N6-Methyladenosine (m6A) Sequencing Reveals Heterodera glycines-Induced Dynamic Methylation Promoting Soybean Defense.

Unraveling the intricacies of soybean cyst nematode (Heterodera glycines) race 4 resistance and susceptibility in soybean breeding lines-11-452 (highly resistant) and Dongsheng1 (DS1, highly susceptible)-was the focal point of this study. Employing cutting-edge N6-methyladenosine (m6A) and RNA sequencing techniques, we delved into the impact of m6A modification on gene expression and plant defense responses. Through the evaluation of nematode development in both resistant and susceptible roots, a pivotal time point (3 days postinoculation) for m6A methylation sequencing was identified. Our sequencing data exhibited robust statistics, successful soybean genome mapping, and prevalent m6A peak distributions, primarily in the 3' untranslated region and stop codon regions. Analysis of differential methylation peaks and differentially expressed genes revealed distinctive patterns between resistant and susceptible genotypes. In the highly resistant line (11-452), key resistance and defense-associated genes displayed increased expression coupled with inhibited methylation, encompassing crucial players such as R genes, receptor kinases, and transcription factors. Conversely, the highly susceptible DS1 line exhibited heightened expression correlated with decreased methylation in genes linked to susceptibility pathways, including Mildew Locus O-like proteins and regulatory elements affecting defense mechanisms. Genome-wide assessments, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses, and differential methylation peak/differentially expressed gene overlap emphasized the intricate interplay of m6A modifications, alternative splicing, microRNA, and gene regulation in plant defense. Protein-protein interaction networks illuminated defense-pivotal genes, delineating divergent mechanisms in resistant and susceptible responses. This study sheds light on the dynamic correlation between methylation, splicing, and gene expression, providing profound insights into plant responses to nematode infection.

Microbial Contributions to Iodide Enrichment in Deep Groundwater in the North China Plain.

Microorganisms play crucial roles in the global iodine cycling through iodine oxidation, reduction, volatilization, and deiodination. In contrast to iodate formation in radionuclide-contaminated groundwater by the iodine-oxidizing bacteria, microbial contribution to the formation of high level of iodide in geogenic high iodine groundwater is poorly understood. In this study, our results of comparative metagenomic analyses of deep groundwater with typical high iodide concentrations in the North China Plain revealed the existence of putative dissimilatory iodate-reducing idrABP1P2 gene clusters in groundwater. Heterologous expression and characterization of an identified idrABP1P2 gene cluster confirmed its functional role in iodate reduction. Thus, microbial dissimilatory iodate reduction could contribute to iodide formation in geogenic high iodine groundwater. In addition, the identified iron-reducing, sulfur-reducing, sulfur-oxidizing, and dehalogenating bacteria in the groundwater could contribute to the release and production of iodide through the reductive dissolution of iron minerals, abiotic iodate reduction of derived ferrous iron and sulfide, and dehalogenation of organic iodine, respectively. These microbially mediated iodate reduction and organic iodine dehalogenation processes may also result in the transformation among iodine species and iodide enrichment in other geogenic iodine-rich groundwater systems worldwide.

Experimental and DFT study of Cu(II) removed by Na-montmorillonite.

The experimental and theoretical studies on the adsorption of Cu(II) on the surface of Na-montmorillonite (Na-Mt) were reported. Effects of batch adsorption experimental parameters were studied. Density functional theory and molecular dynamics simulations were used to study the adsorption of Cu(II) on montmorillonite (001) surface. The adsorption reached equilibrium within 80 min and the adsorption capacity was 35.23 mg·g-1 at 25 °C. The adsorption data of Cu(II) were consistent with pseudo-second-order kinetics and Langmuir isotherm models. The adsorption process was dominated by physical adsorption (Ea was 37.08 kJ·mol-1) with spontaneous endothermic behavior. The influence of coexisting cations on the adsorption capacity of Cu(II) was Mg(II) > Co(II) > Ca(II) > Na(I). The simulation results demonstrated that there were no significant differences in the adsorption energy of Cu(II) at the four adsorption sites on the montmorillonite (001) surface. Cu(II) had more electron transfer than Na(I). The diffusion coefficient of Cu(II) in the aqueous solution system containing montmorillonite was 0.85×10-10 m2·s-1. Considerable amounts of Cu(II) ions were adsorbed at a distance of 0.26 and 2.25 Å from the montmorillonite (001) surface. The simulation results provided strong supporting evidence for experimental conclusions.

Sex differences exist in adult heart group 2 innate lymphoid cells.

BACKGROUND: Group 2 innate lymphoid cells (ILC2s) are the most dominant ILCs in heart tissue, and sex-related differences exist in mouse lung ILC2 phenotypes and functions; however, it is still unclear whether there are sex differences in heart ILC2s. RESULTS: Compared with age-matched wild-type (WT) male mice, 8-week-old but not 3-week-old WT female mice harbored an obviously greater percentage and number of heart ILC2s in homeostasis. However, the percentage of killer-cell lectin-like receptor G1 (Klrg1)- ILC2s was higher, but the Klrg1+ ILC2s were lower in female mice than in male mice in both heart tissues of 3- and 8-week-old mice. Eight-week-old Rag2-/- mice also showed sex differences similar to those of age-matched WT mice. Regarding surface marker expression, compared to age-matched male mice, WT female mice showed higher expression of CD90.2 and Ki67 and lower expression of Klrg1 and Sca-1 in heart total ILC2s. There was no sex difference in IL-4 and IL-5 secretion by male and female mouse heart ILC2s. Increased IL-33 mRNA levels within the heart tissues were also found in female mice compared with male mice. By reanalyzing published single-cell RNA sequencing data, we found 2 differentially expressed genes between female and male mouse heart ILC2s. Gene set variation analysis revealed that the glycine, serine and threonine metabolism pathway was upregulated in female heart ILC2s. Subcluster analysis revealed that one cluster of heart ILC2s with relatively lower expression of Semaphorin 4a and thioredoxin interacting protein but higher expression of hypoxia-inducible lipid droplet-associated. CONCLUSIONS: These results revealed greater numbers of ILC2s, higher expression of CD90.2, reduced Klrg1 and Sca-1 expression in the hearts of female mice than in male mice and no sex difference in IL-4 and IL-5 production in male and female mouse heart ILC2s. These sex differences in heart ILC2s might be due to the heterogeneity of IL-33 within the heart tissue.

Docosahexaenoic acid supplementation represses the early immune response against murine cytomegalovirus but enhances NK cell effector function.

BACKGROUND: Docosahexaenoic acid (DHA) supplementation is beneficial for several chronic diseases; however, its effect on immune regulation is still debated. Given the prevalence of cytomegalovirus (CMV) infection and because natural killer (NK) cells are a component of innate immunity critical for controlling CMV infection, the current study explored the effect of a DHA-enriched diet on susceptibility to murine (M) CMV infection and the NK cell effector response to MCMV infection. RESULTS: Male C57BL/6 mice fed a control or DHA-enriched diet for 3 weeks were infected with MCMV and sacrificed at the indicated time points postinfection. Compared with control mice, DHA-fed mice had higher liver and spleen viral loads at day 7 postinfection, but final MCMV clearance was not affected. The total numbers of NK cells and their terminal mature cell subset (KLRG1+ and Ly49H+ NK cells) were reduced compared with those in control mice at day 7 postinfection but not day 21. DHA feeding resulted in higher IFN-γ and granzyme B expression in splenic NK cells at day 7 postinfection. A mechanistic analysis showed that the splenic NK cells of DHA-fed mice had enhanced glucose uptake, increased CD71 and CD98 expression, and higher mitochondrial mass than control mice. In addition, DHA-fed mice showed reductions in the total numbers and activation levels of CD4+ and CD8+ T cells. CONCLUSIONS: These results suggest that DHA supplementation represses the early response to CMV infection but preserves NK cell effector functions by improving mitochondrial activity, which may play critical roles in subsequent MCMV clearance.

One-Pot Synthesis of Benzoazole-Substituted Thioenamines via a Cross Dehydrogenation Coupling (CDC) Reaction.

An iodine-catalyzed synthesis of benzoazole-substituted thioenamines in a one-pot manner was reported. Using 2-aminothiophenols (or 2-aminophenols or 1,2-phenylenediamines), tetramethylthiuram disulfide (TMTD), and enamines (mainly indoles) as starting materials, the target C(sp2)-S formation products (benzoazole-substituted thioenamines) could be furnished smoothly in good yields. The reaction might proceed through an electrophilic substitution pathway in a cross dehydrogenation coupling (CDC) manner. The protocol is metal-free and features easy performance, a one-pot manner, a good functional group tolerance, and good yields.

Ultrasensitive catechin electrochemical sensor based on uniform ordered mesoporous carbon hollow spheres (MCHSs) advanced carbon-based conductive materials.

Catechin is one of the flavonoids with antioxidant activity and has attracted great interest. A rapid and accurate detection of catechin is of great significance. Herein, an ultrasensitive catechin electrochemical sensor based on uniform ordered mesoporous carbon hollow spheres (MCHSs) advanced carbon-based conductive material modified glass carbon electrode was constructed. The MCHSs were synthesized by pyrolysis using nitrogen protection and template removal methods, and they exhibited excellent electrochemical detection for catechin owing to their high conductivity and uniform and small spheres with a large specific surface area and hollow structure. Under optimal conditions for the detection of catechin, the MCHSs/GCE showed a wider linear range (10 -1400 nM) and lower detection limit (LOD, 2.82 nM, (S/N = 3)). Furthermore, the electrochemical reaction sites and redox mechanisms of catechin were revealed by electrochemical behavior and density flooding theory. Moreover, the sensor we constructed exhibited good accuracy and stability for the detection of catechin in actual sample detections.

First Report of Meloidogyne arenaria on Cynanchum versicolor Bunge in China.

'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.

Strong photoperiod sensitivity is controlled by cooperation and competition among Hd1, Ghd7 and DTH8 in rice heading.

Rice (Oryza sativa) is a short-day (SD) plant originally having strong photoperiod sensitivity (PS), with SDs promoting and long days (LDs) suppressing flowering. Although the evolution of PS in rice has been extensively studied, there are few studies that combine the genetic effects and underlying mechanism of different PS gene combinations with variations in PS. We created a set of isogenic lines among the core PS-flowering genes Hd1, Ghd7 and DTH8 using CRISPR mutagenesis, to systematically dissect their genetic relationships under different day-lengths. We investigated their monogenic, digenic, and trigenic effects on target gene regulation and PS variation. We found that Hd1 and Ghd7 have the primary functions for promoting and repressing flowering, respectively, regardless of day-length. However, under LD conditions, Hd1 promotes Ghd7 expression and is recruited by Ghd7 and/or DTH8 to form repressive complexes that collaboratively suppress the Ehd1-Hd3a/RFT1 pathway to block heading, but under SD conditions Hd1 competes with the complexes to promote Hd3a/RFT1 expression, playing a tradeoff relationship with PS flowering. Natural allelic variations of Hd1, Ghd7 and DTH8 in rice populations have resulted in various PS performances. Our findings reveal that rice PS flowering is controlled by crosstalk of two modules - Hd1-Hd3a/RFT1 in SD conditions and (Hd1/Ghd7/DTH8)-Ehd1-Hd3a/RFT1 in LD conditions - and the divergences of these genes provide the basis for rice adaptation to broad regions.

Value of the diving method for capsule endoscopy in the examination of small-intestinal disease: a prospective randomized controlled trial.

BACKGROUND AND AIMS: Video capsule endoscopy (VCE) is limited by poor image quality and incomplete small-bowel transit. This study was designed to evaluate the diving method for VCE in the examination of small-intestinal disease. METHODS: From July 2017 to September 2017, eligible patients were randomly assigned to 2 groups, the diving group and the control group. For the diving group, 500 mL of water was administered every hour when the capsule reached the small bowel. The primary outcomes were image quality and positive findings. Secondary outcomes were the completion rate of examination, gastric transit time (GTT), small-bowel transit time (SBTT), lesion detection rate, adverse events, and patient satisfaction. RESULTS: One hundred forty patients were included. The scores of endoscopic images in the proximal third and middle third of the small bowel in the diving group were significantly higher than that in the control group (3.47 ± .60 vs 3.11 ± .63 [P = .007] and 3.24 ± .59 vs 2.78 ± .74 [P = .002], respectively). The positive findings in the distal third of the small bowel were significantly different between the 2 groups (P = .005). The completion rate in the diving group was significantly higher (92.19% vs 76.32%, respectively; P = .012). The GTT, SBTT, and lesion detection rate were similar in 2 groups (P = .282, .067, and .577, respectively). No discomfort or adverse events were reported except for a few cases of frequent urination. CONCLUSIONS: The diving method for VCE examination effectively improves the endoscopic view in the proximal and middle thirds of the small bowel and the positive findings in the distal small intestine and increases the completion rate. (Clinical trial registration number: ChiCTR-RDR-17011823.).

General Layer-by-Layer Assembly of Multilayered Photoanodes: Triggering Tandem Charge Transport toward Photoelectrochemical Water Oxidation.

Modulation of photoinduced charge separation/migration and construction of controllable charge transfer pathway over photoelectrodes have been attracting enduring interest in semiconductor-based photoelectrochemical (PEC) cells but suffer from sluggish charge transport kinetics. Here, we report a general approach to fabricate NP-TNTAs/(TMCs QDs/PSS)n (X = Te, Se, S) photoanodes via a facile and green electrostatic layer-by-layer (LbL) self-assembly strategy, for which transition-metal chalcogenides quantum dots (TMCs QDs) [CdX (X = Se, Te, S)] and poly(sodium 4-styrenesulfonate) (PSS) were periodically deposited on the nanoporous TiO2 nanotube arrays (NP-TNTAs) via substantial electrostatic force, resulting in the continuous charge transfer pathway. NP-TNTAs/(TMCs QDs/PSS)n photoanodes demonstrate significantly enhanced solar-driven photoelectrochemical (PEC) water oxidation activities, relative to NP-TNTAs and TMCs QDs under visible and simulated sunlight irradiation, predominantly because of the suitable energy level configuration between NP-TNTAs and TMCs QDs, unique integration mode, and high-speed interfacial charge separation rate endowed by LbL assembly. The ultrathin PSS intermediate layer functions as "molecule glue" for pinpoint and uniform self-assembly of TMCs QDs on the framework of NP-TNTAs and photosensitization effect of TMCs QDs triggers the unidirectional charge transfer cascade, synergistically boosting the charge separation/transfer efficiency. Our work offers an efficacious approach to craft multilayered photoelectrodes and spur further interest in finely tuning the spatial charge flow in PEC cell for solar-to-hydrogen conversion.

Confinement of Quantum Dots in between Monolayered Graphene Nanosheets for Arousing Boosted Multifarious Photoredox Selective Organic Transformation.

Transition metal chalcogenide quantum dots (TMC QDs) represent promising light-harvesting antennas because of their fascinating physicochemical properties including quantum confinement effect and suitable energy band structures. However, TMC QDs generally suffer from poor photoactivities and photostability due to deficiency of active sites and ultrafast recombination rate of photoinduced charge carriers. Here, we demonstrate how to rationally arouse the charge transfer kinetic of TMC QDs by close monolayered graphene (GR) encapsulation via a ligand-dominated layer-by-layer (LbL) assembly utilizing oppositely charged TMC QDs and GR nanosheets as the building blocks. The assembly units were spontaneously and intimately integrated in an alternate integration mode, thereby resulting in the multilayered three-dimensional (3D) TMC QDs/GR ensembles. It was unveiled that multifarious photoactivities of TMC QDs/GR nanocomposites toward versatile photoredox organic catalysis including photocatalytic aromatic alcohols oxidation to aldehydes and nitroaromatics reduction to amino derivatives under visible light irradiation are conspicuously boosted because of spatially multilayered monolayered GR encapsulation which are superior to those of TMC QDs counterparts. The substantially enhanced photoactivities of TMC QDs/GR nanocomposites arise from reasons including improved light absorption and enhanced charge separation efficacy because of GR encapsulation together with unique stacking mode between TMC QDs and GR endowed by LbL assembly. Our work would provide a promising and efficacious route to smartly accelerate the charge transfer kinetic of TMC QDs for solar energy conversion.

Charge Transport Surmounting Hierarchical Ligand Confinement toward Multifarious Photoredox Catalysis.

Metal nanoparticles (NPs) have been deemed an imperative sector of nanomaterial for triggering the Schottky-junction-driven electron flow in photoredox catalysis, but they suffer from sluggish charge-transfer kinetics, rendering efficient charge flow difficult. Here, we report the construction of unidirectional charge-transfer channel in a metal/semiconductor heterostructure via a ligand-triggered self-assembly method, by which hierarchically branched ligands (DMAP)-capped Pd NPs were controllably attached on the WO3 nanorods (NRs) scaffold, resulting in the well-defined Pd@DMAP/WO3 NRs heterostructures. The pinpointed deposition of Pd@DMAP on the WO3 NRs endows the Pd@DMAP/WO3 NRs heterostructure with conspicuously improved photoactivities for organic pollutant mineralization, as well as the capacities for photocatalytic selective oxidation of aromatic alcohols to aldehydes and photoreduction of chromium ions under the irradiation of simulated sunlight and visible light, far surpassing the applicability of blank WO3 NRs. This is due to the imperative contribution of Pd@DMAP as efficient electron reservoir in accelerating the unidirectional flow of electrons from Pd@DMAP to WO3 NRs, overcoming the confinement of spatially hierarchically branched ligand and interface configuration. Moreover, interfacial charge transport efficiency is finely tuned by the interface configuration engineering. The active species in the multifarious photoreactions were unveiled, and a linker-triggered photoredox catalysis mechanism was put forward. It is hoped that our current work would afford new strategies for strategically constructing metal/semiconductor heterostructures for versatile photocatalytic applications.

Layer-by-Layer Self-Assembly of Metal/Metal Oxide Superstructures: Self-Etching Enables Boosted Photoredox Catalysis.

The capability of noble metal nanoparticles (NPs) as efficient charge transfer mediators to stimulate Schottky-junction-triggered charge flow in multifarious photocatalysis has garnered enormous attention in the past decade. Nevertheless, fine-tuning and controllable fabrication of a directional charge transport channel in metal/semiconductor heterostructures via suitable interface engineering is poorly investigated. Here, we report the progressive fabrication of a tailor-made directional charge transfer channel in Pt nanoparticles (NPs)-inlaid WO3 (Pt-WO3) nanocomposites via an efficient electrostatic layer-by-layer (LbL) self-assembly integrated with a thermal reduction treatment, by which oppositely charged metal precursor ions and polyelectrolyte building blocks were intimately and alternately assembled on the WO3 nanorods (NRs) by substantial electrostatic interaction. LbL self-assembly buildup and in situ self-etching-induced structural variation of WO3 NRs to a microsized superstructure occur simultaneously. We found that such exquisitely crafted Pt-WO3 nanocomposites exhibit conspicuously enhanced and versatile photoactivities for nonselective mineralizing of organic dye pollution and reduction of heavy metal ions at ambient conditions under both visible and simulated sunlight irradiation, demonstrating a synergistic effect. This is attributed to the imperative contribution of Pt NPs as electron traps to accelerate the directional high-efficiency electron transport from WO3 to Pt NPs, surpassing the confinement of electron transfer kinetics of WO3 owing to low conduction level. More intriguingly, photoredox catalysis can also be triggered simultaneously in the same reaction system. The primary in situ produced active species in the photocatalytic reactions were specifically analyzed, and underlying photocatalytic mechanisms were determined. Our work would provide a universal synthesis strategy for constructing various metal-decorated semiconductor nanocomposites for widespread photocatalytic utilizations.

Partially Self-Transformed Transition-Metal Chalcogenide Interim Layer: Motivating Charge Transport Cascade for Solar Hydrogen Evolution.

Directional and high-efficiency charge transport to the target active sites of photocatalyst is central to boost the solar energy conversion but is retarded by the sluggish charge transfer kinetics and deficiency of active sites. Here, we report the elaborate design of cascade unidirectional charge transfer channel over spatially multilayered CdS@CdTe@MoS2 dual core-shell ternary heterostructures by partial transformation of CdS to CdTe interim layer followed by seamless encapsulation with an ultrathin MoS2 layer. The suitable energy-level alignment and unique coaxial multilayered assembly mode among the building blocks accelerate the interfacial charge separation and transport, endowing the CdS@CdTe@MoS2 heterostructures with conspicuously enhanced visible-light-driven photocatalytic hydrogen generation performances along with good photostability. The integrated roles of ultrathin CdTe intermediate layer in passivating the defect sites of CdS NWs framework, mediating the unidirectional charge transfer cascade and prolonging the charge lifetime, were ascertained. Besides, the crucial role of the outermost MoS2 layer as the metal-free cocatalyst in enriching the surface active sites for hydrogen evolution was also determined. Our work would provide new alternatives for finely tuning the charge flow toward promising solar-to-hydrogen conversion efficiency.

Short communication: Study on the formation of 2-methylimidazole and 4-methylimidazole in the Maillard reaction.

2-Methylimidazole (2-MI) and 4-methylimidazole (4-MI) can be formed via the Maillard reaction during dairy thermal treatment. In this study, different reactions between α-dicarbonyl compounds (methylglyoxal, glyoxal) and aldehydes (formaldehyde, acetaldehyde) in the presence of ammonium sulfate were performed to investigate the formation of 2-MI and 4-MI. Two formation pathways of 2-MI and 4-MI were proposed. One pathway is that α-dicarbonyl compound reacts with equivalent ammonia to form an intermediate, while aldehyde reacts with equivalent ammonia to form another intermediate, then the 2 intermediates react together to generate 2-MI or 4-MI. Alternatively, α-dicarbonyl compound can react with double ammonia to form an intermediate, and subsequently reacts with aldehyde to form 2-MI or 4-MI. Additionally, possible mechanisms were also proposed to explain the phenomenon that the 2-MI content was much lower than 4-MI in Maillard reaction.

Genetic association of gut microbiota with osteoarthritis: a multivariable Mendelian randomization study considering medication use.

Background. The interplay among human gut microbiota (GM) composition, osteoarthritis (OA) and OA-related medication use has been extensively discussed. However, to date, there has been no exploration of the genetic correlation among these three factors.Hypothesis/Gap. The potential causal link between GM and OA), and whether medications influence this relationship, remains unclear.Methods. We utilized bidirectional Mendelian randomization (MR) to explore the genetic associations between GM and OA. We leveraged genome-wide association study (GWAS) summary statistics from the MiBioGen and GO consortia, which provided data on GM taxa and OA cases, respectively. We identified outlier single-nucleotide polymorphisms using radial-MR and assessed causal associations using inverse variance weighting (IVW), weighted median and MR-Egger methods. Robust outcomes, consistent across these methods, were reported. We addressed potential biases through tests for horizontal pleiotropy and heterogeneity, supplemented by the Mendelian randomization pleiotropy residual sum and outlier method. Multivariable MR techniques were applied to adjust for OA medication use using UK Biobank data.Results. IVW estimates revealed a significant increase in hip OA risk for Gordonibacter and Eubacterium (brachy group) [odds ratio (OR): 1.09, 95% confidence interval (CI): 1.04-1.15, P=7.82E-04; OR: 1.09, 95% CI: 1.03-1.16, P=4.67E-03, respectively]. Conversely, Senegalimassilia, Slackia and Streptococcus exhibited protective effects (OR: 0.88, P=2.14E-02; OR: 0.88, P=3.33E-02; 0.91, P=4.29E-02). Sutterella increased the risk of knee OA (OR=1.15, 95% CI: 1.07-1.25, P=4.06E-04), while Haemophilus decreased it (OR=0.94, 95% CI: 0.88-1.00, P=4.26E-02). No significant heterogeneity or horizontal pleiotropy was observed in the results. Even after accounting for the potential confounding effect of medication, the results remained consistent. No reverse causation was detected.Conclusions. Our MR study reveals gut microbiome links to OA risk. Associations hold after adjusting for medication, indicating a potential causal connection between GM and OA.

In-situ synthesized MgIn2S4/CdWO4 type-II heterojunction as a light-driven photoelectrochemical sensor for ultrasensitive detection of catechol in environmental water samples.

As an essential chemical intermediate, catechol (CC) residues may have adverse effects on human health. Herein, an effective and facile photoelectrochemical sensor platform based on MgIn2S4/CdWO4 composite is constructed for monitoring CC. MgIn2S4 increases light absorption range and activity, while CdWO4 enhances photoelectronic stability, and the type-II heterojunction formed can significantly enhance photocurrent response. Due to the autoxidation process, CC is converted into oligomeric products, which increase the spatial site resistance and attenuate the overall photocurrent response. It is worth noting that the cauliflower-like structure of MgIn2S4 can provide a large specific surface area, and the presence of Mg2+ promotes autoxidation, thus providing a suitable condition for detecting CC. Under optimal conditions, the MgIn2S4/CdWO4/GCE photoelectrochemical sensor has a prominent linear relationship in the range of CC concentration from 2 nM to 7 µM, with a limit of detection of 0.27 nM. With satisfactory selectivity, excellent stability, and remarkable reproducibility, this sensor provides a crucial reference value for effectively and rapidly detecting pollutants in environmental water samples.