[Determination of oligonucleotide molecular masses by MS-MALDI].

MALDI mass spectrometry (MS) of 14- to 42-mer homogeneous oligonucleotides and their mixtures was carried out using a Vision 2000 instrument (Thermo BioAnalysis, Finnigan, United States). Conditions for the determination of oligonucleotide molecular masses were optimized by applying various matrices and operation modes. The most reproducible results with minimal uncontrolled decomposition of the oligonucleotides including their apurinization during the MALDI MS registration were obtained using 2,4,6-trihydroxyacetophenone as a matrix instead of 3-hydroxypicolinic acid, usually employed in the mass spectrometry of oligonucleotides. Our approach allows the determination of molecular masses of oligonucleotides obtained by chemical synthesis and the evaluation of their component composition and purity. It was applied to the mass spectrometric analysis of oligonucleotides containing a 3'-(methyl-C-phosphonate) group or a modified 1,N6-ethenodeoxyadenosine unit.

New DNA diagnostic system for detection of factor V Leiden.

Use was made of allele-specific PCR to develop a highly effective DNA diagnostic system for detection of the factor V Leiden mutation in exon 10 of human factor V gene. The allele-specific primers contain a 3'-OH end nucleotide, which matches a mutant or wild-type nucleotide of the template DNA (A-allele and G-allele, respectively) and also one mismatched nucleotide near the 3'-end. The universal primers have an internal mismatch with the mutant nucleotide of the template DNA and another mismatched nucleotide at 3'-OH end. The A-allele-specific primer enables the preferential amplification of both the homozygous and heterozygous mutant alleles. The extension of the G-allele-specific primer or the universal one is inhibited in the presence of the homozygous factor V Leiden. The developed assay system allowed us to detect five patients, who are heterozygous for factor V Leiden among the 48 patients with deep venous thrombosis and pulmonary thromboembolism.

[Study of the integral antigen of the membranes of fatty globules of human milk]. / Izuchenie integral'nogo antigena membran zhirovykh globul zhenskogo moloka.

The glycoprotein with the molecular weight of 82,500 D (Ag3) was extracted from the native membranes of fatty globules of human milk and was purified by isoelectrofocusing. Polyclonal antisera (PCA) as well as monoclonal antibodies (MoAb)-ICO-21, ICO-22, ICO-26, ICO-29 against this membrane antigen were produced. The localization of the antigen in the human normal and malignant tissues was tested by the immunochemical technique. Apical staining of the Ag3 was in the acinus and duct cells of the normal breast. Weak staining with the antibodies to Ag3 was revealed in the epithelium cells of ovaries, bronchi, kidney tubules and uterine tubes. The far more pronounced staining of the Ag3 with PCA and MCA was observed in the cell cytoplasma both in the primary and metastatic breast and ovarian tumours. The specificity of the MoAb to Ags suggests that they will be useful in the diagnosis of the malignant disease of the breast and ovary.

[Construction of artificial genes by PCR methods using the synthetic template]. / Poluchenie nekotorykh iskusstvennykh genov metodom PTsR na sintetiche sko'i matritse.

Artificial genes were synthesized by the PCR method. Single-stranded DNA contained in an unpurified mixture of oligodeoxynucleotides after automated synthesis was used as a template. The features of this approach were studied.

[Relation between the level of E. coli gene expression and the structure of translation initiation region (TIR). III. Sites of complementary interaction of TIR with 16S rRNA]. / Zavisimost' urovnia ékspressii gena v E.coli ot struktury uchastka initsiatsii transliatsii (TIR) III. Saity komplementarnogo vzaimodeistviia TIR s 16S rRNK.

Potential sites of the complementary interaction of the translation initiation region (TIR) with 16S rRNA are revealed, and the role of these sites in the gene expression level is studied. The high expression level of a gene depends not only on the complementary interaction of TIR with 16S rRNA in sites proximal to the start codon [anti-Shine-Dalgarno (ASD) (delta G > -8 to -10 kcal/mol) and downstream box (DB)] and located at the -15 to +20 mRNA region but also on complementary interactions in distal sites of the untranslated branch of TIR (mTIR). Among them, the UB (upsteam box) 1 site, complementarily interacting with the exposed 452-490 segment of the 440-490 loop of 16S rRNA, may be located in the -15 to -50 mTIR segment. In the -50 to -70 mTIR segment may be located UB2 and UB3 sites, which interact with the exposed segment 478-488 of the 440-490 loop and segment 520-532 of the 520-540 loop of 16S rRNA, the UB3 site being much more efficacious. The high expression level requires that the total free energy of complementary interactions of UB1, UB2, and UB3 sites with 16S rRNA exceeds -20 kcal/mol.

[Cloning the repeat sequence of the oxytocin gene]. / Klonirovanie povtoriaiushcheisia posledovatel'nosti gena oksitotsina.

Cloning of a synthetic gene of the oxytocin trimer is accompanied by deletions, caused by nicks in the plasmid DNA. Use of covalently closed circular double-stranded DNA greatly reduces the number of the deletions.

[Dependence of the level of gene expression in E. coli on the structure of the translation initiation segment (TIR). I. Primary structure of TIR]. / Zavisimost' urovnia ékspressii gena v E. coli ot struktury uchastka initsiiatsii transliatsii (TIR). I. Pervichnaia struktura TIR.

The comparison of expression levels of two genes-interleukin-3 (il3) and epidermal growth factor connected to leader peptide of OmpF (lompegf)-was carried out using specially constructed plasmids contained various structures of translational enhancers. It was shown that besides already known binding sites from mRNA translation initiation region (TIR) to 16S rRNA (SD, UB1 and DB), there is additional binding site of TIR disposed from -30 to -60 nt upstream of start codon AUG (UB2) having significant increasing effect on translation initiation and correspondingly on expression level.

[New DNA diagnostic system for determination and identification of homo- and heterozygote point mutations]. / Novaia sistema DNK-diagnostiki, pozvoliaiushchaia obnaruzhit' i identifitsirovat' gomozigotnye i geterozigotnye tochkovye mutatsii.

A straightforward and effective PCR-based assay system is devised that allows one to reveal and identify homozygous and heterozygous point mutations. The system uses two sets of allele-specific primers. In one set, the 3'-nucleotide matches the allele under study so that the primer functions effectively only if the DNA contains the corresponding allele. To increase primer specificity, template-noncomplementary nucleotides are introduced near its 3'-end. The primers from another set invariably bear a 3'-terminal mismatch, and, in addition, the mutant nucleotides of the alleles under study form mismatches with the internal nucleotides of the primers. In such combination, the primer activity is suppressed if the DNA contains a homozygous mutation. The assay system devised was utilized to reveal the Leiden mutation in the gene for factor V of the human blood clotting system in patients with thrombophilia.

[The dependence of the E.coli gene expression level on the structure of the translation initiation region (TIR). IV. Distal complementary TIR interactions with the mRNA coding region]. / Zavisimost' urovnia ékspressii gena v E.coli ot struktury uchastka initsiatsii transliatsii (TIR). IV. Dal'nie komplementarnye vzaimodeistviia TIR s kodiruiushchei chast'iu mRNK.

To evaluate the effect on translation of distal regions of the encoding mRNA part capable of the complementary binding to the ribosome binding site (RBS), a series of plasmids were constructed containing fragments inserted into the il3 gene and determining secondary interactions in mRNA. A comparison of the levels of the in vivo gene expression showed that the complementary interactions of the translation initiation region (TIR) with distal regions of the mRNA encoding part affect translation. The effectiveness of these interactions decreased with an increase in the distance between the RBS and the complementary mRNA region, whereas the secondary structure formed by the TIR and the adjacent mRNA region was more stable despite the presence of regions in mRNA capable of forming energetically more favorable structures involving these elements.

[Structural-functional characteristics of the Schizosaccharomyces pombe rpb8+ gene, coding the subunit of RNA polymerase I-III, specific only for eukaryotes]. / Strukturno-funktsional'naia kharakteristika gena rpb8+ Schizosaccharomyces pombe, kodiruiushchego sub''edinitsu RNK-polimeraz I-III, specifichnuiu tol'ko dlia éukariot.

A full-length cDNA of the rpb8+ gene encoding a common subunit Rpb8 of nuclear RNA polymerases I-III only specific for Eucarya was isolated from an expression library of the fission yeast Schizosaccharomyces pombe. The primary structure of the corresponding fragment of the Sz. pombe genome was also established. The rpb8+ gene contains two short introns, 59 and 48 bp long. Only short segments of homology were found upon comparing the Rpb8 subunit homologs from various eukaryotic species, and substantial differences exist between the corresponding proteins of unicellular and multicellular organisms. Subunit Rpb8 of Sz. pombe proved to be the smallest one among the known related proteins: it lacks the 21-aa fragment corresponding to amino acids residues 68-88 of the central part of the homologous subunit ABC14.5 of Saccharomyces cerevisiae. Accordingly, subunit Rpb8 of the fission yeast was not capable of substituting in vivo subunit ABC14.5 in nuclear RNA polymerases of the baker's yeast.

[Recombinant proteins containing amino acid sequences of two ectatomin chains]. / Rekombinantnye belki, soderzhashchie aminokislotnye posledovatel'nosti dvukh tsepei éktatomina.

Artificial genes for chains A and B of ectatomin, an Ectatomma tuberculatum ant toxin, were obtained by chemical and enzymic synthesis and cloned into new plasmid vectors. Expression plasmids with the genes of hybrid proteins were constructed containing human interleukin-3 or its terminal 63-mer fragment as well as chains A and B of ectatomin, which are linked via a region containing the cleavage site of specific protease, enterokinase (hybrid proteins IL3ETOXA, IL3ETOXB, ILETOXA, and ILETOXB). Escherichia coli producer strains providing a high yield of IL3ETOXA and IL3ETOXB proteins as inclusion bodies were obtained.

[Recombinant proteins containing oxytocin oligomeric sequences]. / Rekombinantnye belki, soderzhashchie oligomernye posledovatel'nosti oksitotsina.

Expression plasmids were constructed with genes encoding the ILOX3, ILOX6, and ILOX9 recombinant proteins, which contain the C-terminal fragments of trimer, hexamer, or nonamer of oxytocinoyl-Lys. Upon expression in E. coli, all three genes yielded inclusion bodies containing protein products of similar length and heterogeneous in the C-terminal region. It is likely that in the case of the ilox3 gene, the obtained protein mixture includes the full-length product of translation with the C-terminal lysine. In the case of the ilox6 and ilox9 genes, the protein products are formed as the result of a site-specific proteolysis in the regions between the second and the fourth oxytocin units.

[New allele-specific primers for detection of Leiden mutation in exon 10 of factor V gene in thrombophilias]. / Novye allel'-spetsificheskie praimery dlia obnaruzheniia mutatsii Leiden v ékzone 10 gena faktora V pri trombofiliiakh.

New allele-specific primers were developed which enable the facile and effective identification of the Leiden mutation in the human genome using PCR. One of the primers (allele-nonspecific), which is complementary to the nucleotide sequence of the intron 10 sense strand, [(5')TCTCTTGAAGGAAATGCCCCATTA], was described by B. Dahlback in 1994. Two other primers (allele-specific), (5')TAAGAGCAGATCCCTGGACAGCCA and (5')TAAGAGCAGATCCCTGGACACGCA), contained a 3'-terminal nucleotide corresponding to the nucleotide of the mutant allele, as well as a nucleotide noncomplementary to the template DNA near the 3'-end (shown by boldface type). When used in combination with allele-nonspecific primers, both allele-specific primers were equally effective in detecting the Leiden mutation in the human factor V gene. Using these primers, two Leiden mutations in the heterozygous state were found in 20 patients with deep vein thromboses and pulmonary thromboembolia.

[Detection of antibodies neutralizing the endotoxins of gram-negative bacteria using the liposomal potentiometric method]. / Vyiavlenie antitel, neitralizuiushchikh éndotoksiny gramotritsatel'nykh bakterii, liposomal'nym potentsiometricheskim metodom.

For the first time the study of the indicator system consisting of sensitized liposomes with NaF incorporated as a marker and a fluorine-selective electrode has been made and, as a result, the possibility of the potentiometric determination of the immune lysis of liposomes in the presence of complement and specific antibodies has been demonstrated. The dissolution of the lipid components (Re-chemotype glycolipid and lipid A) in the bilayer matrix obviates the necessity for converting lipid antigens into the water-soluble state in the process of serological tests. As compared with other methods, the liposomal potentiometric method for the determination of Re-chemotype glycolipid and lipid A is highly sensitive (20-40 ng/ml), rapid, technically easy to perform, cheap and does not require large volumes of samples. The disadvantages of this analytical system are the instability of liposomes and the diffusion of fluorine ions from the internal aqueous phase of vesicules. For this reason the immunoassay can be made only within 12 hours after the preparation of sensitized liposomes incorporating the marker.

[Isolation of membrane antigens of mammary gland epithelial cells from membranes of human milk fat globules]. / Vydelenie membrannykh antigenov épitelial'nykh kletok molochnoi zhelezy iz membran zhirovykh globul zhenskogo moloka.

Seven antigens, belonging to various structures of bilayer: ArI (lactoferrin) and Ar5 (alpha-lactalbumin) - adsorbed proteins; Ar2 and Ar14 - peripheric components; Ar3, Ar4 and Ar13 - integral structures, were found after treatment of fatty globule membranes from human milk using the agents with improved extracting activity (isotonic solution, 1 M MgCl2, 1% Triton X-100, combined effect of 1% Triton X-100 and sonication). The procedure developed enabled to separate these antigens and to isolate them from the main milk secretory proteins lactoferrin and alpha-lactalbumin. Towards highly purified preparations of the membrane antigens 3 and 4 monospecific antisera were raised, which allowed to identify these components among tissue-specific antigens of mammary gland capable to be maintained in malignization of the tissue. Ar4 was also found in tumoral tissues of ovary, lung and stomach.

A convenient approach to the synthesis of trinucleotide phosphoramidites--synthons for the generation of oligonucleotide/peptide libraries.

Trinucleotide phosphoramidites that correspond to the codons of all 20 amino acids were synthesized in high yield in 5g scale. Precursors of those amidites--trinucleotide phosphotriesters--have been prepared using the phosphotriester approach without protection of the 3'-hydroxyl function. The structures of trinucleotide phosphotriesters and intermediates were confirmed by 1H- and 31P-NMR spectra, mass-spectra and by analysis of SPDE-hydrolysates of deprotected preparations. Purity of the target products has been confirmed by test reactions. The synthons have been used for automated synthesis of oligonucleotides and corresponding libraries by a phosphite-triester approach. A 54mer, containing 12 randomized internal bases, and a 72mer with 24 internal randomized bases have been synthesized.