Experimental Limits on Solar Reflected Dark Matter with a New Approach on Accelerated-Dark-Matter-Electron Analysis in Semiconductors.

Recently a dark matter-electron (DM-electron) paradigm has drawn much attention. Models beyond the standard halo model describing DM accelerated by high energy celestial bodies are under intense examination as well. In this Letter, a velocity components analysis (VCA) method dedicated to swift analysis of accelerated DM-electron interactions via semiconductor detectors is proposed and the first HPGe detector-based accelerated DM-electron analysis is realized. Utilizing the method, the first germanium based constraint on sub-GeV solar reflected DM-electron interaction is presented with the 205.4 kg·day dataset from the CDEX-10 experiment. In the heavy mediator scenario, our result excels in the mass range of 5-15 keV/c^{2}, achieving a 3 orders of magnitude improvement comparing with previous semiconductor experiments. In the light mediator scenario, the strongest laboratory constraint for DM lighter than 0.1 MeV/c^{2} is presented. The result proves the feasibility and demonstrates the vast potential of the VCA technique in future accelerated DM-electron analyses with semiconductor detectors.

Constraints on Sub-GeV Dark Matter-Electron Scattering from the CDEX-10 Experiment.

We present improved germanium-based constraints on sub-GeV dark matter via dark matter-electron (χ-e) scattering using the 205.4 kg·day dataset from the CDEX-10 experiment. Using a novel calculation technique, we attain predicted χ-e scattering spectra observable in high-purity germanium detectors. In the heavy mediator scenario, our results achieve 3 orders of magnitude of improvement for m_{χ} larger than 80 MeV/c^{2} compared to previous germanium-based χ-e results. We also present the most stringent χ-e cross-section limit to date among experiments using solid-state detectors for m_{χ} larger than 90 MeV/c^{2} with heavy mediators and m_{χ} larger than 100 MeV/c^{2} with electric dipole coupling. The result proves the feasibility and demonstrates the vast potential of a new χ-e detection method with high-purity germanium detectors in ultralow radioactive background.

Exotic Dark Matter Search with the CDEX-10 Experiment at China's Jinping Underground Laboratory.

A search for exotic dark matter (DM) in the sub-GeV mass range has been conducted using 205 kg day data taken from a p-type point contact germanium detector of the CDEX-10 experiment at China's Jinping underground laboratory. New low-mass dark matter searching channels, neutral current fermionic DM absorption (χ+A→ν+A) and DM-nucleus 3→2 scattering (χ+χ+A→ϕ+A), have been analyzed with an energy threshold of 160 eVee. No significant signal was found; thus new limits on the DM-nucleon interaction cross section are set for both models at the sub-GeV DM mass region. A cross section limit for the fermionic DM absorption is set to be 2.5×10^{-46} cm^{2} (90% C.L.) at DM mass of 10 MeV/c^{2}. For the DM-nucleus 3→2 scattering scenario, limits are extended to DM mass of 5 and 14 MeV/c^{2} for the massless dark photon and bound DM final state, respectively.

Dispersion-managed technique in temporal-frequency measurement for MoTe2-based ultrafast laser.

Ultrafast phenomena exist widely in modern scientific research. The time scale of ultrafast phenomena is mostly in the order of picosecond, femtosecond, or even attosecond. Nowadays, it is still a major challenge to study these nonrepetitive transient processes. Here, a temporal-frequency measurement based on a dispersion-managed technique has been proposed for an MoTe2-based ultrafast laser. The temporal-frequency measurement comprises a laser diode, an optical switch, a section of tunable dispersion compensation fiber, and a three-port beam splitter. Resolution of the proposed measurement can be tuned in a wide range; further, the upper and lower resolution limits are numerically simulated. The proposed measurement is expected to be applied in ultrafast pulse detection due to its application in real-time measurement of ultrafast nonrepetitive signals.

Direct Detection Constraints on Dark Photons with the CDEX-10 Experiment at the China Jinping Underground Laboratory.

We report constraints on the dark photon effective kinetic mixing parameter (κ) with data taken from two p-type point-contact germanium detectors of the CDEX-10 experiment at the China Jinping Underground Laboratory. The 90% confidence level upper limits on κ of solar dark photon from 205.4 kg-day exposure are derived, probing new parameter space with masses (m_{V}) from 10 to 300 eV/c^{2} in direct detection experiments. Considering dark photon as the cosmological dark matter, limits at 90% confidence level with m_{V} from 0.1 to 4.0 keV/c^{2} are set from 449.6 kg-day data, with a minimum of κ=1.3×10^{-15} at m_{V}=200 eV/c^{2}.

Identifying characteristics of an effective fracture liaison service: systematic literature review.

Fracture liaison services (FLS) have been demonstrated to improve outcomes following osteoporotic fracture. The aim of this systematic literature review (SLR) was to determine the characteristics of an FLS that lead to improved patient outcomes. We conducted a SLR, including articles published between 2000 and February 2017, using global (Medline, EMBASE, PubMed and Cochrane Library) and local databases. Studies including patients aged ≥ 50 years with osteoporotic fractures enrolled in an FLS were assessed. Information extracted from each article included key person coordinating the FLS (physician, nurse or other healthcare professional), setting (hospital vs community), intensity (single vs multiple), duration (long vs short term), fracture type and gender. A meta-analysis of randomised controlled trials was conducted based on the key person coordinating the FLS. Out of 7236 articles, 57 were considered to be high quality and identified for further analysis. The SLR identified several components which contributed to FLS success, including multidisciplinary involvement, driven by a dedicated case manager, regular assessment and follow-up, multifaceted interventions and patient education. Meta-analytic data confirm the effectiveness of an FLS following an osteoporotic fracture: approximate 27% increase in the likelihood of BMD testing and up to 21% increase in the likelihood of treatment initiation compared with usual care. The balance of evidence indicates that the multifaceted FLS and dedicated coordination are important success factors that contribute to effective FLS interventions which reduce fracture-related morbidity and mortality.

Design of metasurface polarizers based on two-dimensional cold atomic arrays.

Engineering light-matter interaction using cold atomic arrays is one of the central topics in modern optics. Here we have demonstrated the capability of two-dimensional asymmetric cold atomic arrays as microscopic metasurfaces for controlling polarization states of light. The designed linear polarizer can lead to an extinction ratio over 20dB as well as a high transmittance over 0.8 for the permitted polarization at zero detuning. For detuned driving light, changing lattice constants can also achieve high performance linear polarizers. We have also accomplished a circular polarizer by manipulating the phases of transmitted light. A theoretical analysis based on Bloch theorem shows the underlying mechanism for this performance is actually attributed to cooperative effects in periodic lattices. Finally, we discuss in detail the effects of system size, lattice imperfection and nonzero driving light linewidth in practical implementation. The present study paves a way to design extremely miniaturized metasurfaces using cold atoms and other two-level systems, showing great potential in quantum information and quantum metrology sciences as well as the fundamental physics of light-matter interaction.

[Diagnostic value of combining serum soluble ST2 and interleukin-33 for heart failure patients with preserved left ventricular ejection fraction].

Objective: Diagnostic efficacy of serum markers is low for heart failure patients with preserved left ventricular ejection fraction (HF-pEF) as compared to heart failure patients with reduced left ventricular ejection fraction.We sought to explore the diagnostic value of serum levels of soluble ST2 (sST2) combined with interleukin-33 (IL-33) for the diagnosis of HF-pEF in this study. Methods: A total of 376 patients with HF-pEF (HF group), 376 matched-control patients without heart failure who shared similar clinical characteristics (non-HF group) were included in the study.Another 500 healthy individuals were recruited for assessing the normal ranges of IL-33 and sST2.Serum levels of NT-proBNP were measured by chemi-luminescence assay, while IL-33 and sST2 were measured by enzyme linked immunosorbent assay. Results: Serum levels of IL-33 and sST2 were not normally distributed in healthy population.Serum concentrations of IL-33 and sST2 were significantly higher in HF-pEF patients than in patients in non-HF group (median, IL-33: 0.437 µg/L vs. 0.127 µg/L, P<0.01; sST: 0.118 µg/L vs. 0.067 µg/L, P<0.01). The area under receiver operating characteristic curve (AUC) of sST2 for detecting HF-pEF was 0.763 (95%CI 0.729-0.795, P<0.01), with 71.01% sensitivity and 66.75% specificity, the AUC was 0.884 (95%CI 0.859-0.908, P<0.01), with 80.05% sensitivity and 81.91% specificity in patients with serum IL-33 higher than 0.117 µg/L (median level of serum IL-33 in healthy individuals, n=306). The AUC of NT-proBNP for detecting HF-pEF was 0.83, with 74.73% sensitivity and 84.57% specificity.The AUC of sST2 for detecting HF-pEF was significantly higher than NT-proBNP in population with high serum IL-33 (AUC: 0.88 vs. 0.83, P<0.01). Conclusion: Serum sST2 could serve as a satisfactory biomarker for HF-pEF diagnosis, especially for patients with high serum IL-33 concentrations.

First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan.

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5'CCGACATTGCCGTCAGCGATCACG3' and rv-5'AGCGTTCTTGGGTGTGTTGAGCATTTG3' (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

First Report of Stem and Leaf Blight Caused by Sclerotinia sclerotiorum on Eustoma in Taiwan.

Eustoma (Eustoma russellianum) is an economically important cut flower in Taiwan. Each year more than 1.7 million dozen flowers, mainly exported to Japan in the winter, are produced in greenhouses. In January 2011, eustoma plants with stem and leaf blight symptoms were observed in some greenhouses in Changhua County, Taiwan, at an incidence of 2%. Brown and rotten lesions were presented on the stem and nearby leaves, with white mycelia growing on the surface and black sclerotia (up to 7 mm long) produced inside the stem. Infected plants were completely blighted and eventually died. Diseased stem tissues collected from the field were surface sterilized for 3 min in 0.6% NaOCl, rinsed with sterilized distilled water, and plated on potato dextrose agar. White fungal colonies were consistently isolated. The cultures produced large sclerotia at the peripheries of the plates. Internal transcribed spacer (ITS) sequences of two voucher isolates were determined and deposited in GenBank (Accession Nos. JQ653934 and JQ653935). The sequences were 100% identical to that of Sclerotinia sclerotiorum strain ATCC MYA-4521 (Accession No. FJ810516). In addition, PCR amplified DNA fragments (approximately 630 bp) were obtained by the S. sclerotiorum specific primer pair MP_SsF and MP_UniR (1). On the basis of morphology, ITS sequence homology, and the specific PCR detection, the fungus was identified as S. sclerotiorum. The two fungal isolates (BCRC34830 and BCRC34831) were deposited in Bioresource Collection and Research Center, Hsinchu, Taiwan. Pathogenicity tests were conducted on 1-month-old, second flush eustoma cultivars Ex Rosa Pink Flash and Rosina Blue Ver. 2 after primary flowers had been harvested in the greenhouse. Fungal inoculum consisting of Tref horticultural substrate and wet sterilized rice colonized by S. sclerotiorum BCRC34830 (substrate-rice-water ratio of 2:1:1) was placed near the base of the plants. Ten plants of each cultivar were inoculated with about 800 g of the mixture. Sterile mixture applied to an equal number of plants served as negative controls. Eight plants of each cultivar showed blight symptoms after 1 month of incubation at an average temperature of 26°C. All control plants remained healthy. The pathogen reisolated from the inoculated stems produced sclerotia identical to those isolated in the field, fulfilling Koch's postulates. The pathogenicity test was repeated with similar results. S. sclerotiorum has been reported on eustoma in Argentina (2). To our knowledge, this is the first report of Sclerotinia blight on eustoma in Taiwan. Although the disease was not prevalent on eustoma, the inoculum could be dormant in the greenhouse soil. Awareness of the potential perennial problem could increase the quality of the flowers exported and benefit the flower industry. References: (1) S. Hirschhäuser and J. Fröhlich. Int. J. Food Microbiol. 118:151, 2007. (2) S. Wolcan et al. Plant Dis. 80:223, 1996.

Incidental finding of juvenile angiofibroma from pre-orthodontic radiographs: two case reports and a literature review.

This case series presents two asymptomatic cases of juvenile angiofibroma which were initially incidentally identified in pre-orthodontic radiographs. Juvenile angiofibroma is an uncommon, locally aggressive benign, vascular neoplasm with invasive growth patterns. Due to the hypervascularity of these tumours, there are biopsy associated risks and multi-slice computed tomography, magnetic resonance imaging and angiography are usually employed for diagnosis. Early pre-symptomatic identification of this lesion facilitates early management and limiting potential life-threatening complications. This highlights the importance of thorough interpretation of dental radiographs, including the evaluation of structures which are not in the primary region of interest. © 2022 Australian Dental Association.

First Report of Acidovorax avenae subsp. citrulli as the Causal Agent of Bacterial Leaf Blight of Betelvine in Taiwan.

In November 2008, betelvines (Piper betle L., Piperaceae) exhibiting leaf blight symptoms were observed in central Taiwan. Infections resulted in a 30 to 70% loss of leaf yield in the investigated betel leaf-producing facilities. Symptoms began with small, necrotic, water-soaked spots that progressed to circular to irregularly shaped brown lesions, 5 to 10 mm in diameter, with chlorotic halos on leaves; some lesions started from the edge of leaves and later fused to form dried, necrotic margins. Bacteria-like streaming fluid was visible from the edges of freshly cut lesions at the junctions of chlorotic and necrotic leaf tissues when observed with a light microscope at ×100. When the streaming fluid was streaked onto King's medium B (3), a slow-growing, gram-negative, nonfluorescent bacterium was identified from the whitish colonies that consistently developed on the medium. Five bacterial isolates from three lesions were characterized with fatty acid methyl ester analysis (Agilent Technologies, Santa Clara, CA) and Sherlock Microbial Identification System (Microbial IDentification Inc., Newark, DE), and for each isolate, the bacterium was confirmed as Acidovorax avenae subsp. citrulli with a similarity index >0.70. In addition, the Biolog system (Biolog, Hayward, CA) and 16S ribosomal RNA sequence identity comparison were performed to confirm that the five betelvine-isolated bacteria were A. avenae subsp. citrulli based on a similarity of 0.54 with Biolog and 99% sequence identity for 16S rRNA gene. Koch's postulates were fulfilled by infiltrating a bacterial suspension of 3 × 105 CFU/ml into 40 leaves of four greenhouse-grown, disease-free, mature betelvine plants. After inoculation, plants were kept in a humidified greenhouse at 28°C to favor symptom development and symptoms similar to those observed in the greenhouse were evident at 7 days post inoculation (dpi) on all bacterium-infiltrated leaves. Control leaves infiltrated with distilled water remained symptomless. Bacteria showing morphological and biochemical similarities (2) to the ones used for inoculation were isolated from all of the inoculated betelvine leaves. In addition, a bacterial suspension at 3 × 108 CFU/ml was sprayed at the amount of 5 ml per plant onto 6 to 10 plants each of 4-week-old disease-free seedlings of watermelon (Citrullus lanatus (Thunb.) Matsum & Nakai, cv. Empire No. 2), oriental sweet melon (Cucumis melo L. var. saccharinus Naudin, cv. Silver Beam), and waxgourd (Benincasa hispida (Thunb.) Cogn., cv. Cheerer) for bioassays, and the inoculated seedlings were enclosed in plastic bags for 36 h at 28°C. Water-soaked lesions were observed on leaves of watermelon and waxgourd at 2 dpi and on sweet melon at 4 dpi on all inoculated plants but not on distilled water-sprayed control plants, indicating that A. avenae subsp. citrulli strains from betelvine could also infect melon plants. A. avenae subsp. citrulli was previously identified as the causal agent of bacterial fruit blotch on melon and bitter gourd in Taiwan (1). To our knowledge, this is the first report that A. avenae subsp. citrulli can naturally infect betelvine, a noncucurbit crop, to elicit bacterial leaf blight disease. References: (1) A.-H. Cheng and T.-C. Huang. Plant Pathol. Bull. 7:216, 1998. (2) J. B. Jones et al. Page 121 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001. (3) E. O. King et al. J. Lab. Clin. Med. 44:301, 1954.

MiR-640 inhibition alleviates acute liver injury via regulating WNT signaling pathway and LRP1.

OBJECTIVE: Acute liver injury (ALI) is associated with the Kupffer cells (KCs) inflammation and hepatocytes apoptosis. Previous studies have shown that miR-640 is a valid regulator of the Low-density lipoprotein receptor-related protein 1 (LRP 1) which expressed much lower in an inflammatory condition. However, it is unclear whether MiR-640 inhibition protects against ALI by the up-regulation of LRP 1. To explore the regulated mechanism of miR-640 on acute liver injury. MATERIALS AND METHODS: We analyzed the expression of miR-640 in different times of acute injured liver tissues. Lipopolysaccharide (LPS) was employed in provoking the KCs inflammation to injure liver. We used miR-640 mimic or inhibitor to improve or resist the function of miR-640 to explore miR-640 function to ALI via the target of LRP1. RESULTS: We showed that the expression of miR-640 markedly increased in LPS-induced acute injured liver tissues. LPS promoted the progress of ALI, and the inhibition of miR-640 could reverse the injured effects of LPS. Moreover, WNT signaling pathway and LRP1 were significantly enhanced by miR-640 inhibition. CONCLUSIONS: These results suggested that miR-640 promotes KCs inflammation via restraining LRP 1 and WNT signaling pathway. But inhibiting miR-640 prevents inflammation damage and ameliorates ALI. MiR-640 inhibition may become a novel target for the therapy of ALI in the future.

Volcanic dust in deep-sea sediments: relationship of microfeatures to explosivity estimates.

Particle size variations in a series of volcanic ash layers, deposited in high latitudes of the South Pacific during the past 2.5 million years, were earlier analyzed by using a model in which source cloud height and minimum volcanic paleoexplosivity are derived from downwind ash distribution. Examination of submicrometer morphological features of the volcanic glass shards reveals a clear relationship between what appear to be impact features on the glass surfaces and the independently derived paleoexplosivities, which suggests that this may be a simple means to characterize ash horizons and estimate relative volcanic explosivities.

Antarctic glacial history from analyses of ice-rafted deposits in marine sediments: new model and initial tests.

Contrasts between the latitudinal distributions of ice-rafted debris deposited in deep-sea sediments during Pleistocene glacial and interglacial periods are predicted by a new model. The model requires the existence of a restricted zone where rates of deposition of ice-rafted debris are essentially independent of glacial-interglacial cycles. Initial tests and published results show that the concept is valid in the Southern Ocean and that it provides a new means of diagnosing major migrations of climatic zones.

Paleoclimatological analysis of late quaternary cores from the northeastern gulf of Mexico.

Oxygen isotopic, radiocarbon, and micropaleontological analysis of deep-sea cores from the northeastern Gulf of Mexico identify an episode of rapid ice melting and sea-level rise at about 9600 years B.C. This age coincides, within the limits of all errors, with the age of the Valders ice readvance and with the age assigned by Plato to the flood he describes.

Mediastinitis and mediastinitis-like symptoms associated with mal-positioning of a Port-A catheter.

Mediastinitis is a life-threatening condition and would appear to have been rarely reported as arising as a central-venous catheter-associated complication. Here we report on one cancer patient featuring a Port-A catheter tip positioned within the innominate vein, who developed mediastinitis and mediastinitis-like symptoms subsequent to chemotherapeutic-agent infusion through this catheter. The relevant literature pertaining to this condition was reviewed, and the possible pathophysiology of the condition was discussed.

Multiple, large sialoliths of the submandibular gland duct: a case report.

This paper reviews the major clinical and radiographic features of sialoliths and illustrates these with an unusual case of multiple sialoliths within the submandibular gland duct. The differential diagnosis of other calcific structures both within and outside the salivary gland that may mimic a sialolith is also presented.

A significant incidental finding on cone beam computed tomography: multiple myeloma.

Cone beam computed tomography is widely used in dentistry. Incidental findings are common, with many requiring intervention or monitoring. We present a rare case of previously undiagnosed, asymptomatic multiple myeloma first identified incidentally on cone beam computed tomography and panoramic radiography. This case highlights the diverse range of lesions that may appear on cone beam computed tomography and the importance of radiologic interpretation.