Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 26
Filtrar
1.
BMC Pediatr ; 23(1): 323, 2023 06 24.
Artigo em Inglês | MEDLINE | ID: mdl-37355569

RESUMO

BACKGROUND/AIMS: To investigate the clinical situation, treatment methods, and clinical predictors of surgical intervention in children with magnetic foreign bodies in the digestive tract. MATERIALS AND METHODS: From January 2019 to June 2022, we retrospectively analyzed the clinical data of 72 children who ingested magnetic foreign bodies inadvertently in our hospital, including their general information, admissions, clinical manifestations, and treatment methods, as well as pertinent literature and statistical data. Following software processing, univariate and multivariate logistic regression analyses were conducted to determine the independent risk factors of this study. RESULTS: In this study, 16 patients (22.2%) were discharged smoothly following conservative treatment and 19 patients (26.4%) were cured by gastroscopy. The remaining 37 patients (51.4%) were underwent surgery, in which 26 cases developed gastrointestinal perforation. There were statistical differences between surgery group and non- surgery group in the days of eating by mistake, clinical manifestations (nausea and vomiting, intermittent abdominal pain, abdominal muscle tension) and movement trajectory by every 24-h radiograph (P < 0.01). Logistic regression analysis showed that intermittent abdominal pain and abdominal muscle tension were independent risk factors for surgical treatment. CONCLUSION: Magnetic foreign bodies seriously endanger children's health. This study offers a single-center basis for the choice of surgical opportunity for intestinal obstruction or perforation caused by magnetic foreign bodies. Clinicians need immediate surgical intervention if the child shows symptoms of abdominal pain or abdominal tension.


Assuntos
Corpos Estranhos , Trato Gastrointestinal , Criança , Humanos , Estudos Retrospectivos , Dor Abdominal/etiologia , Corpos Estranhos/diagnóstico por imagem , Corpos Estranhos/cirurgia , Fenômenos Magnéticos
2.
BMC Gastroenterol ; 19(1): 70, 2019 May 09.
Artigo em Inglês | MEDLINE | ID: mdl-31072341

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication. CASE PRESENTATION: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases. CONCLUSIONS: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up.


Assuntos
Síndrome de Peutz-Jeghers/diagnóstico por imagem , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Quinases Proteína-Quinases Ativadas por AMP , Criança , Endoscopia Gastrointestinal , Humanos , Masculino , Mutação , Síndrome de Peutz-Jeghers/cirurgia , Conduta Expectante
3.
BMC Med Genet ; 19(1): 141, 2018 08 09.
Artigo em Inglês | MEDLINE | ID: mdl-30092773

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.


Assuntos
Mutação/genética , Neoplasias/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Transdução de Sinais/genética , Proteína Supressora de Tumor p53/genética , Quinases Proteína-Quinases Ativadas por AMP , Adolescente , Adulto , Criança , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Fenótipo , Adulto Jovem
4.
BMC Surg ; 18(1): 24, 2018 Apr 23.
Artigo em Inglês | MEDLINE | ID: mdl-29685139

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease characterized by gastrointestinal hamartomas, mucocutaneous pigmentation (MP), and increased cancer risk. Serine/threonine kinase 11 (STK11) is the only validated causative gene in PJS. Clinical observation reveals MP and intussusception in childhood are more frequent and severe than in adults. CASE PRESENTATION: We report here a girl without a positive family history, who grew oral and fingertip MP at her age of 2 and got abdomen dull pain from 7 years old. Endoscopy revealed no obvious polyps in the stomach or the colon until 10 years old, when she received enteroscopy. Tens of polyps were resected during enteroscopy, and pathological examination confirmed them hamartomas. A heterozygous deletion in STK11, c.471_472delCT, was detected in the proband but not in her parents, which is not recorded in databases. CONCLUSION: The mutation we reported here is a novel one and a de-novo one, so our results enlarge the spectrum of STK11. We speculate close and regular endoscopy especially enteroscopy is necessary for complication prevention when the former endoscopy discovers no polyps temporarily in a child of suspect PJS.


Assuntos
Síndrome de Peutz-Jeghers/genética , Pólipos , Proteínas Serina-Treonina Quinases/genética , Quinases Proteína-Quinases Ativadas por AMP , Povo Asiático , Criança , Feminino , Heterozigoto , Humanos , Intussuscepção/complicações , Mutação , Síndrome de Peutz-Jeghers/complicações
5.
BMC Med Genet ; 18(1): 130, 2017 11 15.
Artigo em Inglês | MEDLINE | ID: mdl-29141581

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.


Assuntos
Povo Asiático/genética , Neoplasias/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Quinases Proteína-Quinases Ativadas por AMP , Sequência de Aminoácidos , China , Éxons , Mutação da Fase de Leitura , Mutação em Linhagem Germinativa , Humanos , Masculino , Pessoa de Meia-Idade , Neoplasias/diagnóstico , Linhagem , Síndrome de Peutz-Jeghers/diagnóstico , Conformação Proteica , Fatores de Risco , Análise de Sequência de DNA
6.
Dig Dis Sci ; 62(11): 3014-3020, 2017 11.
Artigo em Inglês | MEDLINE | ID: mdl-28986664

RESUMO

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.


Assuntos
Biomarcadores Tumorais/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Deleção de Sequência , Quinases Proteína-Quinases Ativadas por AMP , Adulto , Povo Asiático/genética , Sequência de Bases , Biomarcadores Tumorais/química , Biomarcadores Tumorais/metabolismo , China , Análise Mutacional de DNA , Éxons , Feminino , Predisposição Genética para Doença , Hereditariedade , Heterozigoto , Humanos , Modelos Moleculares , Linhagem , Síndrome de Peutz-Jeghers/diagnóstico , Síndrome de Peutz-Jeghers/enzimologia , Síndrome de Peutz-Jeghers/etnologia , Fenótipo , Conformação Proteica , Proteínas Serina-Treonina Quinases/química , Proteínas Serina-Treonina Quinases/metabolismo , Relação Estrutura-Atividade
7.
Z Naturforsch C J Biosci ; 69(7-8): 283-90, 2014.
Artigo em Inglês | MEDLINE | ID: mdl-25265848

RESUMO

A series of annulated 7-membered oxazepine and 8-membered oxazocine derivatives were synthesized by photoreaction of phthalimide derivatives and an alkene. The antimicrobial activities of the synthesized compounds were evaluated, and compounds 18 and 20 exhibited best antibacterial activity against Gram-positive bacteria. The relationships between structure (especially steric structure) and antimicrobial activities are discussed.


Assuntos
Oxazepinas/síntese química , Oxazepinas/farmacologia , Oxazocinas/síntese química , Oxazocinas/farmacologia , Antibacterianos/síntese química , Antibacterianos/farmacologia , Testes de Sensibilidade Microbiana , Modelos Moleculares , Relação Estrutura-Atividade , Difração de Raios X
8.
World J Oncol ; 15(3): 414-422, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38751702

RESUMO

Background: This study assessed clinical outcomes of three-dimensional-printed template (3DPT)-guided radioactive seed brachytherapy (RSBT) via a submental approach for recurrent base of tongue and floor of mouth cancer. Methods: Thirty-one patients with recurrent lingual and floor of mouth squamous cell carcinoma after surgery and radiotherapy were treated with 3DPT-guided RSBT from 2015 to 2022. Seeds were implanted through a submental approach guided by 3DPTs. Local control (LC), overall survival (OS), disease control (DC) and quality of life (QOL) were evaluated. Results: The median follow-up was 13.7 months. The 1-, 3- and 5-year LC rates were 66.1%, 66.1%, and 55.1% respectively. The 1-, 3- and 5-year OS rates were 63.4%, 33.4%, and 8.3%. The 1-, 3- and 5-year DC rates were 37.8%, 26.5%, and 21.2%. Univariate analysis showed tumor size significantly affected LC (P = 0.031). The presence of extraterritorial lesions affected DC and OS on multivariate analysis (P < 0.01). QOL improved significantly in domains of pain, swallowing, chewing, taste, and emotion after treatment compared to baseline. Four patients (13%) developed necrosis and osteoradionecrosis. Conclusions: 3DPT-guided submental RSBT provided favorable LC and QOL for recurrent tongue/floor of mouth cancer with minimal toxicity; moreover, severe toxicity should be noted.

10.
Acta Crystallogr Sect E Struct Rep Online ; 69(Pt 3): o450, 2013 Mar 01.
Artigo em Inglês | MEDLINE | ID: mdl-23476618

RESUMO

There are two independent mol-ecules in the asymmetric unit of the title compound, C21H21N5O2. In each mol-ecule, the indolizine ring system is essentially planar, with r.m.s. deviations of 0.030 and 0.028 Å. The dihedral angles between the indolizine ring system and the pyrazole rings are 54.7 (3) and 8.6 (3)° in one mol-ecule and 54.4 (3) and 6.6 (3)° in the other. In the crystal, weak C-H⋯O and C-H⋯N hydrogen bonds link mol-ecules, forming a two-dimensional network parallel to (100).

11.
Cancer Invest ; 30(3): 236-42, 2012 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-22360363

RESUMO

Seventeen patients with head and neck recurrent carcinoma underwent (125)I seed implantation under CT or ultrasound guidance. The actuarial D90 of the (125)I seeds implanted was 90-160 Gy (median, 126 Gy). Median follow-up was 10 months (range, 3-48 months). The median local control time was 16 months; the 1- and 2-year local control rates were 66.5% and 49.9%, respectively. The 1- and 2-year survival rates were 51.3% and 38.5%, respectively (median, 16 months). None of the patients experienced grade 4 toxicity. (125)I seed implantation was a feasible and effective salvage treatment for patients with recurrent head and neck cancers.


Assuntos
Braquiterapia/métodos , Neoplasias de Cabeça e Pescoço/radioterapia , Radioisótopos do Iodo/uso terapêutico , Recidiva Local de Neoplasia/radioterapia , Terapia de Salvação , Adulto , Idoso , Idoso de 80 Anos ou mais , Feminino , Neoplasias de Cabeça e Pescoço/mortalidade , Humanos , Radioisótopos do Iodo/efeitos adversos , Masculino , Pessoa de Meia-Idade , Recidiva Local de Neoplasia/mortalidade , Radioterapia Guiada por Imagem , Taxa de Sobrevida
12.
Beijing Da Xue Xue Bao Yi Xue Ban ; 44(2): 291-4, 2012 Apr 18.
Artigo em Chinês | MEDLINE | ID: mdl-22517006

RESUMO

OBJECTIVE: To evaluate the efficacy and the technological feasibility of B-ultrasound guided implantation of (125)I seed for recurrent head and neck cancer. METHODS: In the study, 29 patients with local or regional recurrence of head and neck tumors after external beam radiotherapy alone, external beam radiotherapy combined neck dissection or chemotherapy were treated with (125)I seed implantation guided by ultrasound under local anesthesia. The median number of seeds was 27 (ranging from 3 to 61), and the radioactive activity ranged from 0.35-0.8 mCi(1.30×10(7) -2.96×10(7) Bq). Postoperative quality evaluations were routinely obtained for all the patients. RESULTS: The median follow-up was 8 months (ranging from 3 to 42 months). The 1-, 2- and 3-year local controls were 53.1%, 34.8%, and 17.4%, respectively. The 1-, 2- and 3-year survival rates were 54.1%, 27.5%, and 27.5%, respectively. CONCLUSION: Ultrasound guided implantation of (125)I seeds can play an important role in the salvage treatment of recurrence of head and neck cancer. This study shows B-ultrasound guided (125)I seed implantation is one of the most efficient brachytherapies, which is easy to operate, least invasive and safe for low morbidity.


Assuntos
Braquiterapia/métodos , Neoplasias de Cabeça e Pescoço/radioterapia , Radioisótopos do Iodo/administração & dosagem , Recidiva Local de Neoplasia/radioterapia , Adulto , Idoso , Idoso de 80 Anos ou mais , Carcinoma de Células Escamosas/diagnóstico por imagem , Carcinoma de Células Escamosas/radioterapia , Feminino , Neoplasias de Cabeça e Pescoço/diagnóstico por imagem , Humanos , Masculino , Pessoa de Meia-Idade , Recidiva Local de Neoplasia/diagnóstico por imagem , Radioterapia Guiada por Imagem/métodos , Ultrassonografia/métodos , Adulto Jovem
13.
Acta Crystallogr Sect E Struct Rep Online ; 67(Pt 11): o3033, 2011 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-22220045

RESUMO

The title compound, C(18)H(15)NO(3), consists of an indolizine ring system and an aromatic ring. The two ring systems are not coplanar, the dihedral angle between the two being 54.26 (7)°. In the crystal, inversion dimers are formed by weak C-H⋯O interactions. These dimeric groups are further extended to form a regular two-dimensional structure by additional weak C-H⋯O inter-actions.

14.
Transl Pediatr ; 10(12): 3237-3247, 2021 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-35070838

RESUMO

BACKGROUND: Circulating RNAs (Circ-RNAs) are tightly related to the processes of neuroblastoma. The circ-ACAP2 has been reported as dysregulated in various cancers; however, its biological roles and mechanisms in neuroblastoma remain largely unclear. METHODS: We collected 40 neuroblastoma tissues and adjacent noncancerous tissues. Quantitative reverse transcription polymerase chain reaction (qRT-RCR) or western blot were used to examine ACAP2, miR-143-3p, and HK2 abundances. Cell migration, invasion, glycolysis, and apoptosis were assessed via wound healing, transwell, glucose uptake and lactate, 3-(4,5-diamethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay, and flow cytometry. The association between circRNA, microRNA (miRNA), and messenger RNA (mRNA) was examined by dual-luciferase reporter analysis and RNA immunoprecipitation. RESULTS: The abundances of ACAP2 and HK2 were remarkedly increased in neuroblastoma tissues and cell lines. Silencing ACAP2 significantly constrained neuroblastoma cell migration, invasion, and glycolysis, and promoted apoptosis. Bioinformatics prediction, luciferase assay, and RNA pull-down assay consistently demonstrated that ACAP2 sponged miR-143-3p to downregulate its expression in neuroblastoma cells. Furthermore, we identified that hexokinase 2, a glycolysis key enzyme, was a direct target of miR-143-3p in neuroblastoma cells. Rescue of miR-143-3p in ACAP2-overexpressing cells effectively mitigated the influence of ACAP2 on neuroblastoma cell processes. CONCLUSIONS: Our study revealed biological roles and molecular mechanisms for circ-ACAP2 in the oncogenic characteristics of neuroblastoma, facilitating the development of circRNA-based treatment approaches for anti-brain tumor therapy.

15.
Orphanet J Rare Dis ; 16(1): 261, 2021 06 08.
Artigo em Inglês | MEDLINE | ID: mdl-34103092

RESUMO

OBJECTIVE: To report Peutz-Jeghers syndrome (PJS) cases with non-definitive clues in the family or personal history and finally diagnosed through pathological examination and STK11 gene mutation test. CLINICAL PRESENTATION AND INTERVENTION: PJS was suspected in 3 families with tortuous medical courses. Two of them had relatives departed due to polyposis or colon cancer without pathological results, and the other one had been diagnosed as hyperplastic polyposis before. Diagnosis of PJS was confirmed by endoscopy and repeated pathological examinations, and the STK11 mutation test finally confirmed the diagnosis at genetic level, during which 3 novel mutation were detected (536C > A, 373_374insA, 454_455insGGAGAAGCGTTTCCCAGTGTGCC). CONCLUSION: Early diagnosis of PJS is important and may be based on a family history with selective features among family members, and the pathological information is the key. The novel mutations also expand the STK11 variant spectrum.


Assuntos
Síndrome de Peutz-Jeghers , Diagnóstico Tardio , Família , Humanos
16.
World J Clin Cases ; 9(25): 7542-7550, 2021 Sep 06.
Artigo em Inglês | MEDLINE | ID: mdl-34616824

RESUMO

BACKGROUND: Congenital biliary atresia is a type of obstruction of the bile ducts inside and outside the liver, which can lead to cholestatic liver cirrhosis and eventually liver failure. The preduodenal portal vein (PD-PV) is a rare developmental malformation of the PV. The PV courses in front of the duodenum. However, very few cases of neonatal biliary atresia combined with PD-PV have been reported in the scientific literature. CASE SUMMARY: A 1-mo-and-4-d-old child was admitted to the hospital in January because of yellowish skin. After surgical consultation, surgical intervention was recommended. The child underwent Hilar-jejunal anastomosis, duodenal rhomboid anastomosis, and abdominal drainage under general anesthesia. During the operation, the PV was located at the anterior edge of the duodenum. CONCLUSION: Diagnoses: (1) Congenital biliary atresia; (2) PD-PV; and (3) Congenital cardiovascular malformations. Outcomes: Recommendation for liver transplantation. Lessons: The choice of treatment options for neonatal biliary atresia combined with PD-PV.

17.
Acta Crystallogr Sect E Struct Rep Online ; 67(Pt 1): o123, 2010 Dec 15.
Artigo em Inglês | MEDLINE | ID: mdl-21522634

RESUMO

The title compound, C(14)H(15)NO(4), was prepared by a 1,3-dipolar cyclo-addition from N-(eth-oxy-carbonyl-methy)pyridinium bromide and ethyl acrylate. The -CO(2) side chains form dihedral angles of 0.2 (3) and 2.4 (3)° with respect to the ring system. In the crystal, two neighbouring mol-ecules form a dimer through weak C-H⋯O interactions. The dimers form a three-dimensional structure via further weak C-H⋯O inter-actions.

18.
Int J Colorectal Dis ; 24(4): 391-9, 2009 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-19084969

RESUMO

PURPOSE: To assess the feasibility, efficacy, and morbidity of (125)I seeds interstitial permanent implant as salvage therapy for re-recurrent rectal cancer. METHODS AND MATERIALS: From September 2003 to October 2007, (125)I seeds implant procedures were performed under CT or ultrasound guidance for thirteen patients with locally re-recurrent rectal carcinoma. The minimal peripheral doses (MPD) of (125)I seeds implanted ranged from 120 to 160 Gy, with a median MPD of 140 Gy to total decay. Three patients also received two to four cycles of chemotherapy after seed implantation. RESULTS: After a median follow-up of 10 months (range 3-45), the pain-free interval was 0-14 months with a median of 7 months (95% CI: 3-11 months). The response rate of pain relief was 46.2% (6/13). Local control was 3-14 months with a median of 7 months (95% CI: 3.5-10.5 months). The 1- and 2-year local control rates were 14.4% and 0%, respectively. Three (23.1%) patients died of local recurrence; seven (53.8%) patients died of local recurrence and metastases; one (7.7%) patient died of metastases. Two (15.4%) patients survived to follow-up. At the time of analysis, the median survival was 10 months (95% CI: 3.9-16.1 months). The 1- and 2-year actuarial overall survival rates were 46.2% and 11.5%, respectively. Two (15.4%) patients experienced a grade 4 toxic event. Seed migration to the pelvic wall was observed in one (7.7%) patient. There was no associated neuropathy. CONCLUSION: (125)I seed implantation is feasible, effective, and safe as a salvage or palliative treatment for patients with re-recurrent rectal cancer.


Assuntos
Radioisótopos do Iodo/uso terapêutico , Recidiva Local de Neoplasia/tratamento farmacológico , Neoplasias Retais/terapia , Terapia de Salvação , Adulto , Idoso , Feminino , Humanos , Radioisótopos do Iodo/efeitos adversos , Masculino , Pessoa de Meia-Idade , Recidiva Local de Neoplasia/diagnóstico por imagem , Dor/tratamento farmacológico , Neoplasias Retais/diagnóstico por imagem , Análise de Sobrevida , Tomografia Computadorizada por Raios X , Resultado do Tratamento
19.
Acta Crystallogr Sect E Struct Rep Online ; 65(Pt 12): o3155, 2009 Nov 21.
Artigo em Inglês | MEDLINE | ID: mdl-21578873

RESUMO

The title compound, C(22)H(17)N(3)O(4), was prepared through 1,3-dipolar cyclo-addition: the dihedral angle between the benzimidazole and benzene rings is 80.93 (6)°. The crystal structure is stabilized by weak π-π inter-actions between the planar pyrrolobenzimidazole rings (r.m.s. deviation = 0.0293 Å) of neighbouring mol-ecules, forming chains along the c axis. The perpendicular distance is 3.47 (2) Šand the centroid-centroid distances are in the range of 3.590 (3)-3.944 (3) Å.

20.
Cancer Genet ; 230: 47-57, 2019 01.
Artigo em Inglês | MEDLINE | ID: mdl-30528796

RESUMO

BACKGROUND: The combination of direct sequencing and multiple ligation-dependent probe amplification (MLPA) has resulted in an 80% detection rate of serine/threonine kinase 11 (STK11) gene mutations in Peutz-Jeghers syndrome (PJS); however, this rate varies in different ethnicities. AIMS: To test the efficacy of the combination in Chinese patients with PJS. METHODS: PJS probands visiting our center during one year were enrolled. Sanger sequencing and MLPA were used to detect STK11 mutations. Associations between the occurrence of severe complications and risk factors were analyzed statistically. RESULTS: We identified 47 PJS probands. Among them, 34 received an STK11 mutation test, revealing 23 point mutations and 2 exonic deletions. Nine of the mutations were splicing errors, reflecting a significantly higher proportion (p < 0.05). Laparotomy history existed for 33 of the probands, and seven families had a history of cancer. Statistical analysis revealed no associations between the occurrence of severe complications or cancers and risk factors. CONCLUSION: The strategy achieved a high detection rate in Chinese people, validating its effectiveness. This cohort comprised a significantly higher proportion of splicing errors, reflecting the unique genetic characteristics Chinese people. No specific genotype-phenotype relationship was noted, while the wide usage of enteroscopy would benefit PJS surveillance.


Assuntos
Povo Asiático/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Splicing de RNA/genética , Quinases Proteína-Quinases Ativadas por AMP , Adolescente , Adulto , Criança , Pré-Escolar , Análise Mutacional de DNA , Éxons/genética , Feminino , Estudos de Associação Genética , Humanos , Masculino , Pessoa de Meia-Idade , Síndrome de Peutz-Jeghers/complicações , Mutação Puntual , Deleção de Sequência , Adulto Jovem
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA