Symbiotic integration of waste disposal capability within a city cluster: The case of the Yangtze River Delta.

With the ongoing urbanization in developing regions, integrating regional waste disposal capability is challenging due to unbalanced economic development and rising environmental issues. This research proposed a multi-dimensional symbiotic integration of waste disposal capability. Applying data from the Yangtze River Delta (YRD) in China, we first explore the waste flows and interactions between cities to identify the possibility of inter-municipal collaboration based on the augmented gravity model. We then employ social network analysis to categorize the cities in the collaborative network of waste disposal into subgroups by functionalities. Finally, we proposed the top-down framework of symbiotic networks for waste disposal. Our findings indicate that YRD cities can be classified into four types according to their waste density and disposal efficiency: High-High, Low-High, Low-Low, and High-Low. We also identify three types of inter-municipal collaborative relationships: between high-density and high-efficiency cities, between high-density cities, and between high-efficiency cities. The city subgroups can be categorized into "high-efficiency clusters," "high-density clusters," and "hub clusters," which pave the way for a shared or complementary urban symbiosis in the waste recycling industry. The division of roles among subgroups enables symbiotic activities within the city cluster. This paper extends the spatial scope of industrial symbiosis literature and has practical implications for transitioning to a circular economy in waste management of developing countries.

Animal DNA Typing and Its Research Progress in Forensic Medicine.

With the advance of molecular biology, DNA analysis technology has been widely applied in forensic science. Non-human DNA analysis can be used in some special cases and has unique forensic value to provide investigation clues and trial basis. Animal DNA typing plays a more prominent role in the detection of all kinds of non-human DNA related cases and is the main content of forensic non-human DNA analysis. This paper reviews the development history, present situation, advantages and disadvantages of animal DNA typing according to its technology, characteristic, challenges facing forensic science application scenarios, and also its future development.

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

Occurrence of Chenopodium quinoa mitovirus 1 in Chenopodium quinoa in China.

Chenopodium quinoa mitovirus 1 (CqMV1), a member of Mitovirus in the family Mitoviridae, is the first identified plant mitovirus (Nerva et al., 2019), which has been reported to be capable of infecting different cultivars of Chenopodium quinoa including Cherry vanilla quinoa, GQU-7356 campesino Quinoa, and Wild (Nerva et al., 2019). Cultivation of C. quinoa has increased notably in China, with good agricultural and industrial results due to its nutritional value (Vega-Gálvez et al., 2010). In September 2019, leaf mottling and plant stunting were observed on C. quinoa (cv. Longli 1) plants (Fig. S1) in a field of about 0.9 acre in Qingyuan County, Zhejiang Province, China. About 33.3% (401/1200) of C. quinoa showed leaf mottling and plant stunting symptoms. To identify viral agents potentially associated with this disease, a sRNA library from a symptomatic leaf sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and the library was constructed using the Truseq Small RNA Library preparation kit (Illumina, CA, USA). Approximately 14 million raw reads were obtained from the Illumina MiSeq platform. The clean reads were obtained and assembled using the VirusDetect pipeline v1.6 (Zheng et al., 2017) for virus identification. A total of 22 assembled contigs, with sizes ranging from 42 to 306 nt, could be aligned to the genome of CqMV1 isolate Che1 (accession no. MF375475) with nucleotide identities of 96.3% to 99.1% and a cumulative alignment coverage of the CqMV1 genome of 84.0%. Except for CqMV1, no other viruses or viroids were found in the sample. Based on the assembled contigs and the reference CqMV1 genome, we designed two primer pairs (P1F: 5'- TCCGAATCTCATTTTCGGAGTGGGTAGA -3' and P1R: 5'- CAGACTTTAGATCAAATGAATACACATGT -3'; P2F: 5'- TCCAGTATACCTGTGGATAGTACTTTCA -3'and P2R: 5'- CGATCTCTGCTACCAAATACTCGTGAGCC -3') to obtain the genome sequence of CqMV1 isolate Zhejiang (CqMV1-ZJ). Total RNA from the CqMV1-infected C. quinoa plant was subject to reverse transcription (RT) using AMV reverse transcriptase (TaKaRa, Tokyo, Japan) with random primers N6 (TaKaRa, Tokyo, Japan). The cDNA was then used as the template to amplify two regions in the genome, which together covered the entire genome of CqMV1-ZJ, using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). The PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced (YouKang Co., Ltd, China). The obtained sequences were assembled into a 2,730-nt contig, representing the complete genome of CqMV1-ZJ (GenBank accession no. MT089917). Pairwise sequence comparison using the Sequence Demarcation Tool v.1.2 (Muhire et al., 2014) revealed that CqMV1-ZJ shared a sequence identity of 96.9% with the sole CqMV1 sequence available in GenBank (MF375475), thus confirming the identity of the virus as CqMV1. Furthermore, we performed RT- PCR detection on 10 collected samples using the primer pair P1F and P1R. All seven symptomatic plants tested positive for CqMV1 infection, whereas three asymptomatic plants were CqMV1-free (Fig. S1), suggesting a possible association between the virus and the symptoms observed. However, in the study by Nerva et al, two CqMV1 infected accessions (cv. Regalona and IPSP1) were found asymptomatic (Nerva et al., 2019), we therefore speculated that the symptom caused by CqMV1 varies between different C. quinoa varieties or its growth environment. To the best of our knowledge, this is the first report of CqMV1 infecting C. quinoa in China. Its ability to be transmitted through seeds (Nerva et al., 2019) and the possible pathogenicity in C. quinoa raises a serious concern for the local C. quinoa industry. The findings reported here will assist further investigations on the epidemiology and biological characteristics of CqMV1 in Zhejiang, China.

Molecular cloning, characterization of Pomacea canaliculata HSP40 and its expression analysis under temperature change.

Heat shock proteins (HSPs) play important roles in the adaption of Pomacea canaliculata to unsuitable environments. In the present study, a cDNA encoding HSP40 in P. canaliculata (PocaHSP40) was cloned and characterized. The PocaHSP40 cDNA was 1466 bp, containing an ORF of 954 bp encoding 317 amino acids. Bioinformatics analysis showed that PocaHSP40 belonged to type II HSP40s and had four predicted phosphorylation sites. Phylogenetic analysis proved the conservation of HSP40s in mollusks. PocaHSP40 was widely expressed in the gill, digestive gland, kidney, and foot muscle of P. canaliculata. Challenged by different temperatures, the expression of PocaHSP40 was up-regulated under low temperatures but not high temperatures, which was contrary to the expression change of PocaHSP70 under low and high temperatures. These results implied that P. canaliculata evolved different strategies for survival under low temperature and high temperature through the regulation of HSPs.

Developmental neurotoxicity of Microcystis aeruginosa in the early life stages of zebrafish.

Accumulating evidence suggests that cyanotoxins can exert neurotoxic effects on exposed aquatic organisms but most studies have focused on purified toxins rather than on the more complex effects of cyanobacterial blooms. To evaluate this issue in an environmentally relevant model, we assessed the developmental neurotoxicity induced by Microcystis aeruginosa on newly hatched zebrafish. After four days of exposure, the locomotor activity of zebrafish larvae was significantly decreased with increasing algae concentration. The levels of both acetylcholinesterase (AChE) and dopamine (DA) were decreased, accompanied by a decline in ache, chrna7 and manf and a compensatory increase in nr4a2b transcription. Furthermore, the expression of nine marker genes for nervous system function or development, namely, elavl3, gap43, gfap, mbp, nestin, ngn1, nkx2.2a, shha and syn2a, similarly decreased after algal exposure. These results demonstrated that Microcystis aeruginosa exposure affected cholinergic and dopaminergic neurotransmitter systems, the transcription of key nervous system genes, and consequently the activity level of larval zebrafish. Importantly, discrepancies in the neurotoxic effects observed in this study and in previous reports that were based on exposure to pure cyanotoxin highlight the necessity for further investigation of cyanobacterial bloom mixtures when assessing the ecotoxicity of cyanobacteria.

Biological and chemical factors driving the temporal distribution of cyanobacteria and heterotrophic bacteria in a eutrophic lake (West Lake, China).

Physico-chemical parameters, hydrological conditions, and microbial interactions can affect the growth and persistence of cyanobacteria, but the interacting effects among these bloom-forming factors are still poorly known. This hampers our capacity to predict the occurrence of cyanobacterial bloom accurately. Here, we studied the relationship between temperature, N and P cycles, and the microbial community abundance and diversity at 0.5 m under the surface of West Lake (China) from January 21 to November 20, 2015, in order to better understand the key factors regulating temporal changes in the cyanobacterial community. Using high throughput sequencing of the 16S rRNA gene V3-V4 region, we studied the diversity and abundance of bacteria. In parallel, we measured physico-chemical parameters and followed the abundance of key genes involved in N fixation, denitrification, and nutrient uptake. Multivariate analyses suggest that P concentration and water temperature are the key factors controlling the outbreak of summer cyanobacterial bloom. RT-qPCR analyses of the bacterial community and measurements of the copy number of denitrification-related gene (nirK, nosZ, nirS) show that denitrification potential and denitrifying bacteria relative abundance (Pseudomonas and Bacillus) increased in concert with diazotrophic cyanobacterial genera (Anabaena, Nostoc, Aphanizomenon flos-aquae) and the common bloom-forming non-diazotrophic cyanobacterium genus Microcystis. The present study brings new insights on the complex interplay between physico-chemical parameters, heterotrophic bacterial community composition, nitrogen cycle, and cyanobacteria dominance in a eutrophic lake.

Cytotoxic and antibacterial angucycline- and prodigiosin-analogues from the deep-sea derived Streptomyces sp. SCSIO 11594.

Two new C-glycoside angucyclines, marangucycline A (1) and marangucycline B (2), along with three known compounds, dehydroxyaquayamycin (3), undecylprodigiosin (4) and metacycloprodigiosin (5), have been identified as products of the deep-sea sediment strain Streptomyces sp. SCSIO 11594. New structures were elucidated on the basis of HRESIMS, 1D and 2D NMR analyses and comparisons to previously reported datasets. Compounds 2 and 4 displayed in vitro cytotoxicity against four cancer cell lines A594, CNE2, HepG2, MCF-7 superior to those obtained with cisplatin, the positive control. Notably, compound 2 bearing a keto-sugar displayed significant cytotoxicity against cancer cell lines with IC50 values ranging from 0.24 to 0.56 µM; An IC50 value of 3.67 µM was found when using non-cancerous hepatic cell line HL7702, demonstrating the cancer cell selectivity of 2. Compounds 1-3 were proved to have weak antibacterial activities against Enterococcus faecalis ATCC29212 with an MIC value of 64.0 µg/mL. Moreover, 3 displayed selective antibacterial activity against methicillin-resistant Staphylococcus epidermidis shhs-E1 with an MIC value of 16.0 µg/mL.

Molecular cloning, characterization and expression analysis of HSP60, HSP70 and HSP90 in the golden apple snail, Pomacea canaliculata.

The golden apple snail, Pomacea canaliculata, has strong tolerance to high temperature, facilitating its invasion in East and Southeast Asia. In the present study, three cDNAs encoding heat shock proteins (PocaHSP60, PocaHSP70, PocaHSP90) in P. canaliculata were cloned and characterized. The PocaHSP60 cDNA was 2447 bp, containing an ORF encoding a polypeptide of 574 amino acids. The PocaHSP70 cDNA was 2644 bp, containing an ORF encoding a polypeptide of 643 amino acids. The PocaHSP90 cDNA was 2546 bp, containing an ORF encoding a polypeptide of 726 amino acids. Genomic DNA analysis showed that PocaHSP60 had 11 introns in the coding region and PocaHSP90 had 7 introns but PocaHSP70 had no one. The expression changes of these three PocaHSPs in the gill, digestive gland, kidney and foot muscle of P. canaliculata exposed to high and low temperature were investigated. The results of quantitative PCR and western blotting showed that the expression level of PocaHSP90 was much higher than PocaHSP60 and PocaHSP70 at room temperature, and PocaHSP70 expression level was the lowest among them. Afterheat shock, PocaHSP70 expression increased rapidly, much more significantly than PocaHSP90 expression, and the effect of heat shock on the expression of PocaHSP70 and PocaHSP90 in the different tissues of P. canaliculata was not the same. Unlike PocaHSP70 and PocaHSP90, PocaHSP60 expression seemed not to be affected by heat shock, because its expression was moderately induced only in the foot muscle. However, cool shock had little effect on the expression change of above three PocaHSPs. These results indicated that HSPs might be related to the thermal resistance of P. canaliculata.

Comparison of the relative diagnostic performance of 68Ga-DOTA-IBA and 18F-NaF for the detection of bone metastasis.

Purpose: We aimed to compare the relative diagnostic efficacy of 68Ga-Labeled DOTA-ibandronic acid (68Ga-DOTA-IBA) to that of18F-NaF PET/CT as a mean of detecting bone metastases in patients with a range of cancer types. Methods: This study retrospectively enrolled patients with bone metastases associated with various underlying malignancies. All patients underwent both 68Ga-DOTA-IBA and 18F-NaF PET/CT scans. Histopathology and follow-up CT or MRI imaging results were used as reference criteria, with a minimum follow-up period of 3 months. The maximum Standardized Uptake Value (SUVmax) and number of bone metastases were recorded. The Target-Background Ratio (TBR) was calculated along with the detection rate, sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and accuracy of 68Ga-DOTA-IBA and 18F-NaF PET/CT imaging for overall and partial primary solid tumor bone metastases. Pearson chi-square test, McNemar test, and Kappa test was conducted to assess the correlation and consistency of diagnostic efficiency between the two imaging agents. Receiver Operating Characteristic curve (ROC curve) was performed to compare diagnostic performance and the area under the curve of the two imaging agents, determining optimal critical values for SUVmax and TBR in diagnosing bone metastasis. Differences in SUVmax and TBR values between the two imaging agents for detecting bone metastases were analyzed using the Wilcoxon signed rank test. The difference was statistically significant when P < 0.05. Results: A total of 24 patients (13 women and 11 men) were included in this study, with a mean age of 52 (interquartile range, 49-64 years). The detection rate, sensitivity, specificity, PPV, NPV, accuracy, and AUC of 68Ga-DOTA-IBA and 18F-NaF PET/CT for bone metastases were 81%, 90%, 62%, 95%, 43%, 88%, 0.763, and 89%, 99%, 59%, 95%, 89%, 95%, 0.789, respectively. There was no significant difference between the two imaging methods (P < 0.01), and there was a significant correlation (X2=168.43, P < 0.001) and a strong consistency (Kappa=0.774,P < 0.001) between the diagnostic results of the two imaging agents. The SUVmax values of lesions measured by 68Ga-DOTA-IBA and 18F-NaF imaging in 22 patients with bone metastasis were 5.1 ± 5.4 and 19.6 ± 15.1, respectively, with statistically significant differences (P<0.05). The TBR values of the two imaging methods were 5.0 ± 5.0 and 6.7 ± 6.4, respectively, with statistically significant differences (P<0.05). The AUC of the SUVmax of 68Ga-DOTA-IBA and 18F-NaF curves were 0.824 and 0.862, respectively, with no statistically significant difference (P=0.490). No significant difference was found in the AUC of the TBR of 68Ga-DOTA-IBA and 18F-NaF (0.832 vs 0.890; P=0.248). Subgroup analysis showed significant correlation between the two imaging agents in the diagnosis of bone metastases in lung cancer and breast cancer, with consistent diagnostic results. However, in the diagnosis of bone metastases in prostate cancer, there was a significant difference (P<0.001) and lack of consistency (P=0.109). Conclusion: The diagnostic efficacy of 68Ga-DOTA-IBA for bone metastasis lesions is comparable to that of 18F-NaF. This finding holds significant clinical importance in terms of diagnosis of bone metastasis and selecting treatment plans for patients with malignant tumors.

Comparison of the chemical constituents of Saposhnikoviae Radix associated with three different growth patterns and its therapeutic effect against atopic dermatitis.

ETHNOPHARMACOLOGICAL RELEVANCE: Saposhnikoviae Radix (SR) was initially documented in Shennong Bencao Jing classics for its properties in dispelling wind, dissolving surface, relieving pain, and alleviating spasms. This herb is commonly used in traditional Chinese medicine to address conditions that affect the body's surface, by aiding in the expulsion of pathogens from the surface and alleviating pain associated with the immune response. Atopic dermatitis (AD) is a prevalent allergic skin disorder, and the therapeutic effects of SR in dispelling wind and relieving the body's surface are consistent with the clinical symptoms commonly observed in AD. AIM OF THE STUDY: The anti-AD effects of SR were examined under three different growth patterns to identify active pharmacodynamic compounds. The results provide insight into the clinical efficacy of wild and cultivated SR. MATERIALS AND METHODS: The efficacy of wild, wild-simulated, and cultivated SR was assessed in a mouse model of AD. In addition, the effects of wild and varying doses of cultivated SR were evaluated in mice with short-term AD symptoms. GC-MS and UPLC-MS/MS were used to analyze the chemical components of the three SR treatments and molecular docking was used to identify active components. RESULTS: A mouse model of AD was used to assess the pharmacodynamic effects of SR prepared by three different cultivation methods. The study found that all three SR preparations improved phenotypic markers and histopathological features in the AD mouse model. The efficacy of wild SR and wild-simulated SR was similar, although there was a significant difference between wild and cultivated SR. Both wild SR and various doses of cultivated SR ameliorated skin injuries and reduced inflammation in serum and skin tissues. Furthermore, skin thickness, inflammatory cells, mast cell infiltration, and IL-33 expression improved following treatment. Notably, wild SR, double-cultivated SR, and triple-cultivated SR demonstrated significant therapeutic effects. An analysis using GC-MS revealed the presence of 55, 52, and 43 volatile oils in the three SR preparations, with more common components observed between wild and wild-simulated SR. Fewer common components were evident between cultivated and wild SR. UPLC-MS/MS analysis identified a total of 37 compounds, with larger relative peak areas observed for the chromogenic ketones. Molecular docking studies revealed that certain compounds, such as n-propyl 9,12-octadecadienoate, (E)-9-octadecenoic acid ethyl ester, and various chromogenic ketones, such as cimifugin, 5-O-methyIvisamminol, hamaudol, 3'-O-acetylhamaudol, 3'-O-angeloyhamandol, adenosine and farnesylaceton, may be the major substances that distinguish the activities of SR with three different growth patterns. CONCLUSION: Variations in the anti-AD efficacy of SR with three growth patterns were identified, and their chemical composition differences were determined. These findings suggest that increasing the dosage of cultivated SR could potentially be a viable clinical alternative for atopic dermatitis treatment.

Exploring the impact of PEGylation on pharmacokinetics: a size-dependent effect of polyethylene glycol on prostate-specific membrane antigen inhibitors.

BACKGROUND: Prostate cancer is the second most frequent cancer and the fifth leading cause of cancer-related deaths in men. Prostate-specific membrane antigen (PSMA) as a target has gained increasing attention. This research aims to investigate and understand how altering size of PEG impacts the in vitro and in vivo behavior and performance of PSMA inhibitors, with a specific focus on their pharmacokinetic characteristics and targeting properties. RESULTS: Two 68Ga-labeled PSMA-targeted radiotracers were developed, namely [68Ga]Ga-PP4-WD and [68Ga]Ga-PP8-WD, with varying sizes of polyethylene glycol (PEG). [68Ga]Ga-PP4-WD and [68Ga]Ga-PP8-WD had excellent affinity for PSMA with IC50 being 8.06 ± 0.91, 6.13 ± 0.79 nM, respectively. Both tracers enabled clear visualization of LNCaP tumors in PET images with excellent tumor-to-background contrast. They also revealed highly efficient uptake and internalization into LNCaP cells, increasing over time. The biodistribution studies demonstrated that both radioligands exhibited significant and specific uptake into LNCaP tumors. Furthermore, they were rapidly cleared through the renal pathway, as evidenced by [68Ga]Ga-PP4-WD and [68Ga]Ga-PP8-WD showing a tenfold and a fivefold less in renal uptake, respectively, compared to [68Ga]Ga-Flu-1 in 30 min. Both in vitro and in vivo experiments demonstrated that PEG size significantly impacted tumor-targeting and pharmacokinetic properties. CONCLUSIONS: These radiotracers have demonstrated their effectiveness in significantly reducing kidney uptake while maintaining the absorbed dose in tumors. Both radiotracers exhibited strong binding and internalization characteristics in vitro, displayed high specificity and affinity for PSMA in vivo.

Obtaining cellulose binding and hydrolyzing activity of a family 11 hybrid xylanase by fusion with xylan binding domain.

The xylan binding domain (XBD) and linker sequences (LS) from thermostable and thermophilic Thermomonospora fusca xylanase A (TfxA) was fused to the carboxyl-terminus of a family 11 hybrid xylanase ATx. The constructed chimera (ATxX) was successfully expressed in Pichia pastoris, partially purified to homogeneity, and then characterized in detail. After 96-h 0.25% methanol induction, the xylanase and cellulose activity of ATxX from pPATxX1 transformant culture medium supernatant were 452.1 U/mg and 19.3 U/mg, respectively. SDS-PAGE analysis revealed that the molecular mass of ATxX was about 33.01 kDa. 3.7% ATxX was bound after incubation with 1% microcrystal cellulose at 25 °C for 3 h, while the ATx did not show cellulose binding-hydrolyzing ability. These results suggested that ATx obtained cellulose binding and hydrolyzing ability by fusing with XBD and LS. Enzymatic studies showed that the temperature and pH optimum of the ATxX xylanase activity were 60 °C and pH 5.0, respectively, which were the same as that of ATx. The temperature and pH optimum of the ATxX cellulase activity were 60 °C and pH 6.0, respectively. The major hydrolytic products released by ATxX from birchwood xylan were xylotriose and xylohexaose. Xylooligosaccharides from xylobiose to xylohexaose could be hydrolyzed by ATxX. Mode of action analysis showed that the chimeric ATxX was an endo-acting enzyme. The XBD and LS plays an important role in the binding and hydrolyzing of xylanase to insoluble substrates.

A New Radiopharmaceutical 225 Ac-DOTA-IBA in the Treatment of a Case of Bone Metastases.

ABSTRACT: α-Emitter 225 Ac has been considered a candidate for targeted α-therapy. DOTA-IBA is new a precursor targeting bone metastasis. It can be used for radionuclide labeling with 225 Ac. We present a case with refractory bone pain for bone metastasis, who demonstrated an excellent therapy response after 1 cycle of 225 Ac-DOTA-IBA therapy. Moreover, the patient did not have any observable adverse effects.

Prospective Comparison of the Imaging Value of 99m Tc-MDP Bone Scan and 68 Ga-FAPI-04 PET/CT in Synovitis, Acne, Pustulosis, Hyperostosis, and Osteitis Syndrome.

PURPOSE: This study aimed to explore the imaging value of 68 Ga-FAPI-04 PET/CT in synovitis, acne, pustulosis, hyperostosis, and osteitis (SAPHO) syndrome and compare it with that of 99m Tc-MDP bone scan. METHODS: Nineteen participants with SAPHO syndrome underwent 68 Ga-FAPI-04 PET/CT and 99m Tc-MDP bone scan. Demographic data and clinical features were recorded, SAPHO imaging features were analyzed, and the osteoarticular lesion detection rate in both methods was calculated. RESULTS: This prospective study recruited 4 men and 15 women aged 52.4 ± 8.6 years. The anterior chest wall was involved in all participants (100%). Palmoplantar pustulosis was the most common (36.8%) skin symptom. 99m Tc-MDP bone scan and 68 Ga-FAPI-04 PET/CT together detected 84 osteoarticular lesions, of which 91.7% (77/84) were detected by the former and 96.4% (81/84) by the latter. Furthermore, 68 Ga-FAPI-04 PET/CT detected 5 cases of knee and hip joint synovitis. CONCLUSIONS: 68 Ga-FAPI-04 PET/CT was more sensitive than 99m Tc-MDP bone scan when evaluating osteoarticular lesions in SAPHO syndrome and could also evaluate synovial lesions. 68 Ga-FAPI-04 PET/CT could be a good imaging method for SAPHO syndrome but requires further verification in a more extensive research cohort.

Characterization and transcriptomic analysis of a native fungal pathogen against the rice pest Nilaparvata lugens.

The brown planthopper (BPH), Nilaparvata lugens, is one of the most destructive pests of rice. Given the threats posed by insecticide resistance to its control, eco-friendly strategies based on microbial pathogens emerged as a promising biocontrol alternative. In the present study, we isolated a native fungal pathogen against BPH from infected BPH cadavers and preliminarily identified as a strain of Aspergillus fumigatus based on morphological and molecular methods. Laboratory bioassay revealed that this fungal strain was highly virulent to BPH both at nymphal and adult stages, with the median lethal times (LT50) of 7.5 and 5.8 days under high conidial concentration of 1 × 109 conidia mL-1. A genome-wide view of gene expressions in BPH against fungal attack was analyzed by transcriptomic sequencing and consequently a large number of differentially expressed genes that mainly involved in host immune defense and cell detoxification were found. RNAi-mediated knockdown of an upregulated gene encoding a serine protease (NlSPN) could cause a significant decrease in BPH survival. Combination of dsRNA injection and fungal infection showed an additive effect on BPH mortality, which provided clues to develop new pest management strategies against BPH.

Managing e-waste from a closed-loop lifecycle perspective: China's challenges and fund policy redesign.

E-waste is one of the fastest growing streams of solid waste globally, and its effective management has become a focused issue, which requires a deep understanding of the core guiding theory of extended producer responsibility (EPR). Over the past 20 years, China, one of the world's largest producers of electrical and electronic equipment (EEE), has made great efforts to improve e-waste management along with the massive generation of e-waste. In 2012, China implemented a unique EPR-based e-waste fund policy. However, the fund policy is unsustainable due to the challenges of non-closed resource use, informal recycling, and fund imbalance. Beginning with an overview of these challenges, this paper focuses on redesigning the fund policy from a closed-loop lifecycle perspective in order to maintain a balanced development of the resource use loop and the fund system in China's ten-year plan. In doing so, two EPR instruments, recycling content standards and consumer-oriented deposits, are added to the current fund policy. Subsequently, three extension scenarios alternately changed a critical parameter of the model to test the impact on sustainable capabilities. In this way, the sustainable supply of funds and secondary resources for the e-waste industry can be established in China and effectively demonstrate solid waste management in developing countries.

Carbon Dioxide Emissions Reduction through Technological Innovation: Empirical Evidence from Chinese Provinces.

Energy consumption and industrial activities are the primary sources of carbon emissions. As the "world's factory" and the largest carbon emitter, China has been emphasizing the core role of technological innovation in promoting industrial structure upgrades (ISU) and energy efficiency (EE) to reduce carbon emissions from industrial production and energy consumption. This study investigated the mechanism (through ISU and EE) and spillover effect of technological innovation on carbon emission reduction using the panel dataset of 30 Chinese provinces from 2008 to 2019 and spatial econometrics models. The study concluded that (1) technological innovation had a negative direct effect on provincial carbon emissions, while it also showed a spatial spillover effect on neighboring provinces; (2) technological innovation had an indirect effect on provincial carbon emissions reduction through the mediation of energy efficiency improvement, while the mediation effect of industrial structure upgrading is not yet significant; and (3) the effect of technological innovation on carbon emission reduction showed heterogeneity in the eastern, central, and western regions of China. This study provided empirical and theoretical references to decision-makers in China and other developing countries in promoting technological and carbon control policies. More specifically, direct technology investment and indirect investment in industrial structure upgrades and energy efficiency could help with regional carbon emissions reduction.

Application of 68Ga-citrate PET/CT for differentiating periprosthetic joint infection from aseptic loosening after joint replacement surgery.

AIMS: We aimed to evaluate the utility of 68Ga-citrate positron emission tomography (PET)/CT in the differentiation of periprosthetic joint infection (PJI) and aseptic loosening (AL), and compare it with 99mTc-methylene bisphosphonates (99mTc-MDP) bone scan. METHODS: We studied 39 patients with suspected PJI or AL. These patients underwent 68Ga-citrate PET/CT, 99mTc-MDP three-phase bone scan and single-photon emission CT (SPECT)/CT. PET/CT was performed at ten minutes and 60 minutes after injection, respectively. Images were evaluated by three nuclear medicine doctors based on: 1) visual analysis of the three methods based on tracer uptake model, and PET images attenuation-corrected with CT and those not attenuation-corrected with CT were analyzed, respectively; and 2) semi-quantitative analysis of PET/CT: maximum standardized uptake value (SUVmax) of lesions, SUVmax of the lesion/SUVmean of the normal bone, and SUVmax of the lesion/SUVmean of the normal muscle. The final diagnosis was based on the clinical and intraoperative findings, and histopathological and microbiological examinations. RESULTS: Overall, 23 and 16 patients were diagnosed with PJI and AL, respectively. The sensitivity and specificity of three-phase bone scan and SPECT/CT were 100% and 62.5%, 82.6%, and 100%, respectively. Attenuation correction (AC) at 60 minutes and non-AC at 60 minutes of PET/CT had the same highest sensitivity and specificity (91.3% and 100%), and AC at 60 minutes combined with SPECT/CT could improve the diagnostic efficiency (sensitivity = 95.7%). Diagnostic efficacy of the SUVmax was low (area under the curve (AUC) of ten minutes and 60 minutes was 0.814 and 0.806, respectively), and SUVmax of the lesion/SUVmean of the normal bone at 60 minutes was the best semi-quantitative parameter (AUC = 0.969). CONCLUSION: 68Ga-citrate showed the potential to differentiate PJI from AL, and visual analysis based on uptake pattern of tracer was reliable. The visual analysis method of AC at 60 minutes, combined with 99mTc-MDP SPECT/CT, could improve the sensitivity from 91.3% to 95.7%. In addition, a major limitation of our study was that it had a limited sample size, and more detailed studies with a larger sample size are warranted. Cite this article: Bone Joint Res 2022;11(6):398-408.

A Lung Ultrasound-Based Nomogram for the Prediction of Refractory Mycoplasma pneumoniae Pneumonia in Hospitalized Children.

Purpose: Early diagnosis of refractory Mycoplasma pneumoniae pneumonia (RMPP) is challenging because of the lack of practical diagnostic imaging tools. Lung ultrasound (LUS) is an emerging tool for diagnosing childhood pneumonia. Hence, we evaluated the role of a nomogram combining LUS findings, clinical features, and laboratory indices in the early prediction of RMPP in children. Patients and Methods: We retrospectively analyzed 225 children with Mycoplasma pneumoniae pneumonia (MPP) admitted to our hospital between Dec 2018 and Aug 2021. Logistic regression analysis incorporated LUS findings and clinical predictors into the nomogram. Ninety patients hospitalized from Sep 2021 to Dec 2021 were used for external validation of the prediction model. Receiver operating characteristics (ROC) and calibration curves were used to evaluate the performance of the nomogram in the early diagnosis of RMPP. Results: Ultimately, Consolidation size /BSA (odds ratio (OR) 1.015, 95% confidence interval (CI) 1.536-2.446), Pleural Effusion (OR 3.551, 95% CI 1.921-15.600), LDH (OR 1.044, 95% CI 1.006-1. 021) and CRP (OR 3.293, 95% CI 1.019-1.098) were independent risk factors for the development of RMPP. The prediction model was represented visually as a nomogram. The area under the ROC curve for the predictive nomogram was 0.955 (95% CI 0.919-0.978) in the training cohort and 0.916 (95% CI 0.838-0.964) in the validation cohort. The calibration curve is close to the diagonal. Conclusion: This is the first-time lung ultrasound was added to the predicted nomogram, which can more comprehensively assess the condition and more accurately predict the occurrence of RMPP early. Therefore, this nomogram can be widely used in the early diagnosis of RMPP, especially in primary care hospitals.