Human antibodies neutralizing the alpha-latrotoxin of the European black widow.

Poisoning by widow-spider (genus Latrodectus) bites occurs worldwide. The illness, termed latrodectism, can cause severe and persistent pain and can lead to muscle rigidity, respiratory complications, and cardiac problems. It is a global health challenge especially in developing countries. Equine serum-derived polyclonal anti-sera are commercially available as a medication for patients with latrodectism, but the use of sera imposes potential inherent risks related to its animal origin. The treatment may cause allergic reactions in humans (serum sickness), including anaphylactic shock. Furthermore, equine-derived antivenom is observed to have batch-to-batch variability and poor specificity, as it is always an undefined mix of antibodies. Because latrodectism can be extremely painful but is rarely fatal, the use of antivenom is controversial and only a small fraction of patients is treated. In this work, recombinant human antibodies were selected against alpha-latrotoxin of the European black widow (Latrodectus tredecimguttatus) by phage display from a naïve antibody gene library. Alpha-Latrotoxin (α-LTX) binding scFv were recloned and produced as fully human IgG. A novel alamarBlue assay for venom neutralization was developed and used to select neutralizing IgGs. The human antibodies showed in vitro neutralization efficacy both as single antibodies and antibody combinations. This was also confirmed by electrophysiological measurements of neuronal activity in cell culture. The best neutralizing antibodies showed nanomolar affinities. Antibody MRU44-4-A1 showed outstanding neutralization efficacy and affinity to L. tredecimguttatus α-LTX. Interestingly, only two of the neutralizing antibodies showed cross-neutralization of the venom of the Southern black widow (Latrodectus mactans). This was unexpected, because in the current literature the alpha-latrotoxins are described as highly conserved. The here-engineered antibodies are candidates for future development as potential therapeutics and diagnostic tools, as they for the first time would provide unlimited supply of a chemically completely defined drug of constant quality and efficacy, which is also made without the use of animals.

Diagnóstico de tuberculosis mediante detección de Mycobacterium tuberculosis empleando un sistema no comercial de reacción en cadena de la polimerasa / Diagnosis of tuberculosis by detection of mycobacterium tuberculosis with a non-commercial polymerase chain reaction

Objetivo: Evaluar la capacidad de un sistema no comercial de amplificación directa por reacción en cadena de la polimerasa para identificar a Mycobacterium tuberculosis en pacientes con sospecha de tuberculosis pulmonar y baciloscopia positiva. Material y métodos: Se analizaron muestras de expectoración y líquido pleural por medio de amplificación directa por reacción en cadena de la polimerasa, utilizando las secuencias 5'CAGCCCGCTGGAGTCCCGCGGA3' y 5'GCGCGTTCACCATGGACACCG3'. Se utilizó como estándar de oro el cultivo en Lowenstein-Jensen.Resultados: Se incluyeron 79 pacientes consecutivos y un total de 212 especímenes. Utilizando el cultivo como estándar de oro, la sensibilidad de la reacción en cadena de la polimerasa en las muestras de expectoración fue de 97 por ciento, y su valor predictivo positivo de 57 por ciento. La reacción en cadena de la polimerasa fue positiva en 54 (98.18 por ciento) de los 55 casos con baciloscopia positiva en expectoración. Conclusión: La sensibilidad y el valor predictivo positivo de la secuencia utilizada para identificar a Mycobacterium tuberculosis en muestras de expectoración con baciloscopia positiva, son similares a la reportada en los estudios clínicos. Su aplicación permitirá identificar rápidamente a los pacientes infectados con micobacterias tuberculosas y distinguirlos de aquellos infectados por micobacterias no tuberculosas.