Survey Research: Do All RN Types Have the Same Perceptions Regarding Professional Nursing Governance?

OBJECTIVE: Researchers examined professional nursing governance perception differences by RN type (clinical, manager, and other RNs), and nurse-related outcome associations. BACKGROUND: Shared governance is associated with improved nurse-related outcomes. Understanding differences in RN types regarding shared governance perceptions is important and not well studied. METHODS: Mean Index of Professional Nursing Governance (IPNG) scores from 3 hospitals' 502 RNs were used to evaluate associations by RN type and unit-based nurse-related outcomes. Descriptive and inferential statistical methods were used. RESULTS: Shared governance was the predominant finding (overall score and 4 of 6 subscale scores) with no significant differences by RN type. Traditional governance was scored for 1 subscale (control over personnel), which was not significant. There were no significant differences in the IPNG score associations with outcomes data by RN type. CONCLUSIONS: Clinical nurses, managers, and other RN types perceived their governance as shared, without significant difference in the nurses' perceptions based on role.

Interleukin-2 inhibits HIV-1 replication in some human T cell lymphotrophic virus-1-infected cell lines via the induction and incorporation of APOBEC3G into the virion.

IL-2 has been used in culture of primary T cells to maintain cell proliferation. We have previously reported that IL-27 inhibits HIV-1 replication in primary T cells in the presence of IL-2. To gain a better understanding of the mechanisms involved in this inhibitory effect, we attempted to investigate in detail the effects of IL-27 and IL-2 using several cell lines. Unexpectedly, IL-27 did not inhibit HIV-1 in T cell lines, whereas IL-2 inhibited HIV-1 replication in the human T cell lymphotrophic virus (HTLV)-1-transformed T cell lines, MT-2, MT-4, SLB-1, and ATL-2. No effects were seen in HTLV-1-negative cell lines. Utilizing MT-2 cells, we demonstrated that IL-2 treatment inhibited HIV-1 syncytia-inducing ability and dose-dependently decreased supernatant p24 antigen levels by >90%. Using real time PCR and Western blot analysis, we observed that IL-2 treatment induced the host restriction factor, APOBEC3G with accumulation into the lower molecular mass active form as characterized by FPLC. Further analysis revealed that the virus recovered from IL-2-treated MT-2 cells had impaired replication competency. This was found to be due to incorporation of APOBEC3G into the virion despite the presence of Vif. These findings demonstrate a novel role for IL-2 in regulating production of infectious HIV-1 virions in HTLV-1-infected cells through the induction of APOBEC3G.

Cutting edge: Ku70 is a novel cytosolic DNA sensor that induces type III rather than type I IFN.

Cytosolic foreign DNA is detected by pattern recognition receptors and mainly induces type I IFN production. We found that transfection of different types of DNA into various untreated cells induces type III IFN (IFN-λ1) rather than type I IFN, indicating the presence of uncharacterized DNA sensor(s). A pull-down assay using cytosolic proteins identified that Ku70 and Ku80 are the DNA-binding proteins. The knockdown studies and the reporter assay revealed that Ku70 is a novel DNA sensor inducing the IFN-lambda1 activation. The functional analysis of IFNL1 promoter revealed that positive-regulatory domain I and IFN-stimulated response element sites are predominantly involved in the DNA-mediated IFNL1 activation. A pull-down assay using nuclear proteins demonstrated that the IFN-λ1 induction is associated with the activation of IFN regulatory factor-1 and -7. Thus, to our knowledge, we show for the first time that Ku70 mediates type III IFN induction by DNA.

Short Communication: S100A8 and S100A9, Biomarkers of SARS-CoV-2 Infection and Other Diseases, Suppress HIV Replication in Primary Macrophages.

S100A8 and S100A9 are members of the Alarmin family; these proteins are abundantly expressed in neutrophils, form a heterodimer complex, and are secreted in plasma on pathogen infection or acute inflammatory diseases. Recently, both proteins were identified as novel biomarkers of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection and were shown to play key roles in inducing an aggressive inflammatory response by mediating the release of large amounts of pro-inflammatory cytokines, called the "cytokine storm." Although co-infection with SARS-CoV-2 in people living with HIV-1 may result in an immunocompromised status, the role of the S100A8/A9 complex in HIV-1 replication in primary T cells and macrophages is still unclear. Here, we evaluated the roles of the proteins in HIV replication to elucidate their functions. We found that the complex had no impact on virus replication in both cell types; however, the subunits of S100A8 and S100A9 inhibit HIV in macrophages. These findings provide important insights into the regulation of HIV viral loads during SARS-CoV-2 co-infection.

S100A8 and S100A9, biomarkers of SARS-Cov2-infected patients, suppress HIV replication in primary macrophages.

S100A8 and S100A9 are members of the Alarmin family; these proteins are abundantly expressed in neutrophils and form a heterodimer complex. Recently, both proteins were identified as novel biomarkers of SARS-CoV-2 infection and were shown to play key roles in inducing an aggressive inflammatory response by mediating the release of large amounts of pro-inflammatory cytokines, called the "cytokine storm." Although co-infection with SARS-CoV-2 in people living with HIV-1 may result in an immunocompromised status, the role of the S100A8/A9 complex in HIV-1 replication in primary T cells and macrophages is still unclear. Here, we evaluated the roles of the proteins in HIV replication to elucidate their functions. We found that the complex had no impact on virus replication in both cell types; however, the subunits of S100A8 and S100A9 inhibits HIV in macrophages. These findings provide important insights into the regulation of HIV viral loads in SARS-CoV2 co-infection.

3' gene regulatory elements required for expression of the Plasmodiumfalciparum developmental protein, Pfs25.

Development of sexual stage parasites within the mosquito vector is a crucial step in the transmission of Plasmodium parasites. The expression of the P25 and P28 proteins on the surface of Plasmodium parasites in the mosquito midgut is required for development and hence disease transmission. 3' gene-flanking sequences are essential for expression of these critical proteins but the nucleotide elements required are poorly defined. Transient gene transfection experiments using constructs containing deletions of the 3' gene-flanking region of the Plasmodium falciparum P25 homologue, pfs25, reveal that elements necessary for protein expression are within 315 nucleotides (nt) of the stop codon. A T-rich region 137-231 nt from the stop codon is required for expression. The nonamer AATAAAATG, 360 nt downstream from the stop codon, enhances expression by 51 percent. Using 3' RACE analysis, multiple polyadenylation sites from endogenous and plasmid-derived pfs25 transcripts were identified. Dissimilarities between the identified elements and those of metazoans support the hypothesis that definition of P25/28 3' gene regulatory processes may eventually permit the development of agents which block malaria transmission but are non-toxic to humans.

3' UTR signals necessary for expression of the Plasmodium gallinaceum ookinete protein, Pgs28, share similarities with those of yeast and plants.

During metazoan development, 3' UTR signals mediate the time and place of gene expression. For protozoan Plasmodium parasites, the formation of ookinetes from gametes in the mosquito midgut is an analogous developmental process. Previous studies of the 3' UTR signals necessary for expression of Pgs28, the major surface protein of Plasmodium gallinaceum ookinetes, suggested that a 3' UTR T-rich region and DNA sequences containing an ATTAAA eukaryotic polyadenylation consensus motif were necessary for its expression. During metazoan development, U-rich elements may function in conjunction with eukaryotic polyadenylation consensus signals to mediate developmental protein expression. To define whether the putative Plasmodium elements were mediators of Pgs28 expression mutations of these nucleotide sequences were made in plasmid constructs. The effect of the mutations on Pgs28 expression was tested by the transient gene transfection of sexual stage P. gallinaceum parasites. These studies reveal that two different mutations of the ATTAAA motif, which alter gene expression in higher eukaryotes and yeast, do not alter the expression of Pgs28. However, the U-rich element, adjacent nucleotides UUUACAAAAUUGUUUUAACU and downstream nucleotides UAUAUAAAA are able to mediate expression to varying degrees. The organization and overlapping function of these elements appears to more closely resemble that of yeasts or plants than those of metazoans.

Kinetic characterization of newly discovered inhibitors of various constructs of human T-cell leukemia virus-1 (HTLV-1) protease and their effect on HTLV-1-infected cells.

BACKGROUND: Human T-cell leukemia virus-1 (HTLV-1) was the first identified human retrovirus and was shown to be associated with diseases such as adult T-cell leukemia lymphoma and tropical spastic paraparesis/HTLV-1 associated myelopathy. Retroviral proteases (PRs) are essential for viral replication by processing viral Gag and Gag-(Pro)-Pol polyproteins during maturation. Full-length HTLV-1 PR is 125 residues long; whether the C-terminal region is required for catalytic activity is still controversial. In this study, we characterized the effect of C-terminal amino acids of HTLV-1 PR for PR activity and examined the binding of compounds identified by in silico screening. One compound showed inhibition against the virus in infected cells. METHODS: Truncated (116-, 121- and 122-residue) forms of HTLV-1 PR were prepared and proteins from expression of the genes were purified. In silico screening was performed by docking small molecules into the active site of HTLV-1 PR. The kinetic constants k(cat), K(m), k(cat)/K(m) and inhibition constants K(i) for inhibitors identified by the computational screening were determined. Western blot and ELISA analyses were used to determine the effect of the most potent PR inhibitors on HTLV-1 protein processing in infected cells. RESULTS: The constructs showed similar catalytic efficiency constants (k(cat)/K(m)); thus HTLV-1 PR C-terminal amino acids are not essential for full activity. Computational screening revealed new PR inhibitors and some were shown to be inhibitory in enzyme assays. In HTLV-1-infected cells, one of the small molecules inhibited HTLV-1 gag cleavage and decreased the amount of HTLV-1 p19 produced in the cells. CONCLUSIONS: We have identified an HTLV-1 PR inhibitor that is biologically functional. Inhibitor screening will continue to develop possible drugs for therapy of HTLV-1 infection.

Evaluation of the effect of pyrimethamine, an anti-malarial drug, on HIV-1 replication.

Co-infection of human immunodeficiency virus (HIV) with malaria is one of the pandemic problems in Africa and parts of Asia. Here we investigated the impact of pyrimethamine (PYR) and two other clinical anti-malarial drugs (chloroquine [CQ] or artemisinin [ART]) on HIV-1 replication. Peripheral blood mononuclear cells (PBMCs) or MT-2 cells were infected with HIV(NL4.3) strain and treated with different concentrations of the anti-malarial drugs. HIV-1 replication was measured using p24 ELISA. We show that 10 µM CQ and ART inhibited HIV-1 replication by 76% and 60% in PBMCs, respectively, but not in MT-2 cells. In contrast, 10 µM PYR enhanced HIV-1 replication in MT-2 cells by >10-fold. A series of molecular mechanism studies revealed that PYR increased intracellular HIV gag proteins without affecting the promoter or the reverse transcriptase activity. The effect of PYR was independent of HTLV-1 produced by MT-2 cells. Of interest, PYR treatment led to S-phase accumulation and increased AZT and d4T antiviral activity by ∼ 4-fold. Taken together, we show that PYR significantly enhances HIV-1 replication by affecting the cellular machinery. Our results could be relevant for the management of malaria and HIV particularly in regions where HIV-1 and malaria epidemics overlap.

Hydroxyurea and interleukin-6 synergistically reactivate HIV-1 replication in a latently infected promonocytic cell line via SP1/SP3 transcription factors.

The existence of viral latency limits the success of highly active antiretroviral therapy. With the therapeutic intention of reactivating latent virus to induce a cure, in this study we assessed the impact of cell synchronizers on HIV gene activation in latently infected U1 cells and investigated the molecular mechanisms responsible for such effect. Latently infected U1 cells were treated with 10 drugs including hydroxyurea (HU) and HIV-1 replication monitored using a p24 antigen capture assay. We found that HU was able to induce HIV-1 replication by 5-fold. HU has been used in the clinical treatment of HIV-1-infected patients in combination with didanosine; therefore, we investigated the impact of HU on HIV-1 activation in the presence of the proinflammatory cytokines, interleukin 6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha). IL-6 or TNF-alpha alone induced HIV replication by 18- and approximately 500-fold, respectively. Of interest, in the presence of HU, IL-6-mediated HIV-1 activation was enhanced by >90-fold, whereas TNF-alpha-mediated activation was inhibited by >30%. A reporter gene assay showed that HU and IL-6 synergized to activate HIV promoter activity via the Sp1 binding site. Electrophoretic mobility shift and supershift assays revealed increased binding of the Sp1 and Sp3 transcription factors to this region. Western blot analysis showed that HU and IL-6 co-stimulation resulted in increased levels of Sp1 and Sp3 proteins. In contrast, treatment with HU plus TNF-alpha down-regulated the expression of NF-kappaB. These findings suggest that Sp1/Sp3 is involved in controlling the HU/IL-6-induced reactivation of HIV-1 in latently infected cells.

Recombinant Duffy binding-like-alpha domains of Plasmodium falciparum erythrocyte membrane protein 1 elicit antibodies in rats that recognise conserved epitopes.

Plasmodium falciparum parasites remodel the surface of human erythrocytes on invasion by the insertion of parasite-derived proteins in knob-like protrusions. P. falciparum erythrocyte membrane protein 1 (PfEMP-1), a variant surface antigen, has been shown to be anchored in these knobs and mediates adhesion to various host endothelial receptors. These proteins also undergo clonal antigenic variation as a means of immune evasion. Duffy binding-like-alpha(DBL-alpha) domain together with the cysteine-rich interdomain region form the head structure of the PfEMP1 molecule. In this report, we used ten different recombinant DBL-alpha fusion proteins expressed in Escherichia coli to generate antibodies in experimental animals. Five out of ten recombinant DBL-alpha fusion proteins were immunogenic and induced antibodies that reacted with conserved peptides derived from PfEMP1. Indirect immunofluorescence assay was used to localise PfEMP-1-DBL-alpha expressed in parasitised erythrocytes. Positive fluorescence reactivity was observed within the cytoplasm and with membrane structures but not on the surface of intact P. falciparum-infected erythrocytes.