RESUMO
Once considered a tissue culture-specific phenomenon, cellular senescence has now been linked to various biological processes with both beneficial and detrimental roles in humans, rodents and other species. Much of our understanding of senescent cell biology still originates from tissue culture studies, where each cell in the culture is driven to an irreversible cell cycle arrest. By contrast, in tissues, these cells are relatively rare and difficult to characterize, and it is now established that fully differentiated, postmitotic cells can also acquire a senescence phenotype. The SenNet Biomarkers Working Group was formed to provide recommendations for the use of cellular senescence markers to identify and characterize senescent cells in tissues. Here, we provide recommendations for detecting senescent cells in different tissues based on a comprehensive analysis of existing literature reporting senescence markers in 14 tissues in mice and humans. We discuss some of the recent advances in detecting and characterizing cellular senescence, including molecular senescence signatures and morphological features, and the use of circulating markers. We aim for this work to be a valuable resource for both seasoned investigators in senescence-related studies and newcomers to the field.
RESUMO
BACKGROUND: Nearly half of adults have hypertension, a major risk factor for cardiovascular disease. Mitochondrial hyperacetylation is linked to hypertension, but the role of acetylation of specific proteins is not clear. We hypothesized that acetylation of mitochondrial CypD (cyclophilin D) at K166 contributes to endothelial dysfunction and hypertension. METHODS: To test this hypothesis, we studied CypD acetylation in patients with essential hypertension, defined a pathogenic role of CypD acetylation in deacetylation mimetic CypD-K166R mutant mice and endothelial-specific GCN5L1 (general control of amino acid synthesis 5 like 1)-deficient mice using an Ang II (angiotensin II) model of hypertension. RESULTS: Arterioles from hypertensive patients had 280% higher CypD acetylation coupled with reduced Sirt3 (sirtuin 3) and increased GCN5L1 levels. GCN5L1 regulates mitochondrial protein acetylation and promotes CypD acetylation, which is counteracted by mitochondrial deacetylase Sirt3. In human aortic endothelial cells, GCN5L1 depletion prevents superoxide overproduction. Deacetylation mimetic CypD-K166R mice were protected from vascular oxidative stress, endothelial dysfunction, and Ang II-induced hypertension. Ang II-induced hypertension increased mitochondrial GCN5L1 and reduced Sirt3 levels resulting in a 250% increase in GCN5L1/Sirt3 ratio promoting CypD acetylation. Treatment with mitochondria-targeted scavenger of cytotoxic isolevuglandins (mito2HOBA) normalized GCN5L1/Sirt3 ratio, reduced CypD acetylation, and attenuated hypertension. The role of mitochondrial acetyltransferase GCN5L1 in the endothelial function was tested in endothelial-specific GCN5L1 knockout mice. Depletion of endothelial GCN5L1 prevented Ang II-induced mitochondrial oxidative stress, reduced the maladaptive switch of vascular metabolism to glycolysis, prevented inactivation of endothelial nitric oxide, preserved endothelial-dependent relaxation, and attenuated hypertension. CONCLUSIONS: These data support the pathogenic role of CypD acetylation in endothelial dysfunction and hypertension. We suggest that targeting cytotoxic mitochondrial isolevuglandins and GCN5L1 reduces CypD acetylation, which may be beneficial in cardiovascular disease.
Assuntos
Endotélio Vascular , Hipertensão , Mitocôndrias , Sirtuína 3 , Animais , Feminino , Humanos , Masculino , Camundongos , Acetilação , Angiotensina II , Células Cultivadas , Células Endoteliais/metabolismo , Células Endoteliais/enzimologia , Endotélio Vascular/metabolismo , Endotélio Vascular/fisiopatologia , Hipertensão/metabolismo , Hipertensão/fisiopatologia , Hipertensão/genética , Camundongos Endogâmicos C57BL , Camundongos Knockout , Mitocôndrias/metabolismo , Proteínas Mitocondriais/metabolismo , Proteínas Mitocondriais/genética , Proteínas do Tecido Nervoso , Estresse Oxidativo , Sirtuína 3/metabolismo , Sirtuína 3/genéticaRESUMO
Mammalian sleep is regulated by a homeostatic process that increases sleep drive and intensity as a function of prior wake time. Sleep homeostasis has traditionally been thought to be a product of neurons, but recent findings demonstrate that this process is also modulated by glial astrocytes. The precise role of astrocytes in the accumulation and discharge of sleep drive is unknown. We investigated this question by selectively activating basal forebrain (BF) astrocytes using designer receptors exclusively activated by designer drugs (DREADDs) in male and female mice. DREADD activation of the Gq-protein-coupled pathway in BF astrocytes produced long and continuous periods of wakefulness that paradoxically did not cause the expected homeostatic response to sleep loss (e.g., increases in sleep time or intensity). Further investigations showed that this was not because of indirect effects of the ligand that activated DREADDs. These findings suggest that the need for sleep is not only driven by wakefulness per se, but also by specific neuronal-glial circuits that are differentially activated in wakefulness.SIGNIFICANCE STATEMENT Sleep drive is controlled by a homeostatic process that increases sleep duration and intensity based on prior time spent awake. Non-neuronal brain cells (e.g., glial astrocytes) influence this homeostatic process, but their precise role is unclear. We used a genetic technique to activate astrocytes in the basal forebrain (BF) of mice, a brain region important for sleep and wake expression and sleep homeostasis. Astroglial activation induced prolonged wakefulness without the expected homeostatic increase in sleep drive (i.e., sleep duration and intensity). These findings indicate that our need to sleep is also driven by non-neuronal cells, and not only by time spent awake.
Assuntos
Prosencéfalo Basal , Vigília , Camundongos , Masculino , Feminino , Animais , Vigília/fisiologia , Astrócitos , Prosencéfalo Basal/fisiologia , Sono/fisiologia , Neurônios/fisiologia , MamíferosRESUMO
Herein, we present the discovery and development of the first photoredox-catalyzed alkoxy diazomethylation of alkenes with hypervalent iodine reagents and alcohols. This multicomponent process represents a new disconnection approach to diazo compounds and is featured by a broad scope, mild reaction conditions, and excellent selectivity. Key to the process was the generation of diazomethyl radicals, which engaged alkenes and alcohols in an inter- and intramolecular fashion by a photoredox-catalyzed oxidative radical-polar crossover leading to unexplored ß-alkoxydiazo compounds. The synthetic utility of such diazo compounds was demonstrated with a series of transformations involving C-H, N-H, and O-H insertions as well as in the construction of complex sp3-rich heterocycles.
RESUMO
BACKGROUND: The best approaches to supplemental oxygen administration during surgery remain unclear, which may contribute to variation in practice. We aimed to assess determinants of oxygen administration and its variability during surgery. METHODS: Using multivariable linear mixed-effects regression, we measured the associations between intraoperative fraction of inspired oxygen and patient, procedure, medical center, anesthesiologist, and in-room anesthesia provider factors in surgical cases of 120 minutes or longer in adult patients who received general anesthesia with tracheal intubation and were admitted to the hospital after surgery between January 2016 and January 2019 at 42 medical centers across the U.S. participating in the Multicenter Perioperative Outcomes Group data registry. RESULTS: The sample included 367,841 cases (median [25 th, 75 th] age, 59 [47, 69] years; 51.1% women; 26.1% treated with nitrous oxide) managed by 3,836 anesthesiologists and 15,381 in-room anesthesia providers. Median (25 th, 75 th) fraction of inspired oxygen was 0.55 (0.48, 0.61), with 6.9% of cases <0.40 and 8.7% >0.90. Numerous patient and procedure factors were statistically associated with increased inspired oxygen, notably advanced ASA classification, heart disease, emergency surgery, and cardiac surgery, but most factors had little clinical significance (<1% inspired oxygen change). Overall, patient factors only explained 3.5% (95% CI, 3.5 to 3.5) of the variability in oxygen administration and procedure factors 4.4% (4.2 to 4.6). Anesthesiologist explained 7.7% (7.2 to 8.2) of the variability in oxygen administration, in-room anesthesia provider 8.1% (7.8 to 8.4), medical center 23.3% (22.4 to 24.2), and 53.0% (95% CI, 52.4 to 53.6) was unexplained. CONCLUSIONS: Among adults undergoing surgery with anesthesia and tracheal intubation, supplemental oxygen administration was variable and appeared arbitrary. Most patient and procedure factors had statistical but minor clinical associations with oxygen administration. Medical center and anesthesia provider explained significantly more variability in oxygen administration than patient or procedure factors.
RESUMO
There has been a growing recognition of the need for diversity and inclusion in scientific fields. This trend is reflected in the Journal of Chemical Information and Modeling (JCIM), where there has been a gradual increase in the number of papers that embrace this diversity. In this viewpoint, we analyze the evolution of the profile of papers published in JCIM from 1996 to 2022 addressing three diversity criteria, namely interdisciplinarity, geographic and gender distributions, and their impact on citation patterns. We used natural language processing tools for the classification of main areas and gender, as well as metadata, to analyze a total of 7384 articles published in the categories of research articles, reviews, and brief reports. Our analyses reveal that the relative number of articles and citation patterns are similar across the main areas within the scope of JCIM, and international collaboration and publications encompassing two to three research areas attract more citations. The percentage of female authors has increased from 1996 (less than 20%) to 2022 (more than 32%), indicating a positive trend toward gender diversity in almost all geographic regions, although the percentage of publications by single female authors remains lower than 20%. Most JCIM citations come from Europe and the Americas, with a tendency for JCIM papers to cite articles from the same continent. Furthermore, there is a correlation between the gender of the authors, as JCIM manuscripts authored by females are more likely to be cited by other JCIM manuscripts authored by females.
Assuntos
Modelos Químicos , Processamento de Linguagem Natural , Feminino , HumanosRESUMO
Nature has a remarkable ability to carry out site-selective post-translational modification of proteins, therefore enabling a marked increase in their functional diversity1. Inspired by this, chemical tools have been developed for the synthetic manipulation of protein structure and function, and have become essential to the continued advancement of chemical biology, molecular biology and medicine. However, the number of chemical transformations that are suitable for effective protein functionalization is limited, because the stringent demands inherent to biological systems preclude the applicability of many potential processes2. These chemical transformations often need to be selective at a single site on a protein, proceed with very fast reaction rates, operate under biologically ambient conditions and should provide homogeneous products with near-perfect conversion2-7. Although many bioconjugation methods exist at cysteine, lysine and tyrosine, a method targeting a less-explored amino acid would considerably expand the protein functionalization toolbox. Here we report the development of a multifaceted approach to protein functionalization based on chemoselective labelling at methionine residues. By exploiting the electrophilic reactivity of a bespoke hypervalent iodine reagent, the S-Me group in the side chain of methionine can be targeted. The bioconjugation reaction is fast, selective, operates at low-micromolar concentrations and is complementary to existing bioconjugation strategies. Moreover, it produces a protein conjugate that is itself a high-energy intermediate with reactive properties and can serve as a platform for the development of secondary, visible-light-mediated bioorthogonal protein functionalization processes. The merger of these approaches provides a versatile platform for the development of distinct transformations that deliver information-rich protein conjugates directly from the native biomacromolecules.
Assuntos
Metionina/química , Metionina/metabolismo , Proteínas/química , Proteínas/metabolismo , Iodo/química , Substâncias Macromoleculares/química , Processamento de Proteína Pós-Traducional , Compostos de Sulfônio/química , Compostos de Sulfônio/metabolismoRESUMO
Carbon has the unique ability to bind four atoms and form stable tetravalent structures that are prevalent in nature. The lack of one or two valences leads to a set of species-carbocations, carbanions, radicals and carbenes-that is fundamental to our understanding of chemical reactivity. In contrast, the carbyne-a monovalent carbon with three non-bonded electrons-is a relatively unexplored reactive intermediate; the design of reactions involving a carbyne is limited by challenges associated with controlling its extreme reactivity and the lack of efficient sources. Given the innate ability of carbynes to form three new covalent bonds sequentially, we anticipated that a catalytic method of generating carbynes or related stabilized species would allow what we term an 'assembly point' disconnection approach for the construction of chiral centres. Here we describe a catalytic strategy that generates diazomethyl radicals as direct equivalents of carbyne species using visible-light photoredox catalysis. The ability of these carbyne equivalents to induce site-selective carbon-hydrogen bond cleavage in aromatic rings enables a useful diazomethylation reaction, which underpins sequencing control for the late-stage assembly-point functionalization of medically relevant agents. Our strategy provides an efficient route to libraries of potentially bioactive molecules through the installation of tailored chiral centres at carbon-hydrogen bonds, while complementing current translational late-stage functionalization processes. Furthermore, we exploit the dual radical and carbene character of the generated carbyne equivalent in the direct transformation of abundant chemical feedstocks into valuable chiral molecules.
RESUMO
BACKGROUND: The prevalence of peripheral artery disease (PAD) in the general population is about 12% to 14% and it increases with age. PAD increased from 164 million people in 2000 to 202 million people in 2010. More than two-thirds of people with PAD are based in low- or middle-income countries. Critical limb ischaemia (CLI) occurs in 1% to 2% of people with intermittent claudication over five years. One third of people with CLI have isolated below the knee (BTK) lesions. CLI and isolated BTK lesions are associated with a higher incidence of limb loss when compared with people with multilevel arterial disease. Endovascular procedures such as angioplasty (with or without stenting) are widely used to treat isolated BTK lesions, aiming to improve blood flow and limb salvage. The technical success of any angioplasty procedure depends on the ability to cross the target lesion. Failed attempts are underestimated in the literature and failures in the real world appear to be higher than reported. People with isolated BTK lesions undergoing angioplasty by conventional femoral access present a high failure rate to cross these lesions. Retrograde distal access may provide some advantages that can lead to successful crossing of the target lesion. OBJECTIVES: To evaluate the benefits and harms of retrograde distal access versus conventional femoral access for people undergoing below the knee angioplasty. SEARCH METHODS: The Cochrane Vascular Information Specialist searched the Cochrane Vascular Specialised Register, CENTRAL, MEDLINE, Embase and CINAHL databases, and World Health Organization International Clinical Trials Registry Platform and ClinicalTrials.gov trials registers to 26 September 2022. SELECTION CRITERIA: We planned to include randomised or quasi-randomised controlled trials comparing people undergoing retrograde distal access versus people undergoing conventional femoral access (ipsilateral antegrade or contralateral retrograde) for BTK angioplasty. DATA COLLECTION AND ANALYSIS: Two review authors independently assessed identified studies for potential inclusion in the review. We used standard methodological procedures in accordance with the Cochrane Handbook for Systematic Review of Interventions. Our primary outcomes were technical success of angioplasty procedure and major procedural complications. Our secondary outcomes were mortality rate, amputation-free survival, primary patency, minor procedural complications and wound healing. We planned to use GRADE to assess the certainty of the evidence for each outcome. MAIN RESULTS: We identified no randomised or quasi-randomised controlled trials that met the inclusion criteria. AUTHORS' CONCLUSIONS: We identified no randomised or quasi-randomised controlled trials that compared retrograde distal access versus femoral access for BTK angioplasty. High-quality studies that compare retrograde distal access versus conventional femoral access for BTK angioplasty are needed.
Assuntos
Angioplastia , Articulação do Joelho , Doença Arterial Periférica , Humanos , Fêmur , Articulação do Joelho/irrigação sanguínea , Articulação do Joelho/cirurgia , Doença Arterial Periférica/cirurgiaRESUMO
BACKGROUND: Patients who present with problems with definitive dialysis access (arteriovenous fistula (AVF) or arteriovenous graft (AVG)) become catheter dependent (temporary access), a condition that often carries a higher risk of infections, central venous occlusions and recurrent hospitalisations. For AVG, primary patency rates are reported to be 30% to 90% in patients undergoing thrombectomy or thrombolysis. According to the National Kidney Foundation-Kidney Disease Outcomes Quality Initiative (NKF-KDOQI) guidelines, surgery is preferred when the cause of the thrombosis is a stenosis at the site of the anastomosis in thrombosed AVF. The European Best Practice Guidelines (EBPG) reported that thrombosed AVF may be preferably treated with endovascular techniques, but when the cause of thrombosis is in the anastomosis, surgery provides better results with re-anastomosis. Therefore, there is a need to carry out a systematic review to determine the effectiveness and safety of the intervention for thrombosed fistulae. OBJECTIVES: This review aims to establish the efficacy and safety of interventions for failed AVF and AVG in patients receiving haemodialysis (HD). SEARCH METHODS: We searched the Cochrane Kidney and Transplant Register of Studies up to 28 January 2024 through contact with the Information Specialist using search terms relevant to this review. Studies in the Register are identified through searches of CENTRAL, MEDLINE, EMBASE, conference proceedings, the International Clinical Trials Registry Portal (ICTRP) Search Portal and ClinicalTrials.gov. SELECTION CRITERIA: The review included randomised controlled trials (RCTs) and quasi-RCTs in people undergoing HD treatment using AVF or AVG presenting with clinical or haemodynamic evidence of thrombosis. Patients had to have used an AVF or AVG at least once. DATA COLLECTION AND ANALYSIS: Summary estimates of effect were obtained using a random-effects model, and results were expressed as risk ratios (RR) and their 95% confidence intervals (CI) for dichotomous outcomes. Confidence in the evidence was assessed using the Grading of Recommendations Assessment, Development and Evaluation (GRADE) approach. MAIN RESULTS: Our search strategy identified 14 eligible studies (1176 randomised participants) for inclusion in this review. We included three types of interventions for the treatment of thrombosed AVF and AVG: (1) types of thrombectomy, (2) types of thrombolysis and (3) surgical procedures. Most of the included studies had a high risk of bias due to a poor study design, a low number of patients and industry involvement. Overall, there was insufficient evidence to suggest that a specific intervention was better than another for the outcomes of failure, primary patency at 30 days, technical success and adverse events (both major and minor). Primary patency at 30 days may improve with surgical compared to mechanical thrombectomy (3 studies, 404 participants: RR 1.36, 95% CI 1.07 to 1.67); however, the evidence is very uncertain. Death, access dysfunction, successful dialysis, and SONG (Standards Outcomes in Nephrology) outcomes were rarely reported. The current review is limited by the small number of available studies with a limited number of patients enrolled. Most of the studies included in this review have a high risk of bias and a low or very low certainty of evidence. Further research is required to define the most effective and clinically appropriate technique for access dysfunction. AUTHORS' CONCLUSIONS: It remains unclear whether any intervention therapy affects the patency at 30 days or failure in any thrombosed HD AV access (very low certainty of evidence). Future research will very likely change the evidence base. Based on the importance of HD access to these patients, future studies of these interventions among people receiving HD should be a priority.
Assuntos
Fístula Arteriovenosa , Trombose , Humanos , Trombose/etiologia , Trombose/cirurgia , Trombectomia , Rim , Diálise RenalRESUMO
The identification and physical interpretation of arbitrary quantum correlations are not always effortless. Two features that can significantly influence the dispersion of the joint observable outcomes in a quantum bipartite system composed of systems I and II are: (a) All possible pairs of observables describing the composite are equally probable upon measurement, and (b) The absence of concurrence (positive reinforcement) between any of the observables within a particular system; implying that their associated operators do not commute. The so-called EPR states are known to observe (a). Here, we demonstrate in very general (but straightforward) terms that they also satisfy condition (b), a relevant technical fact often overlooked. As an illustration, we work out in detail the three-level systems, i.e., qutrits. Furthermore, given the special characteristics of EPR states (such as maximal entanglement, among others), one might intuitively expect the CHSH correlation, computed exclusively for the observables of qubit EPR states, to yield values greater than two, thereby violating Bell's inequality. We show such a prediction does not hold true. In fact, the combined properties of (a) and (b) lead to a more limited range of values for the CHSH measure, not surpassing the nonlocality threshold of two. The present constitutes an instructive example of the subtleties of quantum correlations.
RESUMO
We describe the first catalytic generation of Fischer-type acyloxy Rh(II)-carbenes from carboxylic acids and Rh(II)-carbynoids. This novel class of transient donor/acceptor Rh(II)-carbenes evolved through a cyclopropanation process providing access to densely functionalized cyclopropyl-fused lactones with excellent diastereoselectivity. DFT calculations allowed the analysis of the properties of Rh(II)-carbynoids and acyloxy Rh(II)-carbenes as well as the characterization of the mechanism.
RESUMO
BACKGROUND: Renal ischemia and reperfusion (IR) contribute to perioperative acute kidney injury, and oxygen is a key regulator of this process. We hypothesized that oxygen administration during surgery and renal IR would impact postoperative kidney function and injury in mice. METHODS: Mice were anesthetized, intubated, and mechanically ventilated with a fraction of inspired oxygen (F io2 ) 0.10 (hypoxia), 0.21 (normoxia), 0.60 (moderate hyperoxia), or 1.00 (severe hyperoxia) during 67 minutes of renal IR or sham IR surgery. Additional mice were treated before IR or sham IR surgery with 50 mg/kg tempol, a superoxide scavenger. At 24 hours, mice were sacrificed, and blood and kidney collected. We assessed and compared kidney function and injury across groups by measuring blood urea nitrogen (BUN, primary end point), renal histological injury, renal expression of neutrophil gelatinase-associated lipocalin (NGAL), and renal heme oxygenase 1 ( Ho-1 ), peroxisome proliferator-activated receptor gamma coactivator 1-α ( Pgc1-α ), and glutathione peroxidase 4 ( Gpx-4 ) transcripts, to explore potential mechanisms of any effect of oxygen. RESULTS: Hyperoxia and hypoxia during renal IR surgery decreased renal function and increased kidney injury compared to normoxia. Baseline median (interquartile range) BUN was 22.2 mg/dL (18.4-26.0), and 24 hours after IR surgery, BUN was 17.5 mg/dL (95% confidence interval [CI], 1.3-38.4; P = .034) higher in moderate hyperoxia-treated animals, 51.8 mg/dL (95% CI, 24.9-74.8; P < .001) higher in severe hyperoxia-treated animals, and 64.9 mg/dL (95% CI, 41.2-80.3; P < .001) higher in hypoxia-treated animals compared to animals treated with normoxia ( P < .001, overall effect of hyperoxia). Hyperoxia-induced injury, but not hypoxia-induced injury, was attenuated by pretreatment with tempol. Histological injury scores, renal NGAL staining, and renal transcription of Ho-1 and suppression of Pgc1- α followed the same pattern as BUN, in relation to the effects of oxygen treatment. CONCLUSIONS: In this controlled preclinical study of oxygen treatment during renal IR surgery, hyperoxia and hypoxia impaired renal function, increased renal injury, and impacted expression of genes that affect mitochondrial biogenesis and antioxidant response. These results might have implications for patients during surgery when high concentrations of oxygen are frequently administered, especially in cases involving renal IR.
RESUMO
OBJECTIVES: This study aimed to determine whether blood pressure control in the early postoperative period was associated with postoperative delirium in the cardiovascular intensive care unit (ICU). DESIGN: Observational cohort study. SETTING: Single large academic institution with a high volume of cardiac surgery. PARTICIPANTS: Cardiac surgery patients admitted to the cardiovascular ICU after surgery. INTERVENTIONS: Observational study. MEASUREMENTS AND MAIN RESULTS: A total of 517 cardiac surgery patients had mean arterial pressure (MAP) data recorded minute-by-minute for 12 postoperative hours. The time spent in each of the 7 prespecified blood pressure bands was calculated, and the development of delirium was recorded in the ICU. A multivariate Cox regression model was developed using the least absolute shrinkage and selection operator approach to identify associations between time spent in each MAP range band and delirium. Compared with the reference band of 60-to-69 mmHg, longer durations spent in 3 bands were independently associated with a lower risk of delirium: 50-to-59 mmHg band (adjusted hazard ratio [HR] 0.907 [per 10 minutes]; 95% CI 0.861-0.955); 70-to-79 mmHg band (adjusted HR 0.923 [per 10 minutes]; 95% CI 0.902-0.944); 90-to-99 mmHg band (adjusted HR 0.898 [per 10 minutes]; 95% CI 0.853-0.945). CONCLUSIONS: The MAP range bands above and below the authors' reference band of 60-to- 69 mmHg were associated with decreased risk of ICU delirium development; however, this was difficult to reconcile with a plausible biologic mechanism. Therefore, the authors did not find a correlation between early postoperative MAP control and increased risk of the development of ICU delirium after cardiac surgery.
Assuntos
Procedimentos Cirúrgicos Cardíacos , Delírio , Humanos , Pressão Sanguínea , Delírio/diagnóstico , Delírio/epidemiologia , Delírio/etiologia , Estudos de Coortes , Procedimentos Cirúrgicos Cardíacos/efeitos adversos , Unidades de Terapia Intensiva , Complicações Pós-Operatórias/diagnóstico , Complicações Pós-Operatórias/epidemiologia , Complicações Pós-Operatórias/prevenção & controle , Fatores de RiscoRESUMO
The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.
RESUMO
The concentration of pollutant gases emitted by traffic in a tunnel affects the indoor air quality and contributes to structural deterioration. Demand control ventilation systems incur high operating costs, so reliable measurement of the gas concentration is essential. Numerous commercial sensor types are available with proven experience, such as optical and first-generation electrochemical sensors, or novel materials in detection methods. However, all of them are subjected to measurement deviations due to environmental conditions. This paper presents the main types of sensors and their application in tunnels. Solutions will also be discussed in order to obtain reliable measurements and improve the efficiency of the extraction systems.
RESUMO
Modern embedded systems have achieved relatively high processing power. They can be used for edge computing and computer vision, where data are collected and processed locally, without the need for network communication for decision-making and data analysis purposes. Face detection, face recognition, and pose detection algorithms can be executed with acceptable performance on embedded systems and are used for home security and monitoring. However, popular machine learning frameworks, such as MediaPipe, require relatively high usage of CPU while running, even when idle with no subject in the scene. Combined with the still present false detections, this wastes CPU time, elevates the power consumption and overall system temperature, and generates unnecessary data. In this study, a low-cost low-resolution infrared thermal sensor array was used to control the execution of MediaPipe's pose detection algorithm using single-board computers, which only runs when the thermal camera detects a possible subject in its field of view. A lightweight algorithm with several filtering layers was developed, which allowed the effective detection and isolation of a person in the thermal image. The resulting hybrid computer vision proved effective in reducing the average CPU workload, especially in environments with low activity, almost eliminating MediaPipe's false detections, and reaching up to 30% power saving in the best-case scenario.
Assuntos
Algoritmos , Carga de Trabalho , Humanos , Computadores , Aprendizado de MáquinaRESUMO
Herein, we disclose the first regio-, site- and chemoselective late-stage (hetero)aryl C-H bond cyclopropenylation with cyclopropenium cations (CPCs). The process is fast, operationally simple and shows an excellent functional group tolerance in densely-functionalized drug molecules, natural products, agrochemicals and fluorescent dyes. Moreover, we discovered that the installation of the cyclopropene ring in drug molecules could not only be used to shield against metabolic instability but also as a synthetic tool to reach medicinally-relevant sp3 -rich scaffolds exploiting the highly-strained nature of the cyclopropene ring with known transformations.
RESUMO
A frontier challenge in single-atom (SA) catalysis is the design of fully inorganic sites capable of emulating the high reaction selectivity traditionally exclusive of organometallic counterparts in homogeneous catalysis. Modulating the direct coordination environment in SA sites, via the exploitation of the oxide support's surface chemistry, stands as a powerful albeit underexplored strategy. We report that isolated Rh atoms stabilized on oxygen-defective SnO2 uniquely unite excellent TOF with essentially full selectivity in the gas-phase hydroformylation of ethylene, inhibiting the thermodynamically favored olefin hydrogenation. Density Functional Theory calculations and surface characterization suggest that substantial depletion of the catalyst surface in lattice oxygen, energetically facile on SnO2 , is key to unlock a high coordination pliability at the mononuclear Rh centers, leading to an exceptional performance which is on par with that of molecular catalysts in liquid media.
RESUMO
Herein, we report the first catalytic one-step synthesis of cyclopropenium cations (CPCs) with readily available alkynes and hypervalent iodine reagents as carbyne sources. Key to the process is the catalytic generation of a novel Rh-carbynoid that formally transfers monovalent cationic carbynes (:+C-R) to alkynes via an oxidative [2+1] cycloaddition. Our process is able to synthesize a new type of CPC substituted with an ester group that underpins the regioselective attack of a broad range of carbon and heteroatomic nucleophiles, thus providing a new platform for the synthesis of valuable cyclopropenes difficult or not possible to make by current methodologies.