Metformin attenuates pressure overload-induced cardiac hypertrophy via AMPK activation.

AIM: To identify the role of metformin in cardiac hypertrophy and investigate the possible mechanism underlying this effect. METHODS: Wild type and AMPKα2 knockout (AMPKα2⁻/⁻) littermates were subjected to left ventricular pressure overload caused by transverse aortic constriction. After administration of metformin (200 mg·kg⁻¹·d⁻¹) for 6 weeks, the degree of cardiac hypertrophy was evaluated using echocardiography and anatomic and histological methods. The antihypertrophic mechanism of metformin was analyzed using Western blotting. RESULTS: Metformin significantly attenuated cardiac hypertrophy induced by pressure overload in wild type mice, but the antihypertrophic actions of metformin were ablated in AMPKα2⁻/⁻ mice. Furthermore, metformin suppressed the phosphorylation of Akt/protein kinase B (AKT) and mammalian target of rapamycin (mTOR) in response to pressure overload in wild type mice, but not in AMPKα2⁻/⁻ mice. CONCLUSION: Long-term administration of metformin may attenuate cardiac hypertrophy induced by pressure overload in nondiabetic mice, and this attenuation is highly dependent on AMPK activation. These findings may provide a potential therapy for patients at risk of developing pathological cardiac hypertrophy.

A distinct AMP-activated protein kinase phosphorylation site characterizes cardiac hypertrophy induced by L-thyroxine and angiotensin II.

1. The purpose of the present study was to evaluate differences in the AMP-activated protein kinase (AMPK) phosphorylation sites in cardiac hypertrophy induced by L-thyroxine and angiotensin (Ang) II. 2. Cardiac hypertrophy was induced in wild-type and AMPKalpha2-knockout mice by treatment with 1 mg/kg, i.p., thyroxine or 1.44 mg/kg per day AngII for 14 days. The phenotype of the hypertrophy was evaluated using echocardiographic measurements and histological analyses. The phosphorylation of AMPK at alpha-Ser(485/491) and alpha-Thr(172) was determined by western blot analysis. 3. In wild-type mice, the phosphorylation of AMPKalpha-Ser(485/491) was significantly elevated in the AngII-treated group, but not in the thyroxine-treated group, compared with the vehicle control group. In contrast, the phosphorylation of AMPKalpha-Thr(172) was significantly increased by thyroxine, but not AngII, treatment compared with the vehicle control group. Furthermore, knockout of the AMPKalpha2 subunit abolished phosphorylation at the alpha-Ser(485/491) site and significantly suppressed phosphorylation at the alpha-Thr(172) site, resulting in alleviation of thyroxine- but not AngII-induced hypertrophy. 4. In conclusion, L-thyroxine and AngII induce the phosphorylation of distinct sites of AMPK in cardiac hypertrophy. Phosphorylation of AMPK alpha-Thr(172) may contribute to thyroxine-induced cardiac hypertrophy.

[A case-control study of factors associated with primary angle-closure glaucoma].

OBJECTIVE: To understand the risk factors of primary angle-closure glaucoma. METHODS: One to one matched case-control study was conducted in this study. One hundred and ninety two PACG cases and 192 controls, matched by age and gender, were collected from Department of Ophthalmology, Affiliated Hospital of Nantong University. All of the participants were investigated for their demographic information, behavioral habits, disease history, glaucoma family history and received clinical ocular examinations. The difference between these two groups was analyzed. RESULTS: Several factors, including hypertension (OR = 2.004, P = 0.009), glaucoma family history (OR = 6.726, P = 0.003), presbyopia (OR = 3.192, P = 0.031), shallow anterior chamber (OR = 12.804, P = 0.000) and high cup-to-disc ratio (OR = 9.401, P = 0.007) were associated with PACG by multiply Logistic regression. The results did not support that smoking, drinking, myopia, diabetes mellitus and blood style were related to PACG. CONCLUSION: Follow up the populations with glaucoma family history, shallow anterior chamber or high cup-to-disc ratio are the main procedures for the decrease of incidence of PACG.

[Role of GATA-4 in cardiac development and remodeling].

GATA-4 plays important roles in the process of cardiac development and remodeling. Deletion or mutation of GATA-4 is associated with malformation of cardiac development directly, even embryolethality. Down-regulation of GATA-4 may lead to deterioration of cardiac function. GATA4 activity is significantly changed by pathological stimulation induced by pressure overload, hypoxia, sympathetic nerve activation, etc. It involves in the process of myocardium remodeling through regulating ANP, BNP, Bcl-2, CARP, etc. Overall, GATA-4 has important roles in the process of cardiac development and remodeling. Exploration of underlying mechanism of GATA4 transcriptional regulation may provide a new clue for the prevention and treatment of cardiovascular diseases.

[Construction of eukaryotic expression plasmids with paramyosin gene of periodic Brugia malayi].

Total RNA was extracted from periodic Brugia malayi Specific primers were designed on the basis of known sequences of paramyosin gene from B. malayi (BmPmy). The desired gene was amplified by PCR technique from cDNA. The PCR products were purified and cloned into plasmid pGEM-T by T-A cloning method, transformed into Escherichia coli (E. coli) strain DH5alpha. The recombinant plasmids were screened and identified by digestion with restriction enzyme and PCR amplification. The right gene fragments encoding BmPmy in positive clones for prokaryotic and eukaryotic expression plasmids were digested with restrictive endonuclease, and were subcloned into pcDNA3.1(+). The recombinant eukaryotic plasmid (pcDNA3.1-BmPmy) was then transfected into COS-7 cells. The transient expression of BmPmy was examined with RT-PCR. BmPmy mRNA was highly expressed in transfected COS-7 cells.

[High-risk behaviors related to AIDS/STDs infections among fishermen in Lü-si harbor, Jiangsu province].

OBJECTIVE: To investigate the high-risk behaviors related to acquired immune deficiency syndrome/sexually transmitted disease (AIDS/STDs) infection among fishermen in Lü-si harbor, Jiangsu province. METHODS: A cross-sectional study was designed to investigate the research participants' demographic characteristics, high-risk behaviors that related to AIDS/STDs. Logistic regression was performed to measure the associations between potential risk factors and reported potential high-risk sexual behavior. RESULTS: 817 fishermen participated in the study and casual or commercial sex activities appeared to be the main high-risk behavior for AIDS/STDs infection in the target population. The rates of casual and commercial sex reported were 18.1% and 28.9% among fishermen. Risk factors associated with AIDS/STDs related high-risk behaviors among fishermen were high mobility (OR = 1.516, P = 0.038), higher lifetime sex frequency (OR = 1.422, P = 0.002) and unmarried status (OR = 7.527, P = 0.014). Protective factors against high-risk behaviors were low intake of alcohol (OR = 0.803, P = 0.053), negative STD history (OR = 0.268, P = 0.001), age of initial sexual intercourse at or older than 22 years (OR = 0.440, P = 0.000) of age, as well as negative attitude toward multiple sexual partners (OR = 0.662, P = 0.023) and legitimation for commercial sex (OR = 0.612, P = 0.007). CONCLUSION: There were risk behaviors of AIDS/STDs in those infected fishmen. Casual and commercial sex were common high-risk behaviors.

[Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus].

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.