Salivary factor LTRIN from Aedes aegypti facilitates the transmission of Zika virus by interfering with the lymphotoxin-ß receptor.

Pathogens have co-evolved with mosquitoes to optimize transmission to hosts. Mosquito salivary-gland extract is known to modulate host immune responses and facilitate pathogen transmission, but the underlying molecular mechanisms of this have remained unknown. In this study, we identified and characterized a prominent 15-kilodalton protein, LTRIN, obtained from the salivary glands of the mosquito Aedes aegypti. LTRIN expression was upregulated in blood-fed mosquitoes, and LTRIN facilitated the transmission of Zika virus (ZIKV) and exacerbated its pathogenicity by interfering with signaling through the lymphotoxin-ß receptor (LTßR). Mechanically, LTRIN bound to LTßR and 'preferentially' inhibited signaling via the transcription factor NF-κB and the production of inflammatory cytokines by interfering with the dimerization of LTßR during infection with ZIKV. Furthermore, treatment with antibody to LTRIN inhibited mosquito-mediated infection with ZIKV, and abolishing LTßR potentiated the infectivity of ZIKV both in vitro and in vivo. This study provides deeper insight into the transmission of mosquito-borne diseases in nature and supports the therapeutic potential of inhibiting the action of LTRIN to disrupt ZIKV transmission.

Local F-actin network links synapse formation and axon branching.

Axonal branching and synapse formation are tightly linked developmental events during the establishment of synaptic circuits. Newly formed synapses promote branch initiation and stability. However, little is known about molecular mechanisms that link these two processes. Here, we show that local assembly of an F-actin cytoskeleton at nascent presynaptic sites initiates both synapse formation and axon branching. We further find that assembly of the F-actin network requires a direct interaction between the synaptic cell adhesion molecule SYG-1 and a key regulator of actin cytoskeleton, the WVE-1/WAVE regulatory complex (WRC). SYG-1 cytoplasmic tail binds to the WRC using a consensus WRC interacting receptor sequence (WIRS). WRC mutants or mutating the SYG-1 WIRS motif leads to loss of local F-actin, synaptic material, and axonal branches. Together, these data suggest that synaptic adhesion molecules, which serve as a necessary component for both synaptogenesis and axonal branch formation, directly regulate subcellular actin cytoskeletal organization.

Aberrant splicing of CaV1.2 calcium channel induced by decreased Rbfox1 enhances arterial constriction during diabetic hyperglycemia.

Diabetic hyperglycemia induces dysfunctions of arterial smooth muscle, leading to diabetic vascular complications. The CaV1.2 calcium channel is one primary pathway for Ca2+ influx, which initiates vasoconstriction. However, the long-term regulation mechanism(s) for vascular CaV1.2 functions under hyperglycemic condition remains unknown. Here, Sprague-Dawley rats fed with high-fat diet in combination with low dose streptozotocin and Goto-Kakizaki (GK) rats were used as diabetic models. Isolated mesenteric arteries (MAs) and vascular smooth muscle cells (VSMCs) from rat models were used to assess K+-induced arterial constriction and CaV1.2 channel functions using vascular myograph and whole-cell patch clamp, respectively. K+-induced vasoconstriction is persistently enhanced in the MAs from diabetic rats, and CaV1.2 alternative spliced exon 9* is increased, while exon 33 is decreased in rat diabetic arteries. Furthermore, CaV1.2 channels exhibit hyperpolarized current-voltage and activation curve in VSMCs from diabetic rats, which facilitates the channel function. Unexpectedly, the application of glycated serum (GS), mimicking advanced glycation end-products (AGEs), but not glucose, downregulates the expression of the splicing factor Rbfox1 in VSMCs. Moreover, GS application or Rbfox1 knockdown dynamically regulates alternative exons 9* and 33, leading to facilitated functions of CaV1.2 channels in VSMCs and MAs. Notably, GS increases K+-induced intracellular calcium concentration of VSMCs and the vasoconstriction of MAs. These results reveal that AGEs, not glucose, long-termly regulates CaV1.2 alternative splicing events by decreasing Rbfox1 expression, thereby enhancing channel functions and increasing vasoconstriction under diabetic hyperglycemia. This study identifies the specific molecular mechanism for enhanced vasoconstriction under hyperglycemia, providing a potential target for managing diabetic vascular complications.

IGF2BP3 suppresses ferroptosis in lung adenocarcinoma by m6A-dependent regulation of TFAP2A to transcriptionally activate SLC7A11/GPX4.

Ferroptosis is recently discovered as an important player in the initiation, proliferation, and progression of human tumors. Insulin-like growth factor 2 mRNA-binding protein 3 (IGF2BP3) has been reported as an oncogene in multiple types of cancers, including lung adenocarcinoma (LUAD). However, little research has been designed to investigate the regulation of IGF2BP3 on ferroptosis in LUAD. qRT-PCR and western blot were used to measure the mRNA and protein expression of IGF2BP3 and transcription factor AP-2 alpha (TFAP2A). CCK-8 assay was performed to determine cell viability. DCFH-DA and C11-BODIPY staining were used to detect the levels of intracellular reactive oxygen species (ROS) and lipid ROS. The corresponding assay kits were used to analyze the levels of malondialdehyde (MDA) and glutathione (GSH). SRAMP website and m6A RNA immunoprecipitation (Me-RIP) were used to predict and confirm the m6A modification of TFAP2A. RIP experiments were conducted to confirm the binding of IGF2BP3 and TFAP2A. RNA stability assay was performed using actinomycin D. Chromatin immunoprecipitation (ChIP) and dual-luciferase reporter experiments were performed to confirm the interaction between TFAP2A and cystine/glutamate antiporter solute carrier family 7 member 11 (SLC7A11) or glutathione peroxidase 4 (GPX4). Mice xenotransplant model was also constructed to explore the effect of IGF2BP3 on LUAD tumor growth and ferroptosis. IGF2BP3 and TFAP2A were both highly expressed in LUAD. IGF2BP3 or TFAP2A knockdown induced ferroptosis by aggravating erastin-induced cell viability suppression, increasing the production of intracellular ROS, lipid ROS, and MDA, and decreasing GSH synthesis, GSH/GSSG ratio, and cystine uptake. Mechanistically, IGF2BP3 stabilized TFAP2A expression via m6A modification. Moreover, sh-IGF2BP3-mediated ferroptosis was significantly abated by TFAP2A overexpression. Furthermore, TFAP2A binds to the promoters of SLC7A11 and GPX4 to promote their transcription. Also, IGF2BP3 depletion suppressed LUAD tumor growth by inducing ferroptosis in mice. IGF2BP3 suppresses ferroptosis in LUAD by m6A-dependent regulation of TFAP2A to promote the transcription of SLC7A11 and GPX4. Our findings suggest that targeting IGF2BP3/TFAP2A/SLC7A11/GPX4 axis might be a potential therapeutic choice to increase ferroptosis sensitivity in LUAD.

Investigation of a novel biofilm model close to the original oral microbiome.

A more optimized culture medium used in vitro to mimic the bacterial composition of original oral flora as similar as possible remains difficult at present, and the goal of this study is to develop a novel oral biofilm medium to restore the original oral microbiome. Firstly, we conducted a systematic literature review by searching PubMed and summarized the current reported culture media in vitro. Seven culture media were found. We used mixed saliva as the origin of oral species to compare the effects of the above media in culturing oral multispecies biofilms. Results indicated that among the seven media brain heart infusion containing 1% sucrose (BHIs) medium, PG medium, artificial saliva (AS) medium, and SHI medium could obviously gain large oral biofilm in vitro. The nutrients contained in different culture media may be suitable for the growth of different oral bacteria; therefore, we optimized several novel media accordingly. Notably, results of crystal violet staining showed that the biofilm cultured in our modified artificial saliva (MAS) medium had the highest amount of biofilm biomass. 16S rRNA gene sequencing showed that the operational taxonomic units (OTUs) and Shannon index of biofilm cultured in MAS medium were also the highest among all the tested media. More importantly, the 16S rRNA gene sequencing analysis indicated that the biofilm cultured in MAS medium was closer to the original saliva species. Besides, biofilm cultured by MAS was denser and produced more exopolysaccharides. MAS supported stable biofilm formation on different substrata. In conclusion, this study demonstrated a novel MAS medium that could culture oral biofilm in vitro closer to the original oral microbiome, showing a good application prospect. KEY POINTS: • We compare the effects of different media in culturing oral biofilms • A novel modified artificial saliva (MAS) medium was obtained in our study • The MAS medium could culture biofilm that was closer to oral microbiome.

Integrated metabolomic and transcriptomic analysis of triterpenoid accumulation in the roots of Codonopsis pilosula var. modesta (Nannf.) L.T.Shen at different altitudes.

INTRODUCTION: Codonopsis Radix is a beneficial traditional Chinese medicine, and triterpenoid are the major bioactive constituents. Codonopsis pilosula var. modesta (Nannf.) L.T.Shen (CPM) is a precious variety of Codonopsis Radix, which is distributed at high mountain areas. The environment plays an important role in the synthesis and metabolism of active ingredients in medicinal plants, but there is no report elaborating on the effect of altitude on terpenoid metabolites accumulation in CPM. OBJECTIVES: This study aims to analyse the effects of altitude on triterpenoid biosynthetic pathways and secondary metabolite accumulation in CPM. MATERIAL AND METHODS: The untargeted metabolomics based on liquid chromatography-tandem mass spectrometry (LC-MS/MS) and 10 triterpenoids based on ultra-performance liquid chromatography quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF-MS) method were analysed at the low-altitude (1480 m) and high-altitude (2300 m) CPM fresh roots. The transcriptome based on high-throughput sequencing technology were combined to analyse the different altitude CPM triterpenoid biosynthetic pathways. RESULTS: A total of 17,351 differentially expressed genes (DEGs) and 55 differentially accumulated metabolites (DAMs) were detected from the different altitude CPM, and there are significant differences in the content of the 10 triterpenoids. The results of transcriptome study showed that CPM could significantly up-regulate the gene expression levels of seven key enzymes in the triterpenoid biosynthetic pathway. CONCLUSIONS: The CPM at high altitude is more likely to accumulate triterpenes than those at low altitude, which was related to the up-regulation of the gene expression levels of seven key enzymes. These results expand our understanding of how altitude affects plant metabolite biosynthesis.

Exploring ways to improve China's ecological well-being amidst air pollution challenges using mixed methods.

Ecological well-being performance (EWP), a novel concept in sustainable development research, diverges from traditional ecological efficiency in terms of perspectives, core content, and driving factors. However, research on EWP remains insufficiently comprehensive, particularly the corresponding theoretical and methodological investigations into driving pathways. To address this gap, this study develops an "economy-environment-health" framework, incorporating air pollution and associated health losses into the evaluation system, and employs a two-stage Super-NSBM and Window DEA model for reevaluating EWP. The study further investigates the primary pathways of EWP, focusing on environmental regulations, technological innovation, and structural adjustments through both quantitative and qualitative methods. Quantitative spatial econometric analysis reveals that factors such as market-driven environmental regulations, green invention patents, and industrial and energy consumption structures significantly enhance EWP. While examining the "net effects" contributions of individual variables using spatial econometric models, the fsQCA method is employed to identify four effective driving paths for EWP from a configurational perspective. These paths are 1) technological innovation and structural adjustment under environmental regulations with public participation; 2) a combination of environmental regulation, technological innovation, and structural adjustment; 3) structural adjustment with minimal influence from environmental regulations and technological innovation; and 4) structural adjustment directed by market-incentive environmental regulations.

Dysregulated Rbfox2 produces aberrant splicing of CaV1.2 calcium channel in diabetes-induced cardiac hypertrophy.

BACKGROUND: L-type Ca2+ channel CaV1.2 is essential for cardiomyocyte excitation, contraction and gene transcription in the heart, and abnormal functions of cardiac CaV1.2 channels are presented in diabetic cardiomyopathy. However, the underlying mechanisms are largely unclear. The functions of CaV1.2 channels are subtly modulated by splicing factor-mediated alternative splicing (AS), but whether and how CaV1.2 channels are alternatively spliced in diabetic heart remains unknown. METHODS: Diabetic rat models were established by using high-fat diet in combination with low dose streptozotocin. Cardiac function and morphology were assessed by echocardiography and HE staining, respectively. Isolated neonatal rat ventricular myocytes (NRVMs) were used as a cell-based model. Cardiac CaV1.2 channel functions were measured by whole-cell patch clamp, and intracellular Ca2+ concentration was monitored by using Fluo-4 AM. RESULTS: We find that diabetic rats develop diastolic dysfunction and cardiac hypertrophy accompanied by an increased CaV1.2 channel with alternative exon 9* (CaV1.2E9*), but unchanged that with alternative exon 8/8a or exon 33. The splicing factor Rbfox2 expression is also increased in diabetic heart, presumably because of dominate-negative (DN) isoform. Unexpectedly, high glucose cannot induce the aberrant expressions of CaV1.2 exon 9* and Rbfox2. But glycated serum (GS), the mimic of advanced glycation end-products (AGEs), upregulates CaV1.2E9* channels proportion and downregulates Rbfox2 expression in NRVMs. By whole-cell patch clamp, we find GS application hyperpolarizes the current-voltage curve and window currents of cardiac CaV1.2 channels. Moreover, GS treatment raises K+-triggered intracellular Ca2+ concentration ([Ca2+]i), enlarges cell surface area of NRVMs and induces hypertrophic genes transcription. Consistently, siRNA-mediated knockdown of Rbfox2 in NRVMs upregulates CaV1.2E9* channel, shifts CaV1.2 window currents to hyperpolarization, increases [Ca2+]i and induces cardiomyocyte hypertrophy. CONCLUSIONS: AGEs, not glucose, dysregulates Rbfox2 which thereby increases CaV1.2E9* channels and hyperpolarizes channel window currents. These make the channels open at greater negative potentials and lead to increased [Ca2+]i in cardiomyocytes, and finally induce cardiomyocyte hypertrophy in diabetes. Our work elucidates the underlying mechanisms for CaV1.2 channel regulation in diabetic heart, and targeting Rbfox2 to reset the aberrantly spliced CaV1.2 channel might be a promising therapeutic approach in diabetes-induced cardiac hypertrophy.

Surface Hydrogen Bond-Induced Oxygen Vacancies of TiO2 for Two-Electron Molecular Oxygen Activation and Efficient NO Oxidation.

Defect engineering can provide a feasible approach to achieving ambient molecular oxygen activation. However, conventional surface defects (e.g., oxygen vacancies, OVs), featured with the coordinatively unsaturated metal sites, often favor the reduction of O2 to •O2- rather than O22- via two-electron transfer, hindering the efficient pollutant removal with high electron utilization. Herein, we demonstrate that this bottleneck can be well discharged by modulating the electronic structure of OVs via phosphorization. As a proof of concept, TiO2 nanoparticles are adopted as a model material for NaH2PO2 (HP) modification, in which HP induces the formation of OVs via weakening the Ti-O bonds through the hydrogen bond interactions. Additionally, the formed Ti-O-P covalent bond refines the electronic structure of OVs, which enables rapid electron transfer for two-electron molecular oxygen activation. As exemplified by NO oxidation, HP-modified TiO2 with abundant OVs achieved complete NO removal with high selectivity for benign nitrate, superior to that of pristine TiO2. This study highlights a promising approach to regulate the O2 activation via an electronic structure modulation and provides fresh insights into the rational design of a photocatalyst for environmental remediation.

Parallel RNA and DNA analysis after deep sequencing (PRDD-seq) reveals cell type-specific lineage patterns in human brain.

Elucidating the lineage relationships among different cell types is key to understanding human brain development. Here we developed parallel RNA and DNA analysis after deep sequencing (PRDD-seq), which combines RNA analysis of neuronal cell types with analysis of nested spontaneous DNA somatic mutations as cell lineage markers, identified from joint analysis of single-cell and bulk DNA sequencing by single-cell MosaicHunter (scMH). PRDD-seq enables simultaneous reconstruction of neuronal cell type, cell lineage, and sequential neuronal formation ("birthdate") in postmortem human cerebral cortex. Analysis of two human brains showed remarkable quantitative details that relate mutation mosaic frequency to clonal patterns, confirming an early divergence of precursors for excitatory and inhibitory neurons, and an "inside-out" layer formation of excitatory neurons as seen in other species. In addition our analysis allows an estimate of excitatory neuron-restricted precursors (about 10) that generate the excitatory neurons within a cortical column. Inhibitory neurons showed complex, subtype-specific patterns of neurogenesis, including some patterns of development conserved relative to mouse, but also some aspects of primate cortical interneuron development not seen in mouse. PRDD-seq can be broadly applied to characterize cell identity and lineage from diverse archival samples with single-cell resolution and in potentially any developmental or disease condition.

Occurrence of the Reniform Nematode Rotylenchulus reniformis on Sponge Gourd (Luffa cylindrica) in Yunnan Province, China.

Sponge gourd (Luffa cylindrica) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes (Rotylenchulus) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 µm (352.8 to 436.7 µm), stylet = 18.6 ± 0.5 µm (17.6 to 19.4 µm), tail length= 25.9 ± 2.2 µm (20.1 to 29.9 µm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 µm (368.1 to 463.9 µm), stylet = 12.8 ± 0.8 µm (11.2 to 14.1 µm), tail length= 26.3 ± 1.8 µm (24.3 to 29.4 µm), spicule = 20.6 ± 0.9 µm (19.6 to 22.7 µm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for R. reniformis (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) and D2-D3 region of the 28S rRNA gene sequence (787 bp, MT328542) showed more than 99% identity with several R. reniformis sequences deposited in the GenBank database (e.g., MT209977, KP018557, GU003947; KJ755184, MT225542, HM131858). In greenhouse pathogenicity tests, 12 two-leaf stage sponge gourd seedlings (cv. Zaoxiu 6) maintained in 14-cm-diameter and 12-cm-height pots with sterilized commercial soil (pH 5.5-7.0; organic matter 35%), were inoculated with 500 mixed vermiform stage nematodes of R. reniformis extracted from the infested field soil samples per plant. Eight non-inoculated seedlings were used as controls. After 60 days, all inoculated plants exhibited slight symptoms of root browning compared with the control. The nematode reproduction factor (final population/initial population) was 12.4. No nematodes and root browning were observed on control plants. R. reniformis has been reported on sponge gourd in Shanghai, Fujian, Guangdong, and Hainan provinces of China (Ding et al., 2015). To our knowledge, this is the first report of R. reniformis infecting sponge gourd in Yunnan Province, China. Yunnan Province is one of the biggest sponge gourd producing areas in China. Since R. reniformis is a highly pathogenic nematode and damages sponge gourd, control measures should be taken to avoid its spread to other regions or host crops in China.

First Report of Fusarium verticillioides causing Stem Blight of Schizonepeta tenuifolia in China.

Schizonepeta tenuifolia is an important medicinal plant in China. Over 10000 ha of S. tenuifolia is cultivated in the country annually. However, fungal diseases are a major limiting factor in S. tenuifolia production. In 2022, 50 ha in several S. tenuifolia fields in Hebei province were observed to be severely affected by a disease causing a yield loss of 30%. Results from field surveys suggested an epidemic during seedlings stages that affected S. tenuifolia stems, causing irregularly watery brown lesions. Lesions ranged from 1.5 to 2 × 2.5 to 3 cm. To isolate the causal agent, tissue was removed from the border of lesions and surface sterilized in 75% ethanol for 30 sec and 0.1% HgCl2 for 1 min, then rinsed three times with steriled distilled water(SDW), plated on potato dextrose agar(PDA) at 25℃, and incubated in the dark for 7 days. Five putative isolates of the genus Fusarium were hyphal-tipped on new PDA plates. Isolates were cultured on synthetic low-nutrient agar(SNA) with a ~ 1 × 2-cm strip of sterile filter paper on the agar surface(Nirenberg 1976). Cultures were incubated for 7 to 10 days at 20℃ in dark conditions. When sporulation was observed, agar blocks were mounted on a microscopic slide with a drop of lactophenol cotton blue and examined at 400×. Colonies grew rapidly with abundant pink to violet aerial hyphae. Sporodochia formed on the agar, and the aerial conidiophores branched sparsely, often alternately or oppositely, terminating with up to three verticillate phialides. Microconidia produced on polyphialides and aggregating in heads were unicellular, ovoidal or ellipsoidal, 4.4 to 17 × 1.5 to 4.5 µm. Macroconidia were abundant, falcate to straight, three to five septate, with a distinct foot cell, 27 to 73 × 3.1 to 5.6 µm. Based on morphological characteristics, isolates were tentatively identified as F. verticillioides(A1-Hatmi et al. 2016; Guarro 2013). Pathogenicity tests were performed by injection inoculation of 0.1 mL of conidial suspensions(1×106 conidia/mL) into three S. tenuifolia stems using a disposable needle and syringe. Distilled water was injected into three mock controls. Inoculated plants were placed in a greenhouse at 32 to 34℃ and 95% relative humidity. Typical lesions were observed 7 days after inoculation, except in the control samples. Each treatment was replicated three times. The suspected pathogen was consistently reisolated from diseased tissue according to Koch's postulates, and was found to be morphologically similar to F. verticillioides. Preliminary morphological identification of the pathogen was further confirmed by using genomic DNA extracted from the mycelia of a 7-day-old culture grown on PDA at 25℃. The translation elongation factor 1-α gene(TEF1) was amplified(O'Donnell et al. 1998) and the TEF region(Genbank Accession No. OR105502) was sequenced by Sangon Biotech Co., Ltd.(Shanghai, China) and displayed 100% nucleotide similarity with rDNA-TEF of F. verticillioides(JF740717) separately after a BLASTn search in Genbank. Based on the symptoms, fungal morphology, TEF sequence, and pathogenicity testing, this fungus was identified as F. verticillioides. to our knowledge, this is the first report of F. verticillioides infecting S. tenuifolia in China. This report will promote further research of F. verticillioides on this host and lead to better understanding of disease prevalence, extent of damage, and possible management options.

New insight into scale inhibition during tea brewing: Ca2+/Mg2+ complexing and alkalinity consumption.

Scale not only affects the taste and color of water, but also increases the risks of osteoporosis and cardiovascular diseases associated with drinking it. As a popular beverage, tea is rich many substances that have considerable potential for scale inhibition, including protein, tea polyphenols and organic acids. In this study, the effect of tea brewing on scale formation was explored. It was found that the proteins, catechins and organic acids in tea leaves could be released when the green tea was brewed in water with sufficient hardness and alkalinity. The tea-released protein was able to provide carboxyl groups to chelate with calcium ions (Ca2+), preventing the Ca2+ from reacting with the carbonate ions (CO32-). The B rings of catechins were another important structure in the complexation of Ca2+ and magnesium ions (Mg2+). The carboxyl and hydroxyl groups on the organic acids was able to form five-membered chelating rings with Ca2+ and Mg2+, resulting in a significant decrease in Ca2+ from 100.0 to 60.0 mg/L. Additionally, the hydrogen ions (H+) provided by the organic acids consumed and decreased the alkalinity of the water from 250.0 to 131.4 mg/L, leading to a remarkable reduction in pH from 8.93 to 7.73. It further prevented the bicarbonate (HCO3-) from producing CO32- when the water was heated. The reaction of the tea constituents with the hardness and alkalinity inhibited the formation of scale, leading to a significant decrease in turbidity from 10.6 to 1.4 NTU. Overall, this study provides information to help build towards an understanding of the scale inhibition properties of tea and the prospects of tea for anti-scaling in industrial applications.

Hydroxyl Radical-Mediated Efficient Photoelectrocatalytic NO Oxidation with Simultaneous Nitrate Storage Using A Flow Photoanode Reactor.

The selective conversion of dilute NO pollutant into low-toxic product and simultaneous storage of metabolic nitrogen for crop plants remains a great challenge from the perspective of waste management and sustainable chemistry. This study demonstrates that this bottleneck can be well tackled by refining the reactive oxygen species (ROS) on Ni-modified NH2 -UiO-66(Zr) (Ni@NU) using nickel foam (NF) as a three-dimensional (3D) substrate through a flow photoanode reactor via the gas-phase photoelectrocatalysis. By rationally refining the ROS to ⋅OH, Ni@NU/NF can rapidly eliminate 82 % of NO without releasing remarkable NO2 under a low bias voltage (0.3 V) and visible light irradiation. The abundant mesoporous pores on Ni@NU/NF are conducive to the diffusion and storage of the formed nitrate, which enables the progressive conversion NO into nitrate with selectivity over 99 % for long-term use. Through calculation, 90 % of NO could be recovered as the nitrate species, indicating that this state-of-the-art strategy can capture, enrich and recycle the pollutant N source from the atmosphere. This study offers a new perspective of NO pollutant treatment and sustainable nitrogen exploitation, which may possess great potential to the development of highly efficient air purification systems for industrial and indoor NOx control.

Diminished Rbfox1 increases vascular constriction by dynamically regulating alternative splicing of CaV1.2 calcium channel in hypertension.

Calcium influx from depolarized CaV1.2 calcium channels triggers the contraction of vascular smooth muscle cells (VSMCs), which is important for maintaining vascular myogenic tone and blood pressure. The function of CaV1.2 channel can be subtly modulated by alternative splicing (AS), and its aberrant splicing involves in the pathogenesis of multiple cardiovascular diseases. The RNA-binding protein Rbfox1 is reported to regulate the AS events of CaV1.2 channel in the neuronal development, but its potential roles in vascular CaV1.2 channels and vasoconstriction remain undefined. Here, we detect Rbfox1 is expressed in rat vascular smooth muscles. Moreover, the protein level of Rbfox1 is dramatically decreased in the hypertensive small arteries from spontaneously hypertensive rats in comparison with normotensive ones from Wistar-Kyoto rats. In VSMCs, Rbfox1 could dynamically regulate the AS of CaV1.2 exons 9* and 33. By whole-cell patch clamp, we identify knockdown of Rbfox1 induces the hyperpolarization of CaV1.2 current-voltage relationship curve in VSMCs. Furthermore, siRNA-mediated knockdown of Rbfox1 increases the K+-induced constriction of rat mesenteric arteries. In summary, our results indicate Rbfox1 modulates vascular constriction by dynamically regulating CaV1.2 alternative exons 9* and 33. Therefore, our work elucidates the underlying mechanisms for CaV1.2 channels regulation and provides a potential therapeutic target for hypertension.

Scale-Space Feature Recalibration Network for Single Image Deraining.

Computer vision technology is increasingly being used in areas such as intelligent security and autonomous driving. Users need accurate and reliable visual information, but the images obtained under severe weather conditions are often disturbed by rainy weather, causing image scenes to look blurry. Many current single image deraining algorithms achieve good performance but have limitations in retaining detailed image information. In this paper, we design a Scale-space Feature Recalibration Network (SFR-Net) for single image deraining. The proposed network improves the image feature extraction and characterization capability of a Multi-scale Extraction Recalibration Block (MERB) using dilated convolution with different convolution kernel sizes, which results in rich multi-scale rain streaks features. In addition, we develop a Subspace Coordinated Attention Mechanism (SCAM) and embed it into MERB, which combines coordinated attention recalibration and a subspace attention mechanism to recalibrate the rain streaks feature information learned from the feature extraction phase and eliminate redundant feature information to enhance the transfer of important feature information. Meanwhile, the overall SFR-Net structure uses dense connection and cross-layer feature fusion to repeatedly utilize the feature maps, thus enhancing the understanding of the network and avoiding gradient disappearance. Through extensive experiments on synthetic and real datasets, the proposed method outperforms the recent state-of-the-art deraining algorithms in terms of both the rain removal effect and the preservation of image detail information.

Landslide Susceptibility Mapping by Fusing Convolutional Neural Networks and Vision Transformer.

Landslide susceptibility mapping (LSM) is an important decision basis for regional landslide hazard risk management, territorial spatial planning and landslide decision making. The current convolutional neural network (CNN)-based landslide susceptibility mapping models do not adequately take into account the spatial nature of texture features, and vision transformer (ViT)-based LSM models have high requirements for the amount of training data. In this study, we overcome the shortcomings of CNN and ViT by fusing these two deep learning models (bottleneck transformer network (BoTNet) and convolutional vision transformer network (ConViT)), and the fused model was used to predict the probability of landslide occurrence. First, we integrated historical landslide data and landslide evaluation factors and analysed whether there was covariance in the landslide evaluation factors. Then, the testing accuracy and generalisation ability of the CNN, ViT, BoTNet and ConViT models were compared and analysed. Finally, four landslide susceptibility mapping models were used to predict the probability of landslide occurrence in Pingwu County, Sichuan Province, China. Among them, BoTNet and ConViT had the highest accuracy, both at 87.78%, an improvement of 1.11% compared to a single model, while ConViT had the highest F1-socre at 87.64%, an improvement of 1.28% compared to a single model. The results indicate that the fusion model of CNN and ViT has better LSM performance than the single model. Meanwhile, the evaluation results of this study can be used as one of the basic tools for landslide hazard risk quantification and disaster prevention in Pingwu County.

An Intestinal Symbiotic Bacterial Strain of Oscheius chongmingensis Modulates Host Viability at Both Global and Post-Transcriptional Levels.

A rhabditid entomopathogenic nematode (EPN), Oscheius chongmingensis, has a stable symbiotic relationship with the bacterial strain Serratia nematodiphila S1 harbored in its intestines and drastically reduced viability when associated with a non-native strain (186) of the same bacterial species. This nematode is thus a good model for understanding the molecular mechanisms and interactions involved between a nematode host and a member of its intestinal microbiome. Transcriptome analysis and RNA-seq data indicated that expression levels of the majority (8797, 87.59%) of mRNAs in the non-native combination of O. chongmingensis and S. nematodiphila 186 were downregulated compared with the native combination, including strain S1. Accordingly, 88.84% of the total uniq-sRNAs mapped in the O. chongmingensis transcriptome were specific between the two combinations. Six DEGs, including two transcription factors (oc-daf-16 and oc-goa-1) and four kinases (oc-pdk-1, oc-akt-1, oc-rtk, and oc-fak), as well as an up-regulated micro-RNA, oc-miR-71, were found to demonstrate the regulatory mechanisms underlying diminished host viability induced by a non-native bacterial strain. Oc-rtk and oc-fak play key roles in the viability regulation of O. chongmingensis by positively mediating the expression of oc-daf-16 to indirectly impact its longevity and stress tolerances and by negatively regulating the expression of oc-goa-1 to affect the olfactory chemotaxis and fecundity. In response to the stress of invasion by the non-native strain, the expression of oc-miR-71 in the non-native combination was upregulated to downregulate the expression of its targeting oc-pdk-1, which might improve the localization and activation of the transcription factor DAF-16 in the nucleus to induce longevity extension and stress resistance enhancement to some extent. Our findings provide novel insight into comprehension of how nematodes deal with the stress of encountering novel potential bacterial symbionts at the physiological and molecular genetic levels and contribute to improved understanding of host-symbiont relationships generally.

The monitoring approaches and non-destructive testing technologies for sewer pipelines.

Sewage pipe deterioration has been one of the factors causing huge asset losses and urban hazards worldwide. For more efficient and reliable management, a variety of monitoring and non-destructive testing techniques has been developed for defect inspection and condition assessment of sewer pipes. In the present paper, the monitoring approaches of sewage pipes in the form of operational monitoring, structural monitoring, and durability monitoring are outlined. The fundamentals and features of various non-destructive testing (NDT) techniques for different target detect locations are presented. The stereo vision, light detection and ranging (LiDAR), and laser 3D scanning technologies that might serve to architect the digital twin of the pipeline are also described. What's more, the capabilities and limitations of these technologies are discussed and summarized in tables. Some possible visions for the development of inspection and quantitative evaluation of sewage pipes are also discussed. In practice, it is suggested that visual inspection techniques are the most feasible for the evaluation of underground pipes. In terms of quantitative and automated evaluation, visual inspection robots equipped with stereo vision or laser 3D scanning technology are the most promising.

A Critical Analysis of Computed Tomography Washout in Lipid-Poor Adrenal Incidentalomas.

BACKGROUND: Contrast-enhanced computed tomography (CT) with washout has emerged as an option to distinguish lipid-poor adenomas from non-adenomas. OBJECTIVE: The aim of this study was to assess the utility of CT washout in characterizing indeterminate lipid-poor adrenal incidentalomas. METHODS: From an Institutional Review Board-approved database, patients with adrenal incidentalomas who had adrenal protocol CT scans with a 15-min washout between 2003 and 2019 were identified. Non-contrast CT attenuation and washout patterns of different tumor types were compared. RESULTS: Overall, 156 patients with 175 adrenal lesions were included. Average tumor size was 3.0 cm, non-contrast CT density was 24.7 Hounsfield units (HU), and absolute washout was 52.6%. In 102 lesions (58.3%), CT washout was ≥ 60%; 94 (92.2%) of these were benign adrenocortical adenomas, 7 (6.9%) were pheochromocytomas, and 1 (0.9%) was an adrenal hematoma. Furthermore, in 73 tumors (41.7%), CT washout was < 60%; diagnosis was benign adrenocortical adenoma in 45 (61.6%) lesions, pheochromocytoma in 8 (11%) lesions, metastasis in 9 (12.3%) lesions, adrenocortical cancer in 6 (8.2%) lesions, and 'others' in 5 (6.9%) lesions. Sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of  > 60% absolute CT washout for detecting an adrenal adenoma was 67.6%, 77.8%, 92.2%, 38.4%, and 69.7%, respectively. CONCLUSION: CT washout should be incorporated into the management algorithm of indeterminate adrenal incidentalomas with a high non-contrast CT attenuation to 'rule-in' benign tumors. For small tumors with mild elevation of plasma metanephrines, it should be kept in mind that adenomas and pheochromocytomas may have similar imaging and washout characteristics.