; 462 were treated with RP, 319 with IMRT, and 1036 with BT. The patients were categorized according to the National Comprehensive Cancer Network risk classification criteria, and biochemical outcomes and overall survival rates were examined. Biochemical failure for RP was defined as prostate-specific antigen (PSA) levels > 0.2 ng/ml, and for IMRT and BT as nadir PSA level + 2 ng/ml. Propensity scores were calculated using multivariable logistic regression based on covariates, including the patient's age, preoperative PSA, Gleason score, number of positive cores, and clinical T stage. RESULTS: Median follow-up was 77 months for the RP, 54 months for IMRT, and 66 months for BT patients. After the propensity scores were adjusted, a total of 372 (186 each) and 598 (299 each) patients were categorized into RP vs IMRT and RP vs BT groups, respectively. Kaplan-Meier analysis did not show any statistically significant differences in terms of overall survival rate between these groups (RP vs IMRT: p = 0.220; RP vs BT: p = 0.429). IMRT was associated with improved biochemical failure-free survival compared to RP in all risk groups (high-risk: p < 0.001; intermediate-risk: p = 0.009; low-risk: p = 0.001), whereas significant differences were observed only in the intermediate-risk group (p = 0.003) within the RP vs BT group. CONCLUSION: The results of our propensity score analysis of mid-term localized prostate cancer treatment outcomes demonstrated no significant differences in the overall survival rate. Despite the difference in biochemical failure definition between surgery and radiotherapeutic approaches, the results of this study demonstrate improved biochemical control favoring IMRT and BT as compared to RP.


Assuntos
Braquiterapia , Pontuação de Propensão , Prostatectomia , Neoplasias da Próstata/radioterapia , Neoplasias da Próstata/cirurgia , Radioterapia de Intensidade Modulada , Idoso , Humanos , Masculino , Pessoa de Meia-Idade , Prostatectomia/métodos , Neoplasias da Próstata/mortalidade , Neoplasias da Próstata/patologia , Estudos Retrospectivos , Taxa de Sobrevida , Resultado do Tratamento
14.
Hum Mol Genet ; 26(2): 354-366, 2017 01 15.
Artigo em Inglês | MEDLINE | ID: mdl-28007907

RESUMO

Germline H255Y and K508R missense mutations in the folliculin (FLCN) gene have been identified in patients with bilateral multifocal (BMF) kidney tumours and clinical manifestations of Birt-Hogg-Dubé (BHD) syndrome, or with BMF kidney tumours as the only manifestation; however, their impact on FLCN function remains to be determined. In order to determine if FLCN H255Y and K508R missense mutations promote aberrant kidney cell proliferation leading to pathogenicity, we generated mouse models expressing these mutants using BAC recombineering technology and investigated their ability to rescue the multi-cystic phenotype of Flcn-deficient mouse kidneys. Flcn H255Y mutant transgene expression in kidney-targeted Flcn knockout mice did not rescue the multi-cystic kidney phenotype. However, expression of the Flcn K508R mutant transgene partially, but not completely, abrogated the phenotype. Notably, expression of the Flcn K508R mutant transgene in heterozygous Flcn knockout mice resulted in development of multi-cystic kidneys and cardiac hypertrophy in some mice. These results demonstrate that both FLCN H255Y and K508R missense mutations promote aberrant kidney cell proliferation, but to different degrees. Based on the phenotypes of our preclinical models, the FLCN H255Y mutant protein has lost it tumour suppressive function leading to the clinical manifestations of BHD, whereas the FLCN K508R mutant protein may have a dominant negative effect on the function of wild-type FLCN in regulating kidney cell proliferation and, therefore, act as an oncoprotein. These findings may provide mechanistic insight into the role of FLCN in regulating kidney cell proliferation and facilitate the development of novel therapeutics for FLCN-deficient kidney cancer.


Assuntos
Síndrome de Birt-Hogg-Dubé/genética , Doenças Renais Císticas/genética , Neoplasias Renais/genética , Proteínas Proto-Oncogênicas/genética , Proteínas Supressoras de Tumor/genética , Animais , Síndrome de Birt-Hogg-Dubé/patologia , Cardiomegalia/genética , Cardiomegalia/patologia , Proliferação de Células/genética , Modelos Animais de Doenças , Regulação Neoplásica da Expressão Gênica , Mutação em Linhagem Germinativa , Humanos , Rim/patologia , Doenças Renais Císticas/patologia , Neoplasias Renais/patologia , Camundongos , Camundongos Knockout , Mutação de Sentido Incorreto
15.
BMC Cancer ; 19(1): 298, 2019 Apr 02.
Artigo em Inglês | MEDLINE | ID: mdl-30940117

RESUMO

BACKGROUND: We reported previously the usefulness of 18F-2-fluoro-2-deoxyglucose positron emission tomography/computed tomography (FDG-PET/CT) to predict prognosis of renal cell carcinoma (RCC) treated with molecular targeted agents. Herein we describe a preliminary research of nine patients who underwent FDG-PET/CT before and after initiation of nivolumab. METHODS: Patients with metastatic RCC who were treated by nivolumab from October 2016 to March 2017 were enrolled in this study. All patients underwent FDG-PET/CT at baseline and 1 month as a first response assessment, and contrast-enhanced or non-contrast-enhanced CT scan at 4 month as a second response assessment. Logistic regression analysis was performed to assess the association of potential predictors, including age, gender, baseline diameter, baseline maximum standardized uptake value (SUVmax), lung or not lung metastasis, elevation of SUVmax at 1st assessment, and decrease in diameter at 1st assessment with the response at 2nd assessment (decrease in the diameter ≥ 30% or not). RESULTS: There were 9 patients and 30 lesions. Mean days of first assessment with FDG-PET/CT and second assessment by CT scan from initiation of treatment were 32.3 ± 6.4, 115.5 ± 14.9, respectively. Lesions whose diameter decreased ≥30% at second assessment were defined as responding, and lesions whose diameter did not decrease ≥30% were defined as non-responding. There were 18 responding lesions, and 12 non-responding lesions. We compared change in diameter and SUVmax at first assessment with FDG-PET/CT, respectively. All lesions with decreased diameter and elevated SUVmax at first assessment with FDG-PET/CT showed responding at second assessment by CT scan, while most lesions with increased diameter and declined SUVmax at first assessment showed non-responding at second assessment. The multivariate logistic regression analyses revealed that only the elevation of SUVmax at 1 month was an independent predictor (P = 0.025, OR: 13.087, 95%CI: 1.373-124.716). CONCLUSION: Our findings suggest that the early assessment using FDG-PET/CT can be effective to predict the response of RCC to nivolumab. However, larger prospective studies are needed to confirm these preliminary results. TRIAL REGISTRATION: Registered in University Hospital Medical Information Network in JAPAN [ UMIN0000008141 ], registration date: 11 Jun 2012.


Assuntos
Antineoplásicos Imunológicos/uso terapêutico , Carcinoma de Células Renais/tratamento farmacológico , Neoplasias Renais/tratamento farmacológico , Nivolumabe/uso terapêutico , Tomografia por Emissão de Pósitrons combinada à Tomografia Computadorizada , Idoso , Carcinoma de Células Renais/diagnóstico por imagem , Carcinoma de Células Renais/imunologia , Feminino , Fluordesoxiglucose F18 , Humanos , Neoplasias Renais/diagnóstico por imagem , Neoplasias Renais/imunologia , Masculino , Pessoa de Meia-Idade , Prognóstico
16.
Int J Mol Sci ; 20(15)2019 Jul 28.
Artigo em Inglês | MEDLINE | ID: mdl-31357730

RESUMO

Photodynamic diagnosis (PDD) can improve diagnostic accuracy by using PDD agents such as 5-aminolevulinic acid (ALA). However, the weakness and photobleaching of fluorescence of PDD agents may lead to insufficient fluorescence visibility for the detection of cancer during resection operations. We focused on the "fluorescence enhancement effect" resulting from the addition of polyethylene glycol-modified titanium dioxide nanoparticles (TiO2-PEG NPs) to address these problems. The results showed that the combined administration of TiO2-PEG NPs and ALA could enhance and prolong fluorescence in bladder cancer cells, similar to in the mixture alone. It was suggested that the fluorescence enhancement was related to the accumulation of TiO2-PEG NPs in cells via endocytosis, causing the light scattering and enhancement of fluorescence. This fluorescence enhancement effect could be applicable for PDD.


Assuntos
Ácido Aminolevulínico/farmacologia , Neoplasias/diagnóstico , Titânio/farmacologia , Neoplasias da Bexiga Urinária/diagnóstico , Ácido Aminolevulínico/química , Linhagem Celular Tumoral , Fluorescência , Humanos , Nanopartículas/química , Neoplasias/patologia , Polietilenoglicóis/química , Titânio/química , Neoplasias da Bexiga Urinária/metabolismo , Neoplasias da Bexiga Urinária/patologia
17.
Cancer Sci ; 109(3): 581-586, 2018 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-29325224

RESUMO

Although hereditary kidney cancer syndrome accounts for approximately five percent of all kidney cancers, the mechanistic insight into tumor development in these rare conditions has provided the foundation for the development of molecular targeting agents currently used for sporadic kidney cancer. In the late 1980s, the comprehensive study for hereditary kidney cancer syndrome was launched in the National Cancer Institute, USA and the first kidney cancer-associated gene, VHL, was identified through kindred analysis of von Hippel-Lindau (VHL) syndrome in 1993. Subsequent molecular studies on VHL function have elucidated that the VHL protein is a component of E3 ubiquitin ligase complex for hypoxia-inducible factor (HIF), which provided the basis for the development of tyrosine kinase inhibitors targeting the HIF-VEGF/PDGF pathway. Recent whole-exome sequencing analysis of sporadic kidney cancer exhibited the recurrent mutations in chromatin remodeling genes and the later study has revealed that several chromatin remodeling genes are altered in kidney cancer kindred at the germline level. To date, more than 10 hereditary kidney cancer syndromes together with each responsible gene have been characterized and most of the causative genes for these genetic disorders are associated with either metabolism or epigenome regulation. In this review article, we describe the molecular mechanisms of how an alteration of each kidney cancer-associated gene leads to renal tumorigenesis as well as denote therapeutic targets elicited by studies on hereditary kidney cancer.


Assuntos
Epigênese Genética , Predisposição Genética para Doença , Neoplasias Renais/genética , Síndromes Neoplásicas Hereditárias/genética , Redes Reguladoras de Genes , Humanos , Sequenciamento do Exoma
18.
Pathol Int ; 2018 May 24.
Artigo em Inglês | MEDLINE | ID: mdl-29797630

RESUMO

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

19.
BMC Urol ; 18(1): 97, 2018 Nov 06.
Artigo em Inglês | MEDLINE | ID: mdl-30400941

RESUMO

BACKGROUND: Bladder cancers have been characterized as a tumor group in which the immunological response is relatively well preserved. Programmed death ligand 1 (PD-L1, B7-H1, CD274) has been shown to be expressed in several malignancies, including bladder cancer. However, the clinicopathological impact of this biomarker has not yet been established. In the present study, a quantitative real-time polymerase chain reaction (qPCR) was performed using paired normal and cancerous bladder cancer tissue to investigate PD-1/PD-L1 gene expression. METHODS: We examined the mRNA expression of PD-1/PD-L1 by a qPCR using 58 pairs of normal and cancerous human bladder tissue specimens. We also examined the correlation with the expressions of the STAT1 and NFAT genes, which are thought to be upstream and downstream of the PD-L1 pathway, respectively. RESULTS: There were no significant differences between normal and cancerous tissue in the expression of the PD-1 and PD-L1 genes (p = 0.724 and p = 0.102, respectively). However, PD-1 and PD-L1 were both more highly expressed in high-grade bladder cancer than in low-grade bladder cancer (p < 0.050 and p < 0.010). PD-L1 was positively correlated with the expressions of both the STAT1 (r = 0.681, p < 0.001) and the NFATc1 genes (r = 0.444. p < 0.001). CONCLUSIONS: PD-1 and PD-L1 might be a new biomarker that correlates with the pathological grade of bladder cancer. PD-L1 might function as a mediator of stage progression in bladder cancer and STAT1-NFAT pathway might associate this function.


Assuntos
Antígeno B7-H1/biossíntese , Biomarcadores Tumorais/biossíntese , Progressão da Doença , Regulação Neoplásica da Expressão Gênica , Receptor de Morte Celular Programada 1/biossíntese , Neoplasias da Bexiga Urinária/metabolismo , Idoso , Idoso de 80 Anos ou mais , Antígeno B7-H1/genética , Biomarcadores Tumorais/genética , Linhagem Celular Tumoral , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Gradação de Tumores/tendências , Receptor de Morte Celular Programada 1/genética , Estudos Retrospectivos , Neoplasias da Bexiga Urinária/genética
20.
Proc Natl Acad Sci U S A ; 112(13): E1624-31, 2015 Mar 31.
Artigo em Inglês | MEDLINE | ID: mdl-25775561

RESUMO

Folliculin (FLCN)-interacting proteins 1 and 2 (FNIP1, FNIP2) are homologous binding partners of FLCN, a tumor suppressor for kidney cancer. Recent studies have revealed potential functions for Flcn in kidney; however, kidney-specific functions for Fnip1 and Fnip2 are unknown. Here we demonstrate that Fnip1 and Fnip2 play critical roles in kidney tumor suppression in cooperation with Flcn. We observed no detectable phenotype in Fnip2 knockout mice, whereas Fnip1 deficiency produced phenotypes similar to those seen in Flcn-deficient mice in multiple organs, but not in kidneys. We found that absolute Fnip2 mRNA copy number was low relative to Fnip1 in organs that showed phenotypes under Fnip1 deficiency but was comparable to Fnip1 mRNA copy number in mouse kidney. Strikingly, kidney-targeted Fnip1/Fnip2 double inactivation produced enlarged polycystic kidneys, as was previously reported in Flcn-deficient kidneys. Kidney-specific Flcn inactivation did not further augment kidney size or cystic histology of Fnip1/Fnip2 double-deficient kidneys, suggesting pathways dysregulated in Flcn-deficient kidneys and Fnip1/Fnip2 double-deficient kidneys are convergent. Heterozygous Fnip1/homozygous Fnip2 double-knockout mice developed kidney cancer at 24 mo of age, analogous to the heterozygous Flcn knockout mouse model, further supporting the concept that Fnip1 and Fnip2 are essential for the tumor-suppressive function of Flcn and that kidney tumorigenesis in human Birt-Hogg-Dubé syndrome may be triggered by loss of interactions among Flcn, Fnip1, and Fnip2. Our findings uncover important roles for Fnip1 and Fnip2 in kidney tumor suppression and may provide molecular targets for the development of novel therapeutics for kidney cancer.


Assuntos
Proteínas Reguladoras de Apoptose/metabolismo , Proteínas de Transporte/metabolismo , Regulação Neoplásica da Expressão Gênica , Neoplasias Renais/metabolismo , Proteínas Proto-Oncogênicas/metabolismo , Proteínas Supressoras de Tumor/metabolismo , Alelos , Animais , Proteínas Reguladoras de Apoptose/genética , Síndrome de Birt-Hogg-Dubé/genética , Proteínas de Transporte/genética , Modelos Animais de Doenças , Feminino , Rim/patologia , Neoplasias Renais/genética , Neoplasias Renais/patologia , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Fenótipo , Doenças Renais Policísticas/metabolismo , Proteínas Proto-Oncogênicas/genética , Proteínas Supressoras de Tumor/genética
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA