RESUMO
Commonly deployed measurement systems for water waves are intrusive and measure a limited number of parameters. This results in difficulties in inferring detailed sea state information while additionally subjecting the system to environmental loading. Optical techniques offer a non-intrusive alternative, yet documented systems suffer a range of problems related to usability and performance. Here, we present experimental data obtained from a 256 × 256 Single Photon Avalanche Diode (SPAD) detector array used to measure water waves in a laboratory facility. 12 regular wave conditions are used to assess performance. Picosecond resolution time-of-flight measurements are obtained, without the use of dye, over an area of the water surface and processed to provide surface elevation data. The SPAD detector array is installed 0.487 m above the water surface and synchronized with a pulsed laser source with a wavelength of 532 nm and mean power <1 mW. Through analysis of the experimental results, and with the aid of an optical model, we demonstrate good performance up to a limiting steepness value, ka, of 0.11. Through this preliminary proof-of-concept study, we highlight the capability for SPAD-based systems to measure water waves within a given field-of-view simultaneously, while raising potential solutions for improving performance.
RESUMO
Eupatorium purpureum L. (joe-pye weed, sweet joe-pye weed, and sweetscented joe-pye weed) is a wildflower perennial plant native to the eastern United States. In May 2006, virus-like symptoms including systemic chlorosis, mottling, and downward rolling of leaf blades were observed in a joe-pye weed plant located on the Mississippi State University campus. Young symptomatic leaves were ground in 0.1 M phosphate buffer, pH 7.2, and the slurry was inoculated on leaves of several herbaceous hosts grown in a greenhouse. Systemic symptoms were observed 1 to 2 weeks postinoculation in Cucumis sativus (chlorotic spots followed by systemic ringspot and leaf deformation), Chenopodium quinoa (necrotic lesions/leaf deformation), Nicotiana benthamiana (mosaic/line patterns), and N. rustica (necrotic ring spots). Electron microscopy of partially purified preparations from infected joe-pye weed and cucumber plants revealed the presence of intact and empty isometric viral particles of approximately 30 nm in diameter resembling nepoviruses or comoviruses. The original joe-pye weed plant and artificially infected herbaceous plants were tested by ELISA (Agdia Inc., Elkhart, IN) for several nepoviruses/comoviruses and found to be positive for Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae). Total RNA extracted from the original virus source plant was reverse transcribed using oligodT primer and submitted to PCR with the primer set TRS-F (5'TATCCCTATGTGCTTGAGAG3') and TRS-R (5'CATAGACCACCAGAGTCACA3') designed from the published sequences in GenBank of the RNA 1 of Tobacco ringspot virus. A specific 766-bp PCR product was cloned and sequenced. Sequence analysis showed that the virus from the joe-pye weed shared 94% nucleotide identity (98% at amino acid level) with a "bud blight" isolate of TRSV (Accession No U50869) (2) in the sequenced genome portion and slightly lower (90 to 92%) with other sequenced isolates of the same virus, thus further confirming the identity of the virus. In 2008 and 2009, TRSV was detected in an additional 16 symptomatic specimens of the same host collected from six distinct locations in Mississippi. Our results show that E. purpureum is a new host for TRSV. Considering that the related plant species E. capillifolium (small dogfennel) was already reported as a host of TRSV in North Carolina (1), this suggests that these two common plants may represent additional reservoirs of this virus in the region. References: (1) M. C. Rush and G. V. Gooding. Phytopathology 60:1756, 1970, (2) P. A. Zalloua et al. Virology 219:1, 1996.
RESUMO
From all women diagnosed with invasive breast cancer in 1999 in Western Australia, rural and urban women were compared with regard to mode of detection, tumour characteristics at presentation, diagnostic investigations, treatment and survival. Women from rural areas with breast cancer (n=206, 23%) were less likely to have open biopsy with frozen section (P<0.001), breast-conserving surgery (P<0.001), adjuvant radiotherapy (P=0.004) and hormonal therapy (P=0.03), and were less likely to be treated by a high caseload breast cancer surgeon (P<0.001). Adjusting for age and tumour characteristics, rural women had an increased likelihood of death within 5 years of breast cancer diagnosis (HR 1.62, 95% CI 1.10-2.38). This difference was not significant after adjustment for treatment factors (HR 1.36, 95% CI 0.90-2.04).
Assuntos
Neoplasias da Mama , Saúde da População Rural , Saúde da População Urbana , Idoso , Antineoplásicos/uso terapêutico , Neoplasias da Mama/diagnóstico , Neoplasias da Mama/mortalidade , Neoplasias da Mama/terapia , Feminino , Humanos , Mamografia/estatística & dados numéricos , Mastectomia/estatística & dados numéricos , Pessoa de Meia-Idade , Estadiamento de Neoplasias , Radioterapia/estatística & dados numéricos , Taxa de Sobrevida , Austrália Ocidental/epidemiologiaRESUMO
The hypothesis that dietary fat acts as a promotional agent for the development of breast cancer by influencing sex hormone levels was tested in a dietary intervention study. Thirty-three women in good health were randomly allocated to commence either a standard diet (deriving 40% of their energy from fat) or a low-fat diet (deriving 20% of their energy from fat). After 2 months, the women were crossed over to the alternative diet for another 2 months. Serum hormone and lipid levels were measured in the middle and at the end of each dietary period. In premenopausal women, the low-fat diet appeared to decrease levels of both non-protein-bound estradiol (1.48 down to 1.27%; P = .07) and non-protein-bound testosterone (1.06 down to 0.86%; P = .11). Cholesterol levels were lowered by the low-fat diet and were significantly associated with estradiol, testosterone, and dehydroepiandrosterone. High-density lipoprotein (HDL) cholesterol was associated with estradiol and prolactin. For the postmenopausal women, the low-fat diet lowered cholesterol and HDL cholesterol levels, but there were not the same associations with the hormones. These findings add weight to the concept that attention to diet may be a means of reducing the incidence of breast cancer in our community.
Assuntos
Gorduras na Dieta/farmacologia , Hormônios/sangue , Adulto , Fatores Etários , Idoso , Androgênios/sangue , Colesterol/sangue , HDL-Colesterol/sangue , Ingestão de Energia , Estrogênios/sangue , Feminino , Humanos , Masculino , Menopausa , Pessoa de Meia-Idade , Progesterona/sangue , Prolactina/sangue , Triglicerídeos/sangueRESUMO
In the present study, we have measured acetylation phenotype in 45 patients who had undergone surgical resection of a primary adenocarcinoma of the breast and in 48 patients or volunteer subjects with no breast disease. Phenotype was determined by measuring the ratio of N-acetylsulfamethazine to N-acetylsulfamethazine plus sulfamethazine in plasma 6 h after a p.o. dose of sulfamethazine. In the control group, there were 31 slow and 17 rapid acetylators, while in the breast patients, there were 25 slow and 20 rapid acetylators. The proportions of slow/rapid acetylators were not significantly different between the 2 groups (Pearson's chi 2 with Yates' correction = 0.45; P = 0.51). The data suggest that acetylation phenotype is not a useful risk prediction measurement in breast cancer.
Assuntos
Neoplasias da Mama/metabolismo , Acetilação , Adulto , Idoso , Idoso de 80 Anos ou mais , Feminino , Humanos , Pessoa de Meia-Idade , FenótipoRESUMO
When a steep, breaking wave hits a vertical sea wall in shallow water, a flip-through event may occur, leading to the formation of an up-rushing planar jet. During such an event, a jet of water is ejected at a speed many times larger than the approaching wave's celerity. As the jet rises, the bounded fluid sheet ruptures to form vertical ligaments which subsequently break up to form droplets, creating a polydisperse spray. Experiments in the University of Hokkaido's 24 m flume measured the resulting droplet sizes using image analysis of high-speed video. Consideration of the mechanisms forming spray droplets shows that the number density of droplet sizes is directly proportional to a power p of the droplet radius: where p=-5/2 during the early break-up stage and p=-2 for the fully fragmented state. This was confirmed by experimental observations. Here, we show that the recorded droplet number density follows the lognormal probability distribution with parameters related to the elapsed time since the initial wave impact. This statistical model of polydisperse spray may provide a basis for modelling droplet advection during wave overtopping events, allowing atmospheric processes leading to enhanced fluxes of mass, moisture, heat and momentum in the spray-mediated marine boundary layer over coasts to be described.
RESUMO
We have assessed the outcomes for all women diagnosed with invasive breast cancer in Western Australia during 1989, 1994 and 1999, and compared the results for surgeons who treat 20 or more cases per year with those of surgeons who treat less. Women treated by high caseload surgeons were more likely to retain their breast (53.3% vs. 36.7%, p<0.001), have adjuvant radiotherapy (50.0% vs. 30.6%, p<0.001), and be alive after 4 years (1989, 86% vs. 82%; 1994, 89% vs. 84%; 1999, 90% vs. 79%, HR 0.71, p=0.03). Adjusting for age and year of diagnosis, women were not more likely to be treated with adjuvant chemotherapy (29.2% vs. 20.9%, p=0.28). In 1989 35% of women were treated by high caseload surgeons. By 1999 this had risen to 82%. The results confirm that women treated by high caseload surgeons have better outcomes.
Assuntos
Neoplasias da Mama/cirurgia , Invasividade Neoplásica , Padrões de Prática Médica/estatística & dados numéricos , Carga de Trabalho , Adulto , Idoso , Idoso de 80 Anos ou mais , Quimioterapia Adjuvante , Feminino , Humanos , Pessoa de Meia-Idade , Competência Profissional , Estudos Retrospectivos , Análise de Sobrevida , Resultado do Tratamento , Austrália OcidentalRESUMO
A possible mechanism by which dietary fat may influence the development of breast cancer is by influencing the concentration of female sex hormones. This study investigated the effect of alteration in the type of fat consumed on concentrations of female sex hormones in serum. Female volunteers were randomly assigned to continue on their usual meat-eating diet, change to a vegetarian diet, or change to a diet that was predominantly vegetarian but where fish was consumed at least three times per week. Change to the vegetarian or fish diet had little effect on diet total hormone concentrations; however, the amount of estradiol was significantly decreased in the vegetarian group. When nutrient consumption was correlated with hormone concentrations, prolactin was directly associate with fat consumption, sex-hormone-binding globulin was inversely associated with fat consumption (particularly cholesterol consumption), and the proportion of nonprotein-bound estradiol was directly associated with complex carbohydrate consumption.
Assuntos
Dieta , Gorduras na Dieta , Hormônios Esteroides Gonadais/sangue , Adulto , Animais , Neoplasias da Mama/etiologia , Dieta/efeitos adversos , Dieta Vegetariana , Gorduras na Dieta/efeitos adversos , Estradiol/sangue , Feminino , Peixes , Humanos , Carne , Pessoa de Meia-Idade , Progesterona/sangue , Testosterona/sangueRESUMO
Premenopausal patients undergoing surgery for breast cancer were prospectively studied. Data regarding menstrual history, pathological parameters and hormone receptor status were collected. Serum oestradiol, prolactin and progesterone levels, tumour epidermal growth factor receptor (EGFR) levels, tumour epidermal growth factor (EGF) levels and flow cytometry were measured. Patients were allocated to the follicular or luteal phase of their cycle both by history and progesterone level. No significant differences were seen in hormone receptor levels, pathological parameters or EGF levels between the two groups. EGFR levels were significantly higher in women undergoing surgery during the follicular phase of their cycle, when classified by menstrual history. Patients operated on during this phase have previously been found to have a poorer prognosis, and these results may provide a basis for this finding. This may have implications for prognosis and timing of surgery, and further investigation is warranted.
Assuntos
Neoplasias da Mama/sangue , Neoplasias da Mama/cirurgia , Ciclo Menstrual/sangue , Adulto , Fator de Crescimento Epidérmico/sangue , Receptores ErbB/metabolismo , Estradiol/sangue , Feminino , Fase Folicular/metabolismo , Humanos , Fase Luteal/metabolismo , Pessoa de Meia-Idade , Proteínas de Neoplasias/metabolismo , Progesterona/sangue , Prolactina/sangue , Estudos Prospectivos , Fatores de TempoRESUMO
The rate of growth and spread of breast cancer varies considerably from patient to patient. An observational study was undertaken to identify possible associations between breast cancer growth characteristics and a wide variety of host factors, including demographic, anthropometric, hormonal and dietary variables in 91 patients with breast cancer. Increasing age was associated with favourable growth characteristics, while previous tonsillectomy was associated with adverse growth characteristics. There were no significant associations in anthropometric variables. For postmenopausal women, increasing bioavailability of oestradiol was associated with favourable growth characteristics, while increasing prolactin concentration was associated with adverse growth characteristics. Increasing consumption of sugar, fibre, fruit and vegetables and vitamins was associated with favourable growth characteristics. Consumption of fat (monounsaturated and saturated) was associated with adverse characteristics when adjustment was made for total energy intake. The host environment may play a role in the control of breast cancer growth. In particular, the associations with oestrogen and progesterone receptor status indicate that nutrients may be of value as biological response modifiers in patients having hormonal therapy. This requires further investigation to assess therapeutic potential.
Assuntos
Neoplasias da Mama/patologia , Fatores Etários , Antropometria , Neoplasias da Mama/sangue , Neoplasias da Mama/epidemiologia , Dieta , Estradiol/análise , Exercício Físico , Feminino , Humanos , Pessoa de Meia-Idade , Invasividade Neoplásica , Progesterona/análise , Prolactina/análise , Receptores de Estrogênio/análise , Receptores de Prostaglandina/análise , Globulina de Ligação a Hormônio Sexual/análise , Fumar , TonsilectomiaRESUMO
The oestrogen-inducible pS2 protein has previously been associated with good prognosis for breast cancer patients. In 1987-1988 a series of 145 primary breast cancers were examined for pS2 mRNA using northern blots. On recent examination of mortality data, we were unable to find any association between tumour pS2 positivity and patient survival. One patient in 6 died within 5 years of surgery, regardless of pS2 status. In the oestrogen receptor positive/progesterone receptor positive tumour subgroup of patients, we found no evidence of increased survival for pS2-positive tumours. These results do not support use of pS2 as an indicator of increased survival in an average breast cancer patient population.
Assuntos
Biomarcadores Tumorais/biossíntese , Neoplasias da Mama/metabolismo , Proteínas de Neoplasias/biossíntese , Proteínas , Adulto , Idoso , Idoso de 80 Anos ou mais , Northern Blotting , Neoplasias da Mama/mortalidade , Feminino , Humanos , Pessoa de Meia-Idade , Prognóstico , RNA Mensageiro/genética , RNA Neoplásico/genética , Receptores de Estrogênio/análise , Receptores de Progesterona/análise , Fator Trefoil-1 , Proteínas Supressoras de TumorRESUMO
The metabolism of sulfamethazine (SMZ) and p-aminobenzoic acid (PABA) by N-acetyltransferase (NAT) was measured in human colorectal cytosols from 12 slow and 11 rapid acetylators whose genotype was determined independently by a specific polymerase chain reaction. SMZ metabolism was significantly greater in the rapid than in the slow phenotype (192 +/- 22 versus 94 +/- 11 pmol N-acetylsulfamethazine/min/mg protein), while PABA metabolism was similar in both phenotypes (23.7 +/- 4.4 versus 23.0 +/- 3.9 nmol N-acetyl-p-aminobenzoic acid/min/mg protein). Both monomorphic and polymorphic NAT mRNAs were detected by the polymerase chain reaction in the colorectal mucosa of most samples. The finding that polymorphic NAT is expressed in a phenotype-dependent manner in colorectal mucosa indicates that this tissue has the capacity to participate in local bioactivation of dietary and environmental aryl- or heterocyclic amine carcinogens and may explain, in part, the phenotype-dependent occurrence of colorectal cancer.
Assuntos
Acetiltransferases/biossíntese , Colo/enzimologia , Ácido 4-Aminobenzoico/metabolismo , Acetilação , Acetiltransferases/genética , Idoso , Sequência de Bases , Colo/metabolismo , Feminino , Expressão Gênica , Humanos , Técnicas In Vitro , Mucosa Intestinal/enzimologia , Masculino , Pessoa de Meia-Idade , Dados de Sequência Molecular , Fenótipo , Reação em Cadeia da Polimerase , Polimorfismo Genético , RNA Mensageiro/análise , Sulfametazina/metabolismoRESUMO
PURPOSE: Cyclophilin 40 (CyP40) is an estrogen receptor-associated protein which appears to modify receptor function. The aim of this study was to determine the extent of allelic loss at the CyP40 locus in a panel of breast carcinomas using a newly characterized microsatellite marker located upstream of the CyP40 gene and then to correlate this with losses at chromosomal sites for cancer-associated genes. METHODS: Allelic loss at CyP40 was determined from patients' matched tumor and normal breast tissue using Genescan 672 software analysis of fluorescently labeled, PAGE-separated PCR products incorporating the marker. For each patient, allelic loss at CyP40 was then assessed and compared with losses at markers for various cancer-associated genes. RESULTS: Allelic loss was detected in 30% of breast carcinomas from patients heterozygous for the CyP40 marker. All carcinomas demonstrating allelic loss were grade II or III invasive ductal carcinomas and generally showed multiple losses at other sites near known cancer-associated genes. CONCLUSIONS: The polymorphic marker which we characterized was useful in determining allelic loss at the CyP40 locus in breast cancer patients and when applied in these studies in conjunction with various cancer-associated gene markers, suggests that deletions in the region of the CyP40 gene might be a late event in breast tumor progression.
Assuntos
Neoplasias da Mama/genética , Proteínas de Transporte/genética , Ciclofilinas , Perda de Heterozigosidade , Peptidilprolil Isomerase/genética , Receptores de Estrogênio/metabolismo , Mama/metabolismo , Neoplasias da Mama/metabolismo , Peptidil-Prolil Isomerase F , Feminino , Humanos , Repetições de MicrossatélitesRESUMO
Cyclical mastalgia is very common in Western populations and is believed to have an hormonal basis. Simple measures such as vitamins or evening primrose oil are not very effective, yet the disease rarely warrants anti-oestrogen therapies. Isoflavones are a subgroup of phytoestrogens which we hypothesized might be a simple and effective means of therapy as they act as a weak anti-oestrogen in pre-menopausal women and have no side-effects. A double-blind randomized control trial of either placebo, 40 mg or 80 mg of isoflavones was undertaken after an initial 2 month single-blind 'Placebo Lead-in' to exclude women with a significant placebo response. Eighteen women were randomized to the treatment phase of the trial. Nine of the 12 women on treatment had a worthwhile improvement in their pain compared to only two of six on placebo. The reduction in pain was 13% for placebo, 44% for 40 mg of isoflavone per day and 31% for 80 mg per day. There have been no previous clinical studies of isoflavones for the treatment of mastalgia and the benefit demonstrated in this study adds another valuable arm to therapy.
RESUMO
Variation in body position has been shown to affect respiratory function in adults and neonates with and without respiratory illness. At present it remains unclear why respiratory function should be affected by different body positions. We hypothesized that the effect of body weight on the relatively compliant chest wall of the newborn infant in the prone position would cause a reduction in functional residual capacity (FRC) and a compensatory improvement in ventilation/perfusion matching as measured by effective pulmonary blood flow. To evaluate this, a paired crossover study was performed on 12 normal newborn infants. The inert gas (argon) rebreathing method adapted for neonates was used to measure FRC. Simultaneously effective pulmonary blood flow (Qpeff) was determined using Freon 22 and a mass spectrometer with computerized analysis. The babies were studied in three different positions in random order: prone, supine and right lateral decubitus. The means (95% confidence intervals) of the three groups of FRC were 23.8 (19.2 to 28.4), 23.8 (20.2 to 27.5), and 24.3 (19.5 to 29.2) ml/kg, respectively (P = 0.59) and for Qpeff were 104 (91 to 116), 108 (95 to 122), 109 (97 to 122) ml/ kg-min, respectively (P = 0.11). Thus no significant differences were demonstrated. In nine of the babies, a repeat supine measurement was taken at the end of the study to assess repeatability of the method. In these nine babies alone the results were 22.7 (19.1 to 26.3) and 22.1 (18.6 to 25.6) ml/kg for FRC, and 102 (89 to 116) and 98 (90 to 107) ml/kg-min for Qpeff. The coefficients of repeatability were 4.7 ml/kg for FRC (21%) and 30 ml/kg-min for Qpeff (30%).
Assuntos
Capacidade Residual Funcional/fisiologia , Recém-Nascido/fisiologia , Postura/fisiologia , Circulação Pulmonar/fisiologia , Sono/fisiologia , Argônio , Peso Corporal , Clorofluorcarbonetos de Metano , Estudos Cross-Over , Humanos , Decúbito Ventral , Reprodutibilidade dos Testes , Morte Súbita do Lactente/prevenção & controle , Decúbito DorsalRESUMO
Stereotactic core biopsy (CB) using 14-gauge needles was adopted as the standard method of diagnosis of screen-detected breast microcalcifications (MC) at Sir Charles Gairdner Hospital in 1996. Fine needle aspiration (SFNA) was included as an adjunct, to optimise sensitivity and to provide immediate reporting. Recently, core imprint cytology (CI) has been shown to have a high sensitivity in diagnosing malignancy. The aims of this paper were to evaluate the accuracy of SFNA as an adjunct to CB, and whether CI could replace SFNA for immediate reporting in MC. Part A is a retrospective review of CB/SFNA of screen-detected MC from May 1998 to February 2000. A minimum of five cores was performed. SFNA samples were restricted to a maximum of three needle passes. Part B is a prospective study of CI from May to November 2000. In Part A, there were 406 MC in 353 women and 81 carcinomas were proven on excision. The complete sensitivity of CB for a diagnosis of malignancy was 97.5% and of SFNA was 65%. No false-positive diagnoses were made by either method. No extra carcinomas were detected using SFNA. In Part B, CB/CI were performed on 203 MC from 165 women. There were 38 carcinomas and 30 of these (79%) were diagnosed as malignant on CI. No false-positive diagnoses were made. The predictive value of a benign diagnosis was 95%. SFNA had little value as an adjunct to core biopsy in MC. CI promises to be useful in providing same day diagnosis for counselling purposes and for planning future surgery.
Assuntos
Neoplasias da Mama/patologia , Mama/patologia , Calcinose/patologia , Carcinoma/patologia , Biópsia por Agulha , Diagnóstico Diferencial , Feminino , Humanos , Valor Preditivo dos Testes , Estudos Prospectivos , Sensibilidade e Especificidade , Técnicas EstereotáxicasRESUMO
This study was part of a population-based survey of all cases of breast cancer diagnosed in Western Australia in 1989. The paper concerns histopathology reporting by pathologists in 655 cases of carcinoma of the breast in that year, before the introduction of mammographic screening programmes. Pathological features of the neoplasms are documented, and the extent to which information known to be of clinical or prognostic importance was included in the reports is analysed. 96.5% of all pathology reports included information on breast cancer subtype and, in 98.6% of cases with axillary dissection, the number of lymph nodes dissected, and the number containing metastatic tumor was stated. In 83.7% of cases of invasive carcinoma exact tumor dimensions were recorded. In 44.9% of cases histological grade was recorded, and information about excision margins was present in 60% of reports overall. The reporting of pathological features in many instances was limited by the way in which the specimen was handled prior to reception. At the time of the study, views about the importance of many aspects of histological assessment were still evolving. Even now, for example, consensus is still being reached on the value of histological grading in predicting prognosis and whether reliable histological assessment of such factors as extent of DCIS and completeness of excision of DCIS is possible. The introduction of mammographic screening since 1989 has provided a focus for wider discussion about the value of histological information in prognostication and patient management. A case is made to support the use of "check lists" for surgical pathology reports in cases of breast cancer.
Assuntos
Neoplasias da Mama/patologia , Carcinoma in Situ/patologia , Carcinoma Lobular/patologia , Carcinoma/patologia , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Neoplasias da Mama/epidemiologia , Carcinoma/epidemiologia , Carcinoma/secundário , Carcinoma in Situ/epidemiologia , Carcinoma Lobular/epidemiologia , Feminino , Humanos , Metástase Linfática , Programas de Rastreamento , Pessoa de Meia-Idade , Prognóstico , Austrália OcidentalRESUMO
AIMS: To assess the effects of smoking during pregnancy on lung mechanics and lung volumes in the immediate neonatal period, before infants are exposed to passive smoking. METHODS: Lung function tests were carried out within 72 hours of delivery in infants born to 100 non-smoking and 189 smoking mothers. Lung growth was assessed by plethysmography and lung mechanics using the single breath occlusion technique and oesophageal balloon/pneumotachography. Antenatal maternal serum cotinine values were obtained from 133 mothers. RESULTS: Smoking was associated with a significant reduction in birthweight (mean 256 g, 95% CI 0.164 to 0.392), and length (mean 1.26 cm, 95% CI 0.48 to 2.00). Lung volume was not reduced when related to weight. Smoking was associated with a highly significant reduction in static compliance (Crs). This effect remained significant after relating Crs to weight and lung volume. Regression analyses showed that the Crs association was limited to the boys. Smoking was associated with a small but significant reduction in respiratory system conductance (Grs) (single breath occlusion technique) and total pulmonary conductance (Gp). These associations were limited to girls. CONCLUSIONS: Smoking in pregnancy reduces static compliance in boys and conductance in girls. There was no evidence that maternal smoking adversely affected fetal lung growth.
Assuntos
Desenvolvimento Embrionário e Fetal , Pulmão/fisiologia , Mecânica Respiratória , Fumar/efeitos adversos , Adulto , Peso ao Nascer , Estatura , Feminino , Humanos , Recém-Nascido , Pulmão/embriologia , Complacência Pulmonar , Masculino , Pletismografia , Gravidez , Análise de Regressão , Fatores SexuaisRESUMO
A multicenter, multinational, blinded, randomized, parallel-group, phase II study was conducted to investigate the use of recombinant human tissue factor pathway inhibitor (rhTFPI; SC-59735) as an antithrombotic additive to the intraluminal irrigating solution during microvascular anastomosis in free flap reconstructive surgery. A total of 622 patients undergoing free flap reconstruction were randomly assigned to three groups. For each group, a different intraluminal irrigating solution was administered at completion of the microvascular arterial and venous anastomoses and before blood flow to the flap was reestablished: rhTFPI at a concentration of 0.05 or 0.15 mg/ml (low-dose or high-dose group, respectively) or heparin at a concentration of 100 U/ml (current-standard-of-practice group). There were no other differences in treatment among the groups. Patient characteristics, risk factors, and surgical techniques used were similar among all three groups. Flap failure was lower (2 percent) in the low-dose rhTFPI group than in the high-dose rhTFPI (6 percent) and heparin (5 percent) groups, but this difference was not statistically significant (p = 0.069). There were no significant differences in the rate of intraoperative revisions of vessel anastomoses (11 percent, 12 percent, and 13 percent) or postoperative thrombosis (8 percent, 8 percent, and 7 percent) among the low-dose rhTFPI, high-dose rhTFPI, and heparin groups, respectively. The rate of postoperative wound hematoma was significantly lower in the low-dose rhTFPI group (3 percent) than in the high-dose rhTFPI (8 percent) and heparin (9 percent) groups (p = 0.040). There were no differences in blood chemistry or coagulation values among the three study groups. Other than hematomas, there were no differences in the incidence or severity of adverse reactions among the three groups. It is concluded that use of rhTFPI as an intraluminal irrigant during free flap reconstruction is safe, well tolerated, and as efficacious as use of heparin for preventing thrombotic complications during and after the operation. Furthermore, the lower dose of rhTFPI (0.05 mg/ml) may reduce the occurrence of postoperative hematoma and help prevent flap failure.
Assuntos
Anticoagulantes/administração & dosagem , Microcirurgia , Proteínas/administração & dosagem , Retalhos Cirúrgicos/irrigação sanguínea , Trombose/prevenção & controle , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Relação Dose-Resposta a Droga , Método Duplo-Cego , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Irrigação TerapêuticaRESUMO
Tomato yellow leaf curl virus (TYLCV) is a begomovirus (family Geminiviridae) that causes severe chlorosis, stunting, and cupping of leaves in tomato (Lycopersicon esculentum) throughout the world. The disease was first reported in the United States in Florida in 1997 (2). In 2000, TYLCV was confirmed as the cause of severe chlorosis, stunting, and cupping of leaves in tomato in Louisiana (3). In January of 2001, mild symptoms consistent with TYLCV were observed in a greenhouse-tomato production operation in east-central Mississippi. Whiteflies (Bremisia tabaci) were present in the greenhouse during the previous month, but in relatively low numbers. Symptom severity slightly increased over time with chlorosis in the terminal, reduction in terminal leaf size, and upward cupping of leaves observed. Approximately 4% of plants in the greenhouse developed symptoms. Yield reductions are thought to be negligible since the tomato plants harbored most fruit for that growing season. Terminal growth was halted, and no additional flower production was observed. No symptoms were observed on mature fruit; however, fruit set after leaf symptoms developed remained stunted. A representative sample of symptomatic tissue was submitted to an independent lab (Agdia, Inc., Elkhart, IN), screened for whitefly-transmitted geminiviruses, and the results were positive. Additional symptomatic tomato tissue was submitted to the University Diagnostics Lab, University of Florida, Gainesville, and was observed for viral inclusion bodies. This test was positive for TYLCV based on morphology of virus particles located in the nucleus of tomato cells (1). Total DNA was extracted from the symptomatic plants for polymerase chain reaction (PCR) assay (2). Results from the PCR assay indicated the presence of TYLCV in symptomatic tomato tissue. The strain of the virus was not determined. To our knowledge, this is the first report of TYLCV in Mississippi. References: (1) B. Pico et al. Sci. Hortic. 67:151, 1996. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) R. A. Valderde et al. Plant Dis. 85:230, 2001.