RESUMO
INTRODUCTION: In extending work on early life antecedents of parenting, we investigate associations between childhood family history of disadvantage, adolescent socioemotional wellbeing, and age at first parenthood and subsequent parenting behaviour. METHODS: Parent-child interactions were recorded when participants in the longitudinal Dunedin Multidisciplinary Health and Development Study (New Zealand) had a three-year-old child. Data were available for 358 mothers and 321 fathers, aged between 17.7 and 41.5 at the time of their child's birth. Associations between parenting and antecedent data on socioeconomic disadvantage, adolescent wellbeing and mental health, as well as current adult mental health and age at parenting, were tested for using structural equation modelling. RESULTS: Family disadvantage in childhood and lower adolescent wellbeing was associated with less positive future parenting, but only adult (not adolescent) anxiety/depression symptoms were directly associated with parenting behaviour. Childhood family disadvantage was associated with further disadvantage across the life course that included less positive parenting of the next generation. In contrast, socioemotional wellbeing during adolescence and later age of onset of parenting were associated with more positive parenting. CONCLUSIONS: Reducing childhood disadvantage and improving socioemotional wellbeing during childhood and adolescence is likely to have intergenerational benefits through better parenting of the next generation.
Assuntos
Saúde do Adolescente , Poder Familiar , Adolescente , Adulto , Pré-Escolar , Feminino , Humanos , Saúde Mental , Mães , Relações Pais-Filho , Adulto JovemRESUMO
Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5'TCCGTAGGTGAACCTGCGG) and ITS4 (5'TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be "mainly" associated with legumes is C. epithymum Murr., and C. pentagona is "especially" associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2). References: (1) M. Costea et al. SIDA 22:151, 2006. (2) Y. Goldwasser et al. Weed Res. 52:122, 2012. (3) C. L. Hitchcock and A. Cronquist. Flora of the Pacific Northwest: An Illustrated Manual. University of Washington Press, Seattle, 1973. (4) D. Rubiales et al. Dodder. Page 98 in: Compendium of Chickpea and Lentil Diseases and Pests. W. Chen et al., eds. APS Press, St. Paul, Minnesota, 2011.
RESUMO
Although there are more than 200 odor-causing volatile organic compounds (VOCs), phenol and p-cresol are two prominent odor-causing VOCs found downwind from concentrated animal feeding operations (CAFOs). The VOC emissions from cattle and dairy production are difficult to quantify accurately because of their low concentrations, spatial variability, and limitations of available instruments. To quantify VOCs, a protocol following US. Environmental Protection Agency (EPA) Method TO-14A has been established based on the isolation flux chamber method and a portable gas chromatograph (GC) coupled with a purge-and-trap system. The general objective of this research was to quantify phenol and p-cresol emission rates (ERs) from different ground-level area sources (GLASs) in a free-stall dairy during summer and winter seasons using this protocol. Two-week-long sampling campaigns were conducted in a dairy operation in central Texas. Twenty-nine air samples were collected during winter and 37 samples were collected during summer from six specifically delineated GLASs (barn, loafing pen, lagoon, settling basin, silage pile, and walkway) at the free-stall dairy. Thirteen VOCs were identified during the sampling period and the GC was calibrated for phenol and p-cresol, the primary odorous VOCs identified. The overall calculated ERs for phenol and p-cresol were 2656 +/- 728 and 763 +/- 212 mg hd(-1) day(-1), respectively, during winter. Overall phenol and p-cresol ERs were calculated to be 1183 +/- 361 and 551 +/- 214 mg hd(-1) day(-1), respectively, during summer. In general, overall phenol and p-cresol ERs during winter were about 2.3 and 1.4 times, respectively, higher than those during summer.
Assuntos
Poluentes Atmosféricos/química , Bovinos , Cresóis/química , Indústria de Laticínios , Monitoramento Ambiental/métodos , Fenol/química , Animais , Abrigo para Animais , Odorantes , Estações do Ano , Texas , Compostos Orgânicos VoláteisRESUMO
Potable water is an essential and major input in processing our food supplies, and the continued growth in food manufacturing is placing increased pressure on this limited resource. Recycling and reuse of factory wastewater can lessen potable water use but requires a detailed understanding of wastewater properties. This study uses solid-phase extraction techniques with gas chromatography-mass spectrometry analysis to investigate trace-level semivolatile organic species in various waste and reference waters associated with the Burra Foods milk-processing plant located in Southeastern Australia. Our focus was on contaminants containing phenolic and heterocyclic nitrogen functional groups, which, because of their toxicity and persistence, may limit options for water recycling and reuse. Effluent from the wastewater treatment plant of the factory showed both the highest soluble carbon burden (47 mg/kg) and concentrations of target compounds. The target species found in these effluents included methyl phenol (13 mg/kg), hydroxy indole (9.8 mg/kg), synthetic tolyltriazoles (5.1 mg/kg) and alkyl phenol ethoxylates (0.2 mg/kg). Given the environmental stability of the tolyltriazoles, they may act as chemical markers where these effluents are used for purposes such as irrigation. Milk evaporator condensate waters, in contrast to the effluent, contained very few target species, with only low levels of pyrrolidine and piperidine derivatives such as ethylglutarimide (450 mug/L) detected. Although there were fewer target microcontaminants overall in the potable and creek reference waters, these samples had characteristic profiles. The potable water analysis revealed hydroxy cineole (2.1 microg/L) and the creek analysis revealed dichlorohydroxyacetophenone (0.3 microg/L), which were not detected in other waters. The compounds found in the wastewaters are likely to have been derived from milk or synthetic chemicals used in factory operations. The presence of nitrogen compounds in all the different milk-processing waters suggest their likely source was milk, probably milk phosphoproteins subjected to thermal, chemical, or microbial degradation. Our benign results for the condensates suggest it may be possible to substitute condensate for potable water with minimal pretreatment, both within the plant and in other applications, such as irrigation of recreation turf.
Assuntos
Manipulação de Alimentos , Resíduos Industriais/análise , Leite , Compostos de Nitrogênio/análise , Fenóis/análise , Eliminação de Resíduos Líquidos , Água/química , Animais , Austrália , Cromatografia Gasosa-Espectrometria de MassasRESUMO
As a first step in studying the effects of membrane lipid modification on complex cellular functions we have modified the membrane fatty acid composition of the neuroblastoma X glioma hybrid clone, NG108-15. These cultured cells were chosen because they exhibit many complex neuronal functions in vitro. Unsaturated fatty acids (oleate, linoleate, linolenate and arachidonate) were accumulated, metabolized and esterified by the cells. These unsaturated fatty acids stimulated cell growth, whereas saturated fatty acids were toxic to the cells. Changes as large as 40-fold in the ratio of monounsaturated/polyunsaturated fatty acids in the membrane phospholipids were produced by addition of fatty acids directly to serum-containing culture medium. As a result of the exposure of NG108-15 cells to unsaturated fatty acids the amount of phosphatidylethanolamine in the cells was increased by as much as 60%. Polyunsaturated fatty acids also caused a small decrease in the membrane cholesterol/phospholipid molar ratio. These experiments demonstrate that large changes in membrane fatty acid composition can be created in clonal cells capable of differentiated neuronal activities. Additional changes in membrane lipid composition also appear to be induced by these manipulations. The question of the importance of specific membrane lipid composition to neuronal cellular function now can be addressed.
Assuntos
Ácidos Graxos/metabolismo , Células Híbridas/metabolismo , Lipídeos de Membrana/metabolismo , Animais , Ácidos Araquidônicos/metabolismo , Linhagem Celular , Ácidos Graxos não Esterificados/metabolismo , Ácidos Graxos Insaturados/metabolismo , Glioma , Ácidos Linoleicos/metabolismo , Metabolismo dos Lipídeos , Camundongos , Neuroblastoma , Fosfolipídeos/biossínteseRESUMO
The cholesteryl ester content of Erhlich cells was increased in tumors grown in mice fed saturated fat diets (coconut oil or tristearin) as compared with polyunsaturated fat diet (sunflower oil). Cholesteryl esters containing monoenoic fatty acids were the predominant species that accumulated in the cells grown on unsaturated fat. The increase in cholesteryl esters was not accompanied by corresponding increases in the cell content of phospholipids, triacylglycerols, unesterified cholestorol or proteins. This experimental system may be useful for obtaining basic information about intracelluar cholesteryl ester accumulation, process that occurs in atherosclerosis.
Assuntos
Carcinoma de Ehrlich/metabolismo , Colesterol/metabolismo , Gorduras na Dieta , Ácidos Graxos/farmacologia , Animais , Cocos , Ésteres , Masculino , Camundongos , Óleos/farmacologia , Ácidos Esteáricos/farmacologia , TriglicerídeosRESUMO
We investigated the prevalence of DSM-III disorders in 792 children aged 11 years from the general population and found an overall prevalence of disorder of 17.6% with a sex ratio (boys-girls) of 1.7:1. The most prevalent disorders were attention deficit, oppositional, and separation anxiety disorders, and the least prevalent were depression and social phobia. Conduct disorder, overanxious disorder, and simple phobia had intermediate prevalences. Pervasive disorders, reported by more than one source, had an overall prevalence of 7.3%. Examination of background behavioral data disclosed that children identified at 11 years as having multiple disorders had a history of behavior problems since 5 years of age on parent and teacher reports. Fifty-five percent of the disorders occurred in combination with one or more other disorders, and 45% as a single disorder.
Assuntos
Transtornos Mentais/epidemiologia , Transtornos de Ansiedade/diagnóstico , Transtornos de Ansiedade/epidemiologia , Transtorno do Deficit de Atenção com Hiperatividade/diagnóstico , Transtorno do Deficit de Atenção com Hiperatividade/epidemiologia , Criança , Transtornos do Comportamento Infantil/diagnóstico , Transtornos do Comportamento Infantil/epidemiologia , Estudos Transversais , Transtorno Depressivo/diagnóstico , Transtorno Depressivo/epidemiologia , Deficiências do Desenvolvimento/diagnóstico , Deficiências do Desenvolvimento/epidemiologia , Feminino , Humanos , Masculino , Manuais como Assunto , Transtornos Mentais/diagnóstico , Nova Zelândia , Transtornos Fóbicos/diagnóstico , Transtornos Fóbicos/epidemiologia , Escalas de Graduação PsiquiátricaRESUMO
We investigated the prevalence of depression in a sample of 9-year-old children from the general population being studied longitudinally. Current point prevalences of major and minor depressive disorder were estimated at 1.8% and 2.5%, respectively. A comparison of children with depression and a nondepressed group disclosed no significant differences by sex, nor any significant association between depression and socioeconomic status, teacher reports of behavior problems, and cognitive or motor development. The children with current depression were reported by a parent to have had a history of more behavioral problems, had been referred more often for assessment or treatment of behavioral or emotional problems, and had more negative self-perceptions of their academic ability. The results suggested that parents may be more sensitive than teachers to the behavior problems exhibited by depressed children.
Assuntos
Transtorno Depressivo/epidemiologia , Logro , Sintomas Afetivos/complicações , Sintomas Afetivos/diagnóstico , Fatores Etários , Criança , Transtornos do Comportamento Infantil/complicações , Transtornos do Comportamento Infantil/diagnóstico , Pré-Escolar , Transtorno Depressivo/complicações , Transtorno Depressivo/diagnóstico , Feminino , Humanos , Estudos Longitudinais , Masculino , Nova Zelândia , Pais/psicologia , Escalas de Graduação Psiquiátrica , Testes Psicológicos , Autoimagem , Fatores Sexuais , Classe Social , EnsinoRESUMO
ABSTRACT Development of pea cultivars resistant to Aphanomyces root rot, the most destructive root disease of pea worldwide, is a major disease management objective. In a previous study of a mapping population of 127 recombinant inbred lines (RILs) derived from the cross 'Puget' (susceptible) x '90-2079' (partially resistant), we identified seven genomic regions, including a major quantitative trait locus (QTL), Aph1, associated with partial resistance to Aphanomyces root rot in U.S. fields (21). The objective of the present study was to evaluate, in the same mapping population, the specificity versus consistency of Aphanomyces resistance QTL under two screening conditions (greenhouse and field, by comparison with the previous study) and with two isolates of Aphanomyces euteiches originating from the United States and France. The 127 RILs were evaluated in the greenhouse for resistance to pure culture isolates SP7 (United States) and Ae106 (France). Using the genetic map previously described, a total of 10 QTL were identified for resistance in greenhouse conditions to the two isolates. Among these were Aph1, Aph2, and Aph3, previously detected for partial field resistance in the United States. Aph1 and Aph3 were detected with both isolates and Aph2 with only the French isolate. Seven additional QTL were specifically detected with one of the two isolates and were not identified for partial field resistance in the United States. The consistency of the detected resistance QTL over two screening environments and isolates is discussed with regard to pathogen variability, and disease assessment and QTL detection methods. This study suggests the usefulness of three consistent QTL, Aph1, Aph2, and Aph3, for marker-assisted selection.
RESUMO
An index of adversity is a measure of risk that can be considered independently of individual risk factors. This study examined four areas of adversity in early childhood, namely perinatal complications, family background, child-rearing practices, and the child's physical health, and their relationship to developmental outcomes. Four indices of adversity in these areas were examined as predictors of cognitive ability and motor ability for 476 girls and 510 boys at age 5 years. Results of the study indicated that indices of family background and child-rearing practices were highly related to these developmental outcomes. An index of health problems was found to be significantly related to motor ability. The perinatal complications index was significantly related only to specific cognitive ability scores for boys. Previously, developmental outcomes have been assessed in terms of the magnitude of individual risk factors, but more effective screening procedures may need to take account of the additive effect of the number of relevant adverse risk factors.
Assuntos
Desenvolvimento Infantil , Cognição , Destreza Motora , Educação Infantil , Pré-Escolar , Cognição/fisiologia , Estudos de Coortes , Feminino , Nível de Saúde , Humanos , Recém-Nascido , Doenças do Recém-Nascido/fisiopatologia , Masculino , Destreza Motora/fisiologia , Gravidez , Complicações na Gravidez , Análise de Regressão , Fatores de Risco , Fatores SocioeconômicosRESUMO
Ultrastructural, immunochemical, fluorescence and stereological studies were undertaken on human villous trophoblast from 13 weeks of gestation to term. The aim was to describe and quantify morphological changes during proliferation, differentiation and apoptosis in cytotrophoblast and syncytial regions of non-aggregated and aggregated nuclei. Numbers of trophoblast nuclei increased continuously from 13 weeks. In term placentae, intrasyncytial differentiation was characterized ultrastructurally by gradual decreases in nuclear size and packing density accompanied by nucleolar regression, and increasing heterochromatinization, envelope convolution and packing density of nuclear pore complexes. In densely packed areas, nuclear profiles resembled interlocking jigsaw pieces. Occasionally, these 'pre-apoptotic' nuclei were associated with annulate lamellae. Rarely, nuclear changes terminated in apoptosis with a characteristic pattern of condensed peripheral chromatin, a central island of euchromatin, no nucleoli and no discernible nuclear pores. Apoptotic nuclei were seen singly and within dense nuclear aggregations. Similar spatial patterns of nuclei and chromatin were seen in propidium iodide-stained sections at 13-41 weeks. Whilst the relative incidence of intensely fluorescent nuclei remained constant, absolute numbers increased linearly during gestation and correlated positively with the volume of syncytial knots. Nuclei labelled for DNA fragmentation occurred very infrequently and were also found in nuclear clusters as well as singly. We suggest that nuclear differentiation in syncytium has two phases: on entering syncytium, nuclei become committed to a long programmed pre-apoptotic phase which leads to a short apoptotic execution phase. We propose further that clustered nuclei (pre-apoptotic and apoptotic) in syncytial knots probably represent the extrusion component of normal continuous epithelial turnover.
Assuntos
Apoptose/fisiologia , Vilosidades Coriônicas/ultraestrutura , Citoplasma/ultraestrutura , Membrana Nuclear/ultraestrutura , Trofoblastos/ultraestrutura , Diferenciação Celular/fisiologia , Divisão Celular/fisiologia , Citoplasma/metabolismo , Fragmentação do DNA , Desenvolvimento Embrionário e Fetal/fisiologia , Células Epiteliais/fisiologia , Corantes Fluorescentes , Idade Gestacional , Células Gigantes/citologia , Humanos , Imuno-Histoquímica , Microscopia Confocal , Trofoblastos/metabolismoRESUMO
OBJECTIVE: To evaluate the potential uses of telecommunications in medicine (telemedicine), determine the most important principles in designing telemedicine applications, decide what research questions to address, and identify potential barriers to full use of telemedicine. DESIGN: A consensus conference on telemedicine was convened in October 1993 to assemble a wide variety of participants with the assigned task of addressing the objective. RESULTS: Consensus was achieved on several key principles for implementation of successful telemedicine. Two of the most important principles will be (1) to focus on the needs of the underserved people more than on the capabilities of the available technologies and the regional centers and (2) to use the least expensive but appropriate telecommunications technology for any specific application. Greater professional connectivity between providers of health care in underserved areas and colleagues in tertiary medical centers is expected to minimize professional isolation in underserved areas. CONCLUSION: Telecommunications technologies have considerable potential for improving health care to the rural and underserved populations, but a systematic approach to implementation, which takes into account the identified key principles, is needed.
Assuntos
Área Carente de Assistência Médica , Telemedicina , Humanos , Estados UnidosRESUMO
A method has been developed for purification of the low molecular weight forms of seminal vesicle specific antigen (SVSA). Pooled, liquified seminal fluid was fractionated by CM cellulose chromatography followed by two cycles of monoclonal antibody affinity chromatography. Analysis of the final product shows microheterogeneity of the purified immunoreactive peptides in the range of 9-12 kDa. In one run, from 1138 mg starting material, 2.78 mg of SVSA protein was obtained, a recovery of 0.24% of the total protein in the starting material. The purified material as assessed by scanning densitometry of Coomassie stained gels is 99% pure. These findings indicate that the three-step chromatographic method is useful for purifying the low molecular weight forms of SVSA.
Assuntos
Antígenos/isolamento & purificação , Glândulas Seminais/imunologia , Anticorpos Monoclonais , Carboximetilcelulose Sódica , Cromatografia de Afinidade , Humanos , Masculino , Peso Molecular , Proteínas/imunologia , Proteínas/isolamento & purificaçãoRESUMO
Sclerosing mucoepidermoid carcinoma with eosinophilia (SMECE) is a recently described carcinoma of the thyroid gland associated with Hashimoto's thyroiditis and considered to have a relatively indolent clinical course. We describe two patients with SMECE and its aspiration and exfoliative cytologic features. Patient 1 was a 39-year-old woman with a goiter for many years. Examination of the lobectomy specimen revealed SMECE associated with Hashimoto's disease; 4 months later a total thyroidectomy was performed, metastases were found in nine lymph nodes in the neck. Two years later, fine-needle aspiration biopsy (FNAB) of a paritracheal mass revealed recurrent tumor. After 2 more years, two pleural fluid samples contained metastatic carcinoma with eosinophils. Patient 2 was a 61-year-old man with thyromegaly and vocal cord paralysis. The FNAB revealed a poorly differentiated carcinoma. The subsequent thyroidectomy demonstrated SMECE. Two years later, an FNAB of a vertebral mass demonstrated metastatic mucoepidermoid carcinoma. In all specimens, malignant cells with definite glandular and squamoid differentiation were present in small cohesive aggregates; eosinophils associated with the tumor cells were present in all specimens.
Assuntos
Carcinoma Mucoepidermoide/patologia , Eosinofilia/patologia , Neoplasias da Glândula Tireoide/patologia , Tireoidite Autoimune/patologia , Adulto , Carcinoma Mucoepidermoide/complicações , Carcinoma Mucoepidermoide/secundário , Eosinofilia/complicações , Feminino , Humanos , Neoplasias Pulmonares/patologia , Neoplasias Pulmonares/secundário , Masculino , Pessoa de Meia-Idade , Derrame Pleural/patologia , Esclerose/patologia , Neoplasias da Coluna Vertebral/patologia , Neoplasias da Coluna Vertebral/secundário , Vértebras Torácicas/patologia , Neoplasias da Glândula Tireoide/complicações , Tireoidite Autoimune/complicaçõesRESUMO
Employing a two bottle drinking procedure where an animal's preference is measured between plain water and a novel fluid, it was found that the convulsant drug Metrazol produced a conditioned taste aversion to saccharin. This finding is contrary to that of previous reports and highlights the sensitivity of the two bottle method in detecting a taste aversion.
Assuntos
Aprendizagem da Esquiva/efeitos dos fármacos , Condicionamento Operante/efeitos dos fármacos , Pentilenotetrazol/farmacologia , Animais , Comportamento de Ingestão de Líquido/efeitos dos fármacos , Masculino , Ratos , Sacarina/farmacologia , Paladar/efeitos dos fármacosRESUMO
Two experiments were carried out to investigate whether cigarette smoking could produce state-dependent learning (SDL) in humans. The first experiment was concerned with the methodological issue of choosing an appropriate control cigarette for use in an SDL design. A low nicotine content (0.2 mg) cigarette was chosen as it did not appear to affect the physiological arousal of the subjects. In Experiment 2, it was shown that cigarette smoking can produce state-dependent memory effects. The most likely basis for the results is the arousal produced by the nicotine content of the cigarette.
Assuntos
Memória/efeitos dos fármacos , Fumar , Adulto , Ansiedade/induzido quimicamente , Feminino , Humanos , Masculino , Pulso Arterial/efeitos dos fármacosRESUMO
OBJECTIVE: To determine the strength of association between mental health disorders in adolescence and disorder in early adulthood. METHOD: The study used mental health data from a longitudinal investigation of a New Zealand birth cohort. Of the 943 with prevalence data for DSM-III disorder at age 15, 890 had prevalence data for DSM-III-R disorder when aged 18 years. RESULTS: Two-thirds of those with disorder at age 15 had disorder at age 18. The residual form of attention deficit disorder, simple phobias, and oppositional disorders (with no other accompanying disorders) were associated with the lowest risk of later disorder and conduct disorder with the highest. With the exception of the overall symptom level, a variety of characteristics examined (e.g., social competence and adversity) could not differentiate between those with transient disorder and those with disorder at both ages. Comparisons of those with recurring disorder and those with new disorder at age 18 showed that in addition to characteristics of the disorder, disadvantage was strongly associated with recurrent disorder. CONCLUSIONS: The risk of later disorder for those with disorder in adolescence was high and differed across type of disorder. Findings suggest that to reduce the risk of disorder in early adulthood, clinicians could play a more active role in community interventions with direct social outcomes.
Assuntos
Psiquiatria do Adolescente , Transtornos Mentais/diagnóstico , Adolescente , Fatores Etários , Feminino , Nível de Saúde , Humanos , Estudos Longitudinais , Masculino , Transtornos Mentais/prevenção & controle , Serviços de Saúde Mental , Aceitação pelo Paciente de Cuidados de Saúde , Escalas de Graduação Psiquiátrica , Fatores de Risco , Socialização , Estresse Psicológico/psicologiaRESUMO
A sample of 943 adolescents from the general population were questioned about sleep problems. A quarter of the sample reported needing a lot more sleep than they previously had, and 10% of the sample complained of difficulty falling asleep. Adolescents reporting sleep problems showed more anxious, depressed, inattentive, and conduct disorder behaviors than those who had no (or only occasional) sleep problems. Sleep problems, particularly multiple problems, were associated with DSM-III disorder. There were no significant differences between male and female adolescents on any of the above measures. Finally, sleep problems were relatively persistent over time from ages 13 to 15.
Assuntos
Nível de Alerta , Desenvolvimento da Personalidade , Transtornos do Sono-Vigília/epidemiologia , Adolescente , Sintomas Afetivos/epidemiologia , Sintomas Afetivos/psicologia , Estudos Transversais , Feminino , Seguimentos , Humanos , Incidência , Estudos Longitudinais , Masculino , Nova Zelândia/epidemiologia , Transtornos do Sono-Vigília/psicologiaRESUMO
Although research into the continuity of disorder from childhood to adolescence is sparse, results from both longitudinal and cross sectional studies suggest that the prevalence of disorder increases for girls but may remain more stable for boys. In this paper, the methodologies of two assessment phases of the Dunedin longitudinal study have been equated to estimate the continuity of DSM-III disorder from ages 11 to 15. Although the overall prevalence of disorder doubled between the ages, this was primarily because of an increase in nonaggressive conduct disorder and major depressive episode. The sex ratios in disorder had largely reversed from a male predominance at 11 to a female predominance at 15. In terms of persistence, over 40% of those with disorder at age 11 were also identified at age 15. However, over 80% of those identified with disorder at 15 did not have a history of disorder at 11. Significant sex differences were also found in the continuity of internalizing and externalizing disorders, with externalizing disorders showing more continuity for boys, and internalizing for girls. Logistic regression models were employed to evaluate the roles family background, academic and social competence, and early histories of behavior problems may play in the determination of disorder continuity.