A large-scale field study of transgene flow from cultivated rice (Oryza sativa) to common wild rice (O. rufipogon) and barnyard grass (Echinochloa crusgalli).

The introgression of transgenes into wild relatives or weeds through pollen-mediated gene flow is a major concern in environmental risk assessment of transgenic crops. A large-scale (1.3-1.8 ha) rice gene flow study was conducted using transgenic rice containing the bar gene as a pollen donor and Oryza rufipogon as a recipient. There was a high frequency of transgene flow (11%-18%) at 0-1 m, with a steep decline with increasing distance to a detection limit of 0.01% by 250 m. To our knowledge, this is the highest frequency and longest distance of gene flow from transgenic rice to O. rufipogon reported so far. On the basis of these data, an adequate isolation distance from both conventional and transgenic rice should be taken for in situ conservation of common wild rice. Meanwhile, there is no evidence of transgene introgression into barnyard grass, even when it has coexisted with transgenic rice containing the bar gene for five successive years. Thus, the environmental risk of gene flow to this weedy species is of little concern.

Gene-splitting technology: a novel approach for the containment of transgene flow in Nicotiana tabacum.

The potential impact of transgene escape on the environment and food safety is a major concern to the scientists and public. This work aimed to assess the effect of intein-mediated gene splitting on containment of transgene flow. Two fusion genes, EPSPSn-In and Ic-EPSPSc, were constructed and integrated into N. tabacum, using Agrobacterium tumefaciens-mediated transformation. EPSPSn-In encodes the first 295 aa of the herbicide resistance gene 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS) fused with the first 123 aa of the Ssp DnaE intein (In), whereas Ic-EPSPSc encodes the 36 C-terminal aa of the Ssp DnaE intein (Ic) fused to the rest of EPSPS C terminus peptide sequences. Both EPSPSn-In and Ic-EPSPSc constructs were introduced into the same N. tabacum genome by genetic crossing. Hybrids displayed resistance to the herbicide N-(phosphonomethyl)-glycine (glyphosate). Western blot analysis of protein extracts from hybrid plants identified full-length EPSPS. Furthermore, all hybrid seeds germinated and grew normally on glyphosate selective medium. The 6-8 leaf hybrid plants showed tolerance of 2000 ppm glyphosate in field spraying. These results indicated that functional EPSPS protein was reassembled in vivo by intein-mediated trans-splicing in 100% of plants. In order to evaluate the effect of the gene splitting technique for containment of transgene flow, backcrossing experiments were carried out between hybrids, in which the foreign genes EPSPSn-In and Ic-EPSPSc were inserted into different chromosomes, and non-transgenic plants NC89. Among the 2812 backcrossing progeny, about 25% (664 plantlets) displayed glyphosate resistance. These data indicated that transgene flow could be reduced by 75%. Overall, our findings provide a new and highly effective approach for biological containment of transgene flow.

[Vascular-specific promoters and cis-regulatory elements].

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.