Phase Diagram for Light-Induced Superconductivity in κ-(ET)_{2}-X.

Resonant optical excitation of certain molecular vibrations in κ-(BEDT-TTF)_{2}Cu[N(CN)_{2}]Br has been shown to induce transient superconductinglike optical properties at temperatures far above equilibrium T_{c}. Here, we report experiments across the bandwidth-tuned phase diagram of this class of materials, and study the Mott insulator κ-(BEDT-TTF)_{2}Cu[N(CN)_{2}]Cl and the metallic compound κ-(BEDT-TTF)_{2}Cu(NCS)_{2}. We find nonequilibrium photoinduced superconductivity only in κ-(BEDT-TTF)_{2}Cu[N(CN)_{2}]Br, indicating that the proximity to the Mott insulating phase and possibly the presence of preexisting superconducting fluctuations are prerequisites for this effect.

The relationship between fatty liver index and bone mineral density in Koreans: KNHANES 2010-2011.

Analyses using a nationally representative cohort have revealed that high fatty liver index (FLI) is associated with low bone mineral density (BMD) regardless of insulin resistance in men, thereby supporting the deteriorated bone metabolism in nonalcoholic fatty liver disease (NAFLD). INTRODUCTION: NAFLD is linked to deteriorated bone health. We investigated the association of FLI, a scoring model for NAFLD, with BMD. METHODS: This was a population-based, cross-sectional study from the Korea National Health and Nutrition Examination Surveys including 4264 Koreans (1908 men and 2356 women). FLI was calculated using body mass index, waist circumference, serum triglyceride, and gamma-glutamyltranspeptidase level. Insulin resistance was evaluated using the homeostasis model assessment-estimated insulin resistance (HOMA-IR) index. BMD was measured using dual-energy X-ray absorptiometry at the lumbar spine, total hip, femoral neck, and whole body. RESULTS: Men had a higher FLI than women, while the HOMA-IR index was similar between men and women. The significant association between FLI and BMD was observed only in men, but not in women. FLI was negatively correlated with total hip, femoral neck, and whole body BMD in men after adjusting for all potential confounders, including HOMA-IR (P < 0.001 to 0.010). Lumbar spine, total hip, femoral neck, and whole body BMD in men showed a decreasing trend as the FLI tertile increased after adjusting for all potential confounders, including HOMA-IR (P for trends < 0.001 to 0.034). In men aged 50 years or older, odds ratios for combined osteopenia and osteoporosis increased across increasing FLI tertiles after adjusting for confounders (P for trends < 0.011 to 0.029). CONCLUSION: NAFLD is associated with low bone density regardless of insulin resistance in men. These findings suggest an undiscovered direct link between liver and bone that increases the risk of osteoporosis in men with NAFLD.

Long-term outcomes of locally or radically resected T1 colorectal cancer.

AIM: Little is known about the long-term outcome of T1 colorectal cancer (CRC) following curative resection. The present study addressed the long-term outcome of locally or radically resected T1 CRCs. METHOD: A total of 430 patients with T1 CRC who underwent local or radical resection were considered. Unfavourable histological factors were defined as positive resection margin, deep submucosal invasion, vascular invasion, Grade 3 and budding. The patients were classified as low-risk (unfavourable histological factor negative, n = 65) or high-risk (unfavourable histological factor positive, n = 365). RESULTS: Over a median follow-up of 78.4 months, disease recurred in 16 (3.7%) patients in the high-risk group, and no recurrence in the low-risk group. Resection type and vascular invasion were significantly associated with recurrence. In the vascular invasion (+) high-risk group, both 5-year disease-free survival rate and 5-year overall survival rate were significantly associated with resection type (radical 94.6%, local 43.8%, P < 0.001, and radical 99.1%, local 66.7%, P < 0.001). In the vascular invasion (-) high-risk group, 5-year disease-free survival rate was also significantly associated with resection type (radical 98.9%, local 84.7%, P = 0.001). However, 5-year overall survival rate was not associated with resection type (radical 98.9%, local 95.2%, P = 0.816). CONCLUSION: Local resection may be effective and oncologically safe in low-risk T1 CRC. Although additional surgery should be recommended for the locally resected high-risk T1 CRC cases, intensive surveillance without additional surgery and timely salvage operation may offer another treatment option, if vascular invasion is negative.

First Report of Clover yellow vein virus on White Clover (Trifolium repens) in South Korea.

White clover (Trifolium repens L.) is a herbaceous, perennial plant that has become one of the most widely distributed legumes in the world. It is extensively used in grass-legume pastures, but also has the potential to invade agricultural lands and natural ecosystems. White clover is a well-known natural host for Alfalfa mosaic virus (AMV), Clover yellow vein virus (ClYVV), Soybean dwarf virus (SbDV), Beet western virus (BWYV), Tomato spotted wilt virus (TSWV), Zucchini yellow mosaic virus (ZYMV), etc (1). In July 2013, during a survey to determine the presence of different viruses infecting weed plants in South Korea, three white clover leaf samples showing yellow mosaic symptoms were collected from Taean County, South Chungcheong Do Province, South Korea. In order to identify the infecting virus, total RNA from three leaf samples was extracted using the Tri-reagent (MRC Reagent, Inc., OH) as described by the manufacturer, and was applied to the large-scale oligonucleotide (LSON) chip (3), wherein probes specific to a ClYVV isolate produced a positive reaction. All three samples tested were positive for ClYVV. To confirm this result, ClYVV-specific primers were designed using the sequences of four ClYVV isolates from NCBI (GenBank Accession Nos. AF185959, AF203536, DQ333346, and NC003536). Total RNA was extracted from symptomatic white clover samples using Easy-Spin Total RNA Extraction Kit (iNtRon, Daejeon, Korea) and used as template for RT-PCR. The positive control RNA was used from ClYVV GM isolate (KF975894) and negative control RNA used symptomless white clover plants. The ClYVV coat protein (CP) gene was amplified by RT-PCR using the specific primer pairs ClYVV-CP-F / ClYVV-CP-R (5'-CAAGAGCAGCACGATGAG-3' and 5'-CTCGCTCTATAAAGATCAGAT-3'). DNA fragments of the expected size (1,042 bp) were obtained from the white clover Korea isolate (AB930132), and the PCR product was cloned into a T&A cloning vector (RBC Bioscience, Taipei, Taiwan) and sequenced directly in both directions. BLAST analyses of the nucleotide sequence CP gene fragments revealed the highest identity with 98% with other ClYVV isolates (AF203536). To determine the experimental host range of the ClYVV Korea isolate, we inoculated five species (Chenopodium amaranticolor, C. quinoa, Nicotiana clevelandii, N. benthamiana, and Trifolium repens) in three families using this isolate. All test plants were mechanically inoculated with 0.1 M phosphate buffered saline (Takara, Tokyo, Japan). Each test plant was inoculated nine times and grown in a greenhouse maintained at 27 to 33°C. Necrotic local lesions were produced on inoculated leaves of C. amaranticolor, C. quinoa, and N. clevelandii 4 to 6 days post-inoculation. After 10 to 14 days, C. amaranticolor and C. quinoa showed systemic chlorotic spot symptoms, and N. clevelandii, N. benthamiana, and T. repens showed chlorotic spot, mild mosaic, and mosaic in the upper leaves, respectively. Up to now, in South Korea, ClYVV has been detected in gladiolus (Gladiolus gandavensis) (3) and soybean (Glycine max) (4). ClYVV can be easily transmitted by insect, aphid, or mechanical inoculation and has a host range including tobacco, soybean, etc. The presence of ClYVV could become an important threat to crop production in South Korea. To our knowledge, this is the first report of a ClYVV infection of the white clover plant in South Korea. References: (1) B. L. Denny and P. L. Guy. Australas. Plant Pathol. 38:270, 2009. (2) M. Nam et al. Plant Pathol. J. 30:51, 2014. (3) I. S. Park et al. Korean J. Plant Pathol. 14:74, 1998. (4) J. C. Shin et al. Plant Dis. 98:1283, 2014.

Efficacy and safety of glimepiride/metformin sustained release once daily vs. glimepiride/metformin twice daily in patients with type 2 diabetes.

AIMS: The study investigated the clinical equivalence in reducing haemoglobin A1c (A1C) between glimepiride/metformin sustained release (GM-SR) 2/500 mg, a fixed-dose combination, once daily and glimepiride/metformin (GM) 1/250 mg, a fixed-dose combination, twice daily in patients with type 2 diabetes (T2D). METHODS: A multicentre, randomised, double-blind, double-dummy study was conducted in 14 hospitals in Korea. Inclusion criteria were age 30-75 years, T2D diagnosis no longer than 10 years previously, A1C between 7% and 10%, and body mass index <40 kg/m(2) . A total of 207 subjects were randomised into the GM-SR group (n=101) or the GM group (n=106). Participants were assessed at baseline, 8 weeks and 16 weeks after treatment. RESULTS: After 16 weeks treatment, no difference in baseline-adjusted changes of A1C (primary efficacy variable) was observed between the two groups (-0.59% for GM-SR group vs. -0.61% for GM group, 95% CI: -0.17 to 0.21; p=0.84). In addition, there were no significant differences in secondary efficacy parameters between the two groups, including changes in A1C up to week 8, changes in fasting plasma glucose (FPG) and 2-h-postprandial plasma glucose up to week 8 and week 16, response rate, drug compliance and hypoglycaemic events. However, there was a difference in baseline-adjusted changes of FPG between the two groups (-1.01 mmol/l for GM-SR group vs. -1.52 mmol/l for GM group, p=0.01 in the intention to treat set). CONCLUSIONS: GM-SR 2/500 mg once daily was as effective as GM 1/250 mg twice daily in lowering A1C. In addition, no difference was noted in hypoglycaemic events between the two groups.

Comparative genetic variability between broodstock and offspring populations of Korean starry flounder used for stock enhancement in a hatchery by using microsatellite DNA analyses.

Korean starry flounder, Platichthys stellatus (Pleuronectidae), is one of the most economically important fishery resources in Korea. We investigated the effect of current artificial reproduction in a hatchery facility, genetic divergence between the broodstock and their offspring populations of starry flounder in a hatchery strain to be stocked into natural sea areas was accessed using 9 polymorphic nuclear microsatellite DNA loci. High levels of polymorphism were observed between the 2 populations. A total of 96 alleles were detected at the loci, with some alleles being unique in the broodstock. Allelic variability ranged from 8 to 17 in the broodstock and from 7 to 12 in the offspring population. Average observed and expected heterozygosities were estimated at 0.565 and 0.741 in the broodstock samples and 0.629 and 0.698 in the offspring population, respectively. Although no statistically significant reductions were found in heterozygosity or allelic diversity in the offspring population, a considerable loss of rare alleles was observed in the offspring population compared with that in the broodstock. Significant genetic difference was detected between the broodstock and offspring populations (FST = 0.021, P < 0.05). These results suggest that more intensive breeding practices for stock enhancement might have resulted in a further decrease of genetic diversity. Thus, genetic variations of broodstock and progeny should ideally be monitored in both breeding and release programs as a routine hatchery operation in order to improve the starry flounder hatchery management. This information might be useful for fishery management and aquaculture industry of P. stellatus.

Waffle-inspired hydrogel-based macrodevice for spatially controlled distribution of encapsulated therapeutic microtissues and pro-angiogenic endothelial cells.

Macro-encapsulation systems for delivery of cellular therapeutics in diabetes treatment offer major advantages such as device retrievability and high cell packing density. However, microtissue aggregation and absence of vasculature have been implicated in the inadequate transfer of nutrients and oxygen to the transplanted cellular grafts. Herein, we develop a hydrogel-based macrodevice to encapsulate therapeutic microtissues positioned in homogeneous spatial distribution to mitigate their aggregation while concurrently supporting an organized intra-device network of vascular-inductive cells. Termed Waffle-inspired Interlocking Macro-encapsulation (WIM) device, this platform comprises two modules with complementary topography features that fit together in a lock-and-key configuration. The waffle-inspired grid-like micropattern of the "lock" component effectively entraps insulin-secreting microtissues in controlled locations while the interlocking design places them in a co-planar spatial arrangement with close proximity to vascular-inductive cells. The WIM device co-laden with INS-1E microtissues and human umbilical vascular endothelial cells (HUVECs) maintains desirable cellular viability in vitro with the encapsulated microtissues retaining their glucose-responsive insulin secretion while embedded HUVECs express pro-angiogenic markers. Furthermore, a subcutaneously implanted alginate-coated WIM device encapsulating primary rat islets achieves blood glucose control for 2 weeks in chemically induced diabetic mice. Overall, this macrodevice design lays foundation for a cell delivery platform, which has the potential to facilitate nutrients and oxygen transport to therapeutic grafts and thereby might lead to improved disease management outcome.

First Report of Rice stripe virus of Proso Millet in Korea.

Rice stripe virus (RSV; genus Tenuivirus) is a serious threat to rice production in Korea (2). In 1965, a disease outbreak was observed on rice in South Korea, with plants showing yellow stripe symptoms (2). Reoccurrence of RSV in rice was observed again in 1980 in Gyeonggi and Chungcheong. In 2001, RSV was estimated to be infecting approximately 4,663 ha of rice in the provinces of Gyeonggi and Gangwha and approximately 5,000 ha of riceland in the provinces of Buan and, Seocheon (3). Proso millet (Panicum miliaceum L.) is grown as a cereal grain crop and used mainly for human food in South Korea (1). In June 2009, proso millet plants that displayed yellow stripe symptoms were collected at Sinjeon-Myeon, Gangjin-Gun, and Jeollanam-do provinces, where an outbreak of RSV in rice was reported. Diseased plants tested positive to RSV with an ELISA Kit (KisanBio, Seoul, Korea). Total RNA was extracted from leaf tissue with an RNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA). RSV coat protein specific-primers were produced (5' TGTGGAACATAGTCCCACAGTAAGT 3'(upstream), 5' CTAAGCCGCAACCATTCCTCCAGT 3'(downstream). Reverse transcription-PCR confirmed the presence of a 494-bp product as predicted for the presence of RSV. The coat protein of RSV isolates collected from proso millet, rice, and foxtail millet in the same area was also sequenced. Results confirmed that phylogenetic relationships were of high homology: 98.9% between RSV isolates from rice and foxtail millet, 99.2% between isolates from rice (GenBank Accession No. JN245626) and proso millet (GenBank Accession No. JN245627); 99.6% between rice and foxtail millet (GenBank Accession No. JN245628); and 99.6% between foxtail millet and proso millet. In addition, sequence comparisons showed 96 to 99% identity with known RSV sequences available in GenBank (Accession No. X53563) (4). To our knowledge, this is the first report of RSV of proso millet in South Korea. The finding of this disease confirms further spread of the virus within the northern part of South Korea and the need for research to develop more effective management options to reduce the impact of RSV in proso millet. References: (1) Y. Y. Choi et al. Biosci. Biotechnol. Biochem. 69:31, 2005. (2) B. C. Lee et al. Res. Plant Dis. 10:30, 2004. (3) B. C. Lee et al. Res. Plant Dis. 14:210, 2008. (4) Y. Zhu. J. Gen. Virol. 72:763, 1991.

Microsatellite analysis as a tool for discriminating an interfamily hybrid between olive flounder and starry flounder.

An interspecific artificial hybrid was produced between two economically important aquaculture flatfish: olive flounder (Paralichthys olivaceus) and starry flounder (P. stellatus). This hybrid displays the rapid growth characteristic of the former and tolerance to low temperatures and low salinity of the latter, but the genetics of inheritance in this hybrid have not been elucidated. Polymorphic microsatellite markers developed for P. olivaceus and P. stellatus were tested to determine if these markers can be used for analysis of parentage and genetic inheritance. Multiplex PCR using two primer sets that were specific to each species produced PCR products of different sizes; these could be used for the identification of interspecific hybrids. Among the 192 primers derived from olive flounder, 25.5% of the primer sets successfully amplified genomic DNA from starry flounder, and 23% of the 56 primer sets originating from starry flounder amplified DNA from olive flounder. Analysis of genetic inheritance in the hybrid using seven of the 62 microsatellite markers common to both species demonstrated classic Mendelian inheritance of these markers in the hybrid progeny, with the exception of one locus identified as a null allele in the hybrid. These results demonstrate that cross-specific microsatellite markers can be used tools for parentage analysis of hybrid flatfish, for mapping quantitative trait loci, for marker-assisted selective breeding, and for studies of the evolution of fish.

Indole-3-carbinol inhibits the proliferation of colorectal carcinoma LoVo cells through activation of the apoptotic signaling pathway.

Indole-3-carbinol (I3C) is a phytochemical that exhibits growth-inhibitory activity against various cancer cells. However, there are limited studies on the effects of I3C on colon cancer cells. In this study, the growth-inhibitory activity of I3C against the human colorectal carcinoma cell line (LoVo) was examined. The results of the 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide, colony formation, and cell counting assays revealed that I3C suppressed the proliferation of LoVo cells. Microscopy and wound-healing analyses revealed that I3C affected the morphology and inhibited the migration of LoVo cells, respectively. I3C induced apoptosis and DNA fragmentation as evidenced by the results of fluorescein isothiocyanate-conjugated annexin V staining and terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling assay, respectively. Additionally, I3C arrested the cell cycle at the G0/G1 phase and enhanced the reactive oxygen species levels. Western blotting analysis revealed that treatment with I3C resulted in the activation of apoptotic proteins, such as poly(ADP-ribose) polymerase, caspase-3, caspase-7, caspase-9, Bax, Bim, and p53 in LoVo cells. These results indicate that I3C induces apoptosis in LoVo cells by upregulating p53, leading to the activation of Bax and caspases. Taken together, I3C exerts cytotoxic effects on LoVo cells by activating apoptosis.

Association of Antibody-Secreting Cells With Allograft Rejection After Renal Transplantation.

BACKGROUND: Donor-specific antibodies (DSA) are measured at the time of transplantation to predict renal allograft outcome, but pretransplantation DSA are sometimes not adequate to predict antibody-mediated rejection (AMR). We previously developed a flow cytometric assay that could measure the number of antibody-secreting cells (ASCs) instead of DSA. Here, we evaluated the performance of the flow cytometric ASC assay in predicting renal allograft rejection and compared it with that of the enzyme-linked immunospot (ELISpot) assay. METHODS: We enrolled 25 patients who received renal transplantation between May 2017 and August 2017 at Seoul National University Hospital. Mononuclear cells separated from patient peripheral blood obtained on pretransplantation day 1 were incubated with CpG 2006, human CD40L, interleukin-21, and donor or autologous lymphocyte lysates for 6 days. Flow cytometry and ELISpot assay (Mabtech) were performed to measure the ASCs and their association with graft rejection. RESULTS: The number of donor-reactive ASCs, as measured by flow cytometry, was higher in the rejection group than in the nonrejection group (mean ± standard deviation [SD], 3688.9 ± 3875.3 vs 257.9 ± 297.3, P = .014), and no significant difference was observed in the ELISpot assay. Multiple linear regression analysis showed that the number of donor-reactive ASCs measured by flow cytometry was independently and negatively associated with the number of rejection-free days (P = .008, partial R2 = 0.368, adjusted R2 = 0.496). CONCLUSION: After renal transplantation, an increased number of donor-reactive ASCs, as measured by flow cytometry, was associated with allograft rejection. This may be useful to predict renal allograft rejection by measuring the sensitization status of patients who are awaiting renal transplantation.

Secondary Metabolites from Marine-Derived Fungi from China.

Marine-derived fungi play an important role in the search for structurally unique secondary metabolites, some of which show promising pharmacological activities that make them useful leads for drug discovery. Marine natural product research in China in general has made enormous progress in the last two decades as described in this chapter on fungal metabolites. This contribution covers 613 new natural products reported from 2001 to 2017 from marine-derived fungi obtained from algae, sponges, corals, and other marine organisms from Chinese waters. The genera Aspergillus (170 new natural products, 28%) and Penicillium (70 new natural products, 11%) were the main fungal producers of new natural products during the time period covered, whereas sponges (184 new natural products, 30%) were the most abundant source of new natural products, followed by corals (154 new natural products, 25%) and algae (130 new natural products, 21%). Close to 40% of all natural products covered in this contribution displayed various bioactivities. The major bioactivities reported were cytotoxicity against different cancer cell lines, antimicrobial (mainly antibacterial) activity, and antiviral activity, which accounted for 13%, 9%, and 3% of all natural products reported. In terms of structural classes, polyketides (188 new natural products, 31%) play a dominant role, and if prenylated polyketides and nitrogen-containing polyketides (included in meroterpenes and alkaloids in this contribution) are taken into account, their total number even exceeds 50%. Nitrogen-containing compounds including peptides (65 new natural products, 10%) and alkaloids (103 new natural products, 17%) are the second largest group.

Anticarcinogenic effect of indole-3-carbinol (I3C) on human hepatocellular carcinoma SNU449 cells.

Many cruciferous vegetables, including cabbage, contain indole-3-carbinol (I3C), which is a known anticarcinogen. However, the anticarcinogenic effects of I3C on liver cancer have not been investigated. Therefore, this study was conducted to evaluate the anticarcinogenic effects of I3C in human hepatocellular carcinoma (HCC) SNU449 cells. The results of MTT and WST-1 assays indicated that treatment of SNU449 cells with I3C decreased viability in dose- and time-dependent manners, while colony formation assays indicated that I3C also inhibited proliferation of SNU449 cells. Moreover, fluorescence-activated cell sorter analysis showed that I3C induced apoptosis in SNU449 cells in dose- and time-dependent manners. Furthermore, terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick-end labeling revealed that I3C induced DNA fragmentation in SNU449 cells in a time-dependent manner, while Western blotting showed that apoptotic proteins such as p53, cleaved PARP, caspase-3, and caspase-7 were activated in SNU449 cells following treatment with I3C. Finally, reactive oxygen species-related protein peroxiredoxin-1 and thioredoxin-1 expression decreased in I3C-treated SNU449 cells. The aim of our study is to investigate the unknown mechanisms responsible for the apoptotic effects of I3C on human HCC SNU449 cells, and the results suggest that I3C may be useful for the prevention and treatment of liver cancer.

Cytoprotective effects of taxifolin against cadmium-induced apoptosis in human keratinocytes.

Cadmium (Cd) is a heavy metal widely used in industry, and the skin is an important target of this metal. Taxifolin (Tax), a natural source of bioflavonoids found in various conifers, exerts multiple biologic effects on skin cells. However, the mechanisms by which Tax protects keratinocytes against Cd are currently unclear. We investigated the cytoprotective effects of Tax against Cd-induced apoptosis in the human HaCaT keratinocyte. The water-soluble tetrazolium salt (WST-1) assay and Annexin V/propidium iodide double-staining assay results showed that Cd-induced cell death was lower in cells treated with Tax (0-100 µM) than in cells treated with Cd alone. Additionally, a reduction of Cd-induced DNA fragmentation by Tax was shown by terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end labeling assay. The levels of reactive oxygen species were also lower in Cd/Tax-treated cells than in Cd-treated cells. We employed a two-dimensional electrophoresis-based proteomic analysis to identify treatment-related alterations in protein expression. Tax downregulated cathepsin B and D and upregulated hsp27, cyclophilin A, and peroxiredowin-1. Western blotting confirmed the downregulation of cathepsin B and D and the upregulation of hsp27. The cytoprotective effects of Tax against Cd-induced apoptosis were also characterized by the changes in the activity of caspase 3, -7, poly ADP-ribose polymerase, the cellular proliferation-related ERK1/2, and AKT. Furthermore, the levels of cell cycle-related proteins, such as SP1 and p21, decreased, whereas p53 level increased. We concluded that Tax reduced Cd cytotoxicity and Cd-induced apoptosis by inhibiting the apoptotic pathway.

Development of a Nested Polymerase Chain Reaction Assay for Detection of Colletotrichum acutatum on Symptomless Strawberry Leaves.

A nested polymerase chain reaction (PCR) assay was developed for detection of Colletotrichum acutatum on symptomless strawberry leaves. In pure culture, the assay detected as little as 1.0 fg of DNA extracted from mycelium and as few as 1.5 conidia ml-1 when conidial suspensions were sonicated. On detached inoculated leaves, three alternative protocols to dislodge the pathogen were assessed: (i) immersion of whole leaves in 0.05% Tween 20 and manual agitation in plastic bags for 1 min (A); (ii) immersion in Tween 20, sonication for 30 min, then agitation for 1 min (SA); and (iii) freezing for 3 h, incubation for 2 days at 27°C, immersion in Tween 20, then sonication for 30 min and agitation for 1 min (FISA). Each method removed significantly (P ≤ 0.05) more conidia from leaves than the nontreated control; however, removal of appressoria did not vary among assays. In composite samples of noninoculated and inoculated (1.5 ×103 conidia ml-1) strawberry leaves, the nested PCR assay using the FISA protocol detected C. acutatum in as few as 1 infested leaf in 50 noninfested leaves. In a strawberry field, the assay detected the presence of C. acutatum in samples of asymptomatic strawberry leaves, showing potential as a powerful tool for reliable diagnosis of the pathogen in the field.

First Report of Anthracnose Fruit Rot Caused by Colletotrichum acutatum on Strawberry in Korea.

Symptoms typical of anthracnose fruit rot; sunken, dark brown lesions on maturing fruits, were found in a commercial field of strawberry (Fragaria × ananassa) cv. Cal Giant in Yangyang County, Korea in May 2007. Masses of conidia were produced in acervuli in the center of lesions. The fungus was isolated on potato dextrose agar (PDA). Colonies grown on PDA were pale to mouse gray and became dark green to black in reverse. Conidia were formed in orange-to-salmon pink masses in the center of the culture. The average size of conidia on PDA was 15.2 × 4.6 µm, and they were hyaline, straight, cylindrical, with pointed ends, and aseptate (1). The fungus did not form an ascigerous stage in culture. Mycelial growth rate was 7.5 mm per day at 25°C on PDA. The identity of two isolates was confirmed as Colletotrichum acutatum J.H. Simmonds by PCR amplification using species-specific primers TBCA and TB5 (2), resulting in a characteristic 330-bp band on agarose gel. Morphological characters were in accordance with previous reports on C. acutatum. A pathogenicity test was conducted with five healthy plants of cvs. Cal Giant, Maehyang, Seolhyang, Kumhyang, Akihime, and Redpearl. After fruits and flowers were sprayed with a conidia suspension (105 conidia per ml), the plants were maintained at 10 to 25°C and 100% relative humidity in a greenhouse. As a control, five healthy plants were sprayed with sterile distilled water and incubated under the same conditions. Dark brown, water-soaked spots appeared on mature fruits of all cultivars after 5 days, and lesions on green fruits appeared on individual achenes. Flowers developed dark lesions, dried out, and died. No symptoms were found on the control plants. After the pathogen was reisolated from fruits and flowers lesions, the morphological characters developed in culture as described above. To our knowledge, this is the first report of C. acutatum causing strawberry anthracnose in Korea. References: (1) B. J. Smith and L. L. Black. Plant Dis. 74:69, 1990. (2) P. Talhinhas et al. Appl. Environ. Microbiol. 71:2987, 2005.

HOXA11-AS regulates diabetic arteriosclerosis-related inflammation via PI3K/AKT pathway.

OBJECTIVE: This study aims to explore whether homeobox A11 antisense RNA (HOXA11-AS) could regulate inflammation induced by diabetic arteriosclerosis (DAA) via PI3K/AKT pathway. PATIENTS AND METHODS: Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) was used to detect expressions of HOXA11-AS and proinflammatory genes in carotid endarterectomy samples of symptomatic and asymptomatic atherosclerosis (AS) patients, diabetes mellitus (DM), and non-DM patients. The above-mentioned genes in DM animal model and non-DM animal model were also detected. We detected the expression of HOXA11-AS in vascular smooth muscle cells (VSMCs) treated with platelet-derived growth factor (PDGF) or PDGF inhibitor imatinib, respectively. Subsequently, we applied cell transfection technology to interfere with the expression of HOXA11-AS in VSMCs. In vascular endothelial cells (VECs) and VSMCs, we detected the effect of HOXA11-AS on the expressions of genes related to the proliferation, migration, and cell cycle. Then, VSMCs were treated with tumor necrosis factor-α (TNF-α), and the expression of HOXA11-AS was examined in VSMCs. The effect of HOXA11-AS on TNF-α-induced inflammation in VSMCs was detected as well. Finally, we analyzed the effect of HOXA11-AS on PDGF-induced activation of PI3K/AKT pathway in VSMCs and VECs. RESULTS: HOXA11-AS expression was markedly increased in carotid endarterectomy specimens of symptomatic AS patients compared to that of asymptomatic AS patients. Expression levels of HOXA11-AS and pro-inflammatory genes were significantly elevated in carotid endarterectomy specimens of DM patients. Similarly, HOXA11-AS expression was also significantly increased in carotid arteries of DM mice compared with that of non-DM mice. PDGF could upregulate HOXA11-AS expression in VSMCs, which was reversed by PDGF inhibitor imatinib. HOXA11-AS knockdown could reduce the expressions of the proliferation-associated gene (PCNA) and the cycle-related genes (p21, p53), and also inhibited the proliferation and migration of VSMCs induced by PDGF. HOXA11-AS was upregulated by TNF-α. HOXA11-AS knockdown remarkably downregulated expressions of inflammation-related genes in VSMCs induced by TNF-α. In VECs, low expression of HOXA11-AS can inhibit the expression of TNF-α-induced pro-inflammatory genes and PDGF-induced vascular inflammation-related genes. Low expression of HOXA11-AS inhibited PDGF-induced activation of PI3K/AKT pathway in VSMCs and VECs. CONCLUSIONS: HOXA11-AS may participate in DAA by activating the PI3K/AKT pathway to regulate inflammation in VSMCs and VECs.

Retention of chromosome 3 in extrapulmonary small cell cancer shown by molecular and cytogenetic studies.

In small cell lung carcinoma, one of the short arms of chromosome 3 is typically lost. To investigate chromosome 3 in extrapulmonary small cell carcinoma, we used DNA probes that detect restriction-fragment-length polymorphisms at loci on 3p. These probes were used to study DNA extracted from tumors and normal tissues and/or tumor cell lines from five patients with extrapulmonary small cell cancer. Tumor DNA from four of the five patients with extrapulmonary small cell cancer retained heterozygosity at loci on 3p. Cytogenetic studies of the tumor cell lines established from these four patients showed retention of both short arms of chromosome 3. We conclude that the loss of genetic material from 3p observed in small cell lung cancer is not typical in extrapulmonary small cell cancer.

Overexpression of membrane-type matrix metalloproteinase-1 gene induces mammary gland abnormalities and adenocarcinoma in transgenic mice.

To investigate the role of membrane-type matrix metalloproteinase-1 (MT1-MMP) in mammary gland development and tumorigenesis, transgenic mice overexpressing MT1-MMP in mammary gland under the control of the mouse mammary tumor virus long terminal repeat-promoter were generated. The mouse mammary tumor virus/MT1-MMP transgenic mice displayed abnormalities in 82% of female mammary glands. The abnormalities were verified as lymphocytic infiltration, fibrosis, hyperplasia, alveolar structure disruption, dysplasia, and adenocarcinoma. Northern and reverse transcription-PCR analyses demonstrated that MT1-MMP mRNA was overexpressed in mammary glands exhibiting abnormalities. Western blot analysis and immunohistochemical studies have revealed that the protein expression level was also increased in these glands. In addition, the beta-casein gene as a functional epithelial cell marker was poorly expressed in the mammary glands of transgenic mice exhibiting abnormalities. Gelatin zymography showed significantly increased MMP-2 activation in these mammary glands. These results showed that overexpression of MT1-MMP induced remodeling of the extracellular matrix and tumor formation in the mammary glands of transgenic mice. Therefore, we suggest that overexpression of MT1-MMP may play a key role in development and tumorigenesis in mammary glands.

Activated ras oncogene collaborates with HBx gene of hepatitis B virus to transform cells by suppressing HBx-mediated apoptosis.

The hepatitis B virus HBx protein is a promiscuous transactivator implicated in the development of hepatocellular carcinoma. The ectopic expression of HBx fails to transform both primary and immortalized rodent cells, but rather induces apoptosis. Furthermore, most transgenic mice harboring HBx do not develop liver tumors. Thus, it remains unclear whether and how HBx contributes to oncogenesis. Here, we show that HBx collaborates with activated H-ras to transform immortalized rodent cells. Indeed, REF52 cells transfected by both HBx and activated H-ras were morphologically transformed and were able to grow in soft agar. Remarkably, nude mice injected with REF52 cells transfected by both HBx and activated H-ras developed tumors, whereas the mice injected with REF52 cells transfected by either gene alone did not. Thus, we concluded that HBx could contribute to neoplastic transformation of cells in collaboration with other oncogenes, such as H-ras, that renders cells to overcome the HBx-mediated apoptosis. Further, we found that HBx mediated apoptosis was suppressed by activated H-ras through activation of the phosphatidylinositol-3 kinase and Akt pathway. Data presented here firmly established the oncogenic potential of HBx during multistage carcinogenesis. Oncogene (2001) 20, 16 - 23.