Geochemical fractionation of hazardous elements in fresh and drilled weathered South African coal fly ashes.

The chemical reactions of dry-disposed ash dump, ingressed oxygen, carbon dioxide, and infiltrating rainwater affect mineralogical transformation, redistribution, and migration of chemical species. Composite samples of weathered coal fly ash taken at various depths and fresh coal fly ash were examined using organic petrographic, X-ray diffraction, X-ray fluorescence techniques, and successive extraction procedures. Results obtained show relative enrichment of glass, Al-Fe-oxides, calcite, and tridymite in the weathered CFA, but the fresh CFA is enriched in mullite, inertinite, maghemite, and ettringite. The enrichment of the weathered CFA in amorphous glass suggests higher reactivity when compared to fresh CFA. The evident depletion of soluble oxides in the weathered CFA is attributed to flushing of the soluble salts by percolating rainwater. Comparative enrichment of examined elements in water-soluble, exchangeable, reducible, and residual fractions of the weathered CFA is partly due to the slow release of adsorbed chemical species from the alumina-silicate matrix and diffusion from the deeper sections of the particles of coal fly ash. Sodium and potassium show enrichment in the oxidisable fraction of fresh CFA. The estimated mobility factor indicates mobility for Ca, Mg, Na, Se, Mo, and Sb and K, Sr, V, Cu, Cr, Se, and B in fresh and weathered CFAs, respectively.

Risk Assessment in High- and Low-MELD Liver Transplantation.

Allocation of liver grafts triggers emotional debates, as those patients, not receiving an organ, are prone to death. We analyzed a high-Model of End-stage Liver Disease (MELD) cohort (laboratory MELD score ≥30, n = 100, median laboratory MELD score of 35; interquartile range 31-37) of liver transplant recipients at our center during the past 10 years and compared results with a low-MELD group, matched by propensity scoring for donor age, recipient age, and cold ischemia time. End points of our study were cumulative posttransplantation morbidity, cost, and survival. Six different prediction models, including donor age x recipient MELD (D-MELD), Difference between listing MELD and MELD at transplant (Delta MELD), donor-risk index (DRI), Survival Outcomes Following Liver Transplant (SOFT), balance-of-risk (BAR), and University of California Los Angeles-Futility Risk Score (UCLA-FRS), were applied in both cohorts to identify risk for poor outcome and high cost. All score models were compared with a clinical-oriented decision, based on the combination of hemofiltration plus ventilation. Median intensive care unit and hospital stays were 8 and 26 days, respectively, after liver transplantation of high-MELD patients, with a significantly increased morbidity compared with low-MELD patients (median comprehensive complication index 56 vs. 36 points [maximum points 100] and double cost [median US$179 631 vs. US$80 229]). Five-year survival, however, was only 8% less than that of low-MELD patients (70% vs. 78%). Most prediction scores showed disappointing low positive predictive values for posttransplantation mortality, such as mortality above thresholds, despite good specificity. The clinical observation of hemofiltration plus ventilation in high-MELD patients was even superior in this respect compared with D-MELD, DRI, Delta MELD, and UCLA-FRS but inferior to SOFT and BAR models. Of all models tested, only the BAR score was linearly associated with complications. In conclusion, the BAR score was most useful for risk classification in liver transplantation, based on expected posttransplantation mortality and morbidity. Difficult decisions to accept liver grafts in high-risk recipients may thus be guided by additional BAR score calculation, to increase the safe use of scarce organs.

Cerebral blood flow autoregulation in ischemic heart failure.

Patients with ischemic heart failure (iHF) have a high risk of neurological complications such as cognitive impairment and stroke. We hypothesized that iHF patients have a higher incidence of impaired dynamic cerebral autoregulation (dCA). Adult patients with iHF and healthy volunteers were included. Cerebral blood flow velocity (CBFV, transcranial Doppler, middle cerebral artery), end-tidal CO2 (capnography), and arterial blood pressure (Finometer) were continuously recorded supine for 5 min at rest. Autoregulation index (ARI) was estimated from the CBFV step response derived by transfer function analysis using standard template curves. Fifty-two iHF patients and 54 age-, gender-, and BP-matched healthy volunteers were studied. Echocardiogram ejection fraction was 40 (20-45) % in iHF group. iHF patients compared with control subjects had reduced end-tidal CO2 (34.1 ± 3.7 vs. 38.3 ± 4.0 mmHg, P < 0.001) and lower ARI values (5.1 ± 1.6 vs. 5.9 ± 1.0, P = 0.012). ARI <4, suggestive of impaired CA, was more common in iHF patients (28.8 vs. 7.4%, P = 0.004). These results confirm that iHF patients are more likely to have impaired dCA compared with age-matched controls. The relationship between impaired dCA and neurological complications in iHF patients deserves further investigation.

Cytobrush: A tool for sequential evaluation of gene expression in bovine endometrium.

Aims were to (i) compare specific transcript abundance between endometrial samples collected by transcervical biopsy and cytobrush and (ii) measure the abundance of endometrial transcripts involved in PGF2α synthesis in samples collected by cytobrush. In Experiment 1, endometrial samples were taken transcervically by cytobrush and biopsy 10 days after ovulation. Compared to biopsy samples, abundance of transcripts for MSTN, AKR1C4 and PGR was similar, VIM, FLT1 and PTGES was lower (p < .05) and KRT18 and CD3D was greater in cytobrush samples (p < .05). Thus, there was an enrichment of epithelial and immune cells in the cytobrush samples. In Experiment 2, endometrial samples were collected by cytobrush on days 10, 13, 16 and 19 after ovulation. Abundance of PGR2 mRNA was maximum on day 10 then decreased (p < .05). Abundance of ESR1 decreased gradually from day 10 to day 16 then increased again on day 19. The greatest abundance of OXTR was noted on day 19. The sequential alterations in abundance of these transcripts are consistent with the release of PGF2α associated with luteolysis. In summary, cytobrush sampling provides representative, physiologically relevant samples of the luminal epithelium in cattle.

Renal transplantation in human immunodeficiency virus-infected recipients: a case-control study from the Brazilian experience.

BACKGROUND: Highly active antiretroviral therapy has turned human immunodeficiency virus (HIV)-infected patients with end-stage renal disease into suitable candidates for renal transplantation. We present the Brazilian experience with kidney transplantation in HIV-infected recipients observed in a multicenter study. METHODS: HIV-infected kidney transplant recipients and matched controls were evaluated for the incidence of delayed graft function (DGF), acute rejection (AR), infections, graft function, and survival of patients and renal grafts. RESULTS: Fifty-three HIV-infected recipients and 106 controls were enrolled. Baseline characteristics were similar, but a higher frequency of pre-transplant positivity for hepatitis C virus and cytomegalovirus infections was found in the HIV group. Immunosuppressive regimens did not differ, but a trend was observed toward lower use of anti-thymocyte globulin in the group of HIV-infected recipients (P = 0.079). The HIV-positive recipient group presented a higher incidence of treated AR (P = 0.036) and DGF (P = 0.044). Chronic Kidney Disease Epidemiology Collaboration estimated that glomerular filtration rate was similar at 6 months (P = 0.374) and at 12 months (P = 0.957). The median number of infections per patient was higher in the HIV-infected group (P = 0.018). The 1-year patient survival (P < 0.001) and graft survival (P = 0.004) were lower, but acceptable, in the group of HIV-infected patients. CONCLUSIONS: In the Brazilian experience, despite somewhat inferior outcomes, kidney transplantation is an adequate therapy for selected HIV-infected recipients.

The Receptive Endometrial Transcriptomic Signature Indicates an Earlier Shift from Proliferation to Metabolism at Early Diestrus in the Cow.

This study aimed to characterize the endometrial transcriptome and functional pathways overrepresented in the endometrium of cows treated to ovulate larger (≥13 mm) versus smaller (≤12 mm) follicles. Nelore cows were presynchronized prior to receiving cloprostenol (large follicle [LF] group) or not (small follicle [SF] group), along with a progesterone (P4) device on Day (D) -10. Devices were withdrawn and cloprostenol administered 42-60 h (LF) or 30-36 h (SF) before GnRH agonist treatment (D0). Tissues were collected on D4 (experiment [Exp.] 1; n = 24) or D7 (Exp. 2; n = 60). Endometrial transcriptome was obtained by RNA-Seq, whereas proliferation and apoptosis were assessed by immunohistochemistry. Overall, LF cows developed larger follicles and corpora lutea, and produced greater amounts of estradiol (D-1, Exp. 1, SF: 0.7 ± 0.2; LF: 2.4 ± 0.2 pg/ml; D-1, Exp. 2, SF: 0.5 ± 0.1; LF: 2.3 ± 0.6 pg/ml) and P4 (D4, Exp. 1, SF: 0.8 ± 0.1; LF: 1.4 ± 0.2 ng/ml; D7, Exp. 2, SF: 2.5 ± 0.4; LF: 3.7 ± 0.4 ng/ml). Functional enrichment indicated that biosynthetic and metabolic processes were enriched in LF endometrium, whereas SF endometrium transcriptome was biased toward cell proliferation. Data also suggested reorganization of the extracellular matrix toward a proliferation-permissive phenotype in SF endometrium. LF endometrium showed an earlier onset of proliferative activity, whereas SF endometrium expressed a delayed increase in glandular epithelium proliferation. In conclusion, the periovulatory endocrine milieu regulates bovine endometrial transcriptome and seems to determine the transition from a proliferation-permissive to a biosynthetic and metabolically active endometrial phenotype, which may be associated with the preparation of an optimally receptive uterine environment.

Use of elephant grass for energy production in Campos dos Goytacazes-RJ, Brazil.

Elephant grass is a tropical forage plant widely distributed throughout Brazil. It was first exclusively used in the livestock sector as cattle feed. The grass is characterized by its high productivity and photosynthetic capacity and is considered as an alternative source of renewable energy. Here, we estimated the general combining ability of the parents and specific combining ability of the hybrids based on morpho-agronomic biomass-quality traits. The experiment was conducted in a randomized block design with 3 replicates. The diallel was composed of 16 hybrids and 2 groups of genitors. In the diallel analysis of variance, we observed a significant difference among treatments. A significant difference was observed among genitors for dry matter production (DMP). For the general combining ability of group 1, the traits leaf blade width, DMP, height, percentage of neutral detergent fiber, percentage of hemicellulose, percentage of lignin, percentage of acid detergent fiber, and percentage of cellulose were significant. For the estimates of general combining ability of DMP, parents Porto Rico 534-B, Vruckwona, Taiwan A-146, and Mercker S. E. A. were 0.4748, 3.2819, 1.1659, and 0.4317. The parents of Mercker S. E. A. and Porto Rico 534-B produced the highest percentage of detergent fiber and percentage of lignin with values of 0.1482 and 0.0856. Thus, parents Vruckwona, Porto Rico 534-B, and Taiwan A-146 are promising for integration into breeding programs. The best hybrid combinations for DMP were 1 x 5, 1 x 8, 2 x 6, 3 x 7, and 4 x 5.

First Report of Garlic virus X in Garlic Plants in Brazil.

Garlic is the fifth most economically important vegetable in Brazil and is frequently infected by a complex of different viruses that cause significant degeneration of the crop under field conditions. The species of the genus Allexivirus that infect garlic are: Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D), Garlic virus E (GarV-E), Garlic virus X (GarV-X), Garlic mite-borne filamentous viru s (GarMbFV), and Shallot virus X (ShVX). So far, only GarV-A, GarV-B, GarV-C, GarV-D, and GarMbFV have been reported in Brazil (3). During the 2010 through 2013 seasons, between April and October, 302 garlic plants with yellow mosaic strips and distorted leaves from the cultivars Caçador, Quitéria, Tropical Bergamota, and Tropical Shangai were collected in the states of Paraná, Minas Gerais, São Paulo, and Goiás and analyzed for the presence of allexiviruses. Total plant RNA was extracted with the Total RNA Purification kit (Norgen Biotek Corp., Canada) according to manufacturer's instructions. RT-PCR reactions were performed initially with the primer pair named Cpallexi-senso2 (5' CTACCACAAYGGNTCVTC 3') and Cpallexi-anti1 (5' CACNGCGTTRAAGAARTC 3') specifically designed to amplify a ~230-bp fragment from all currently known allexiviruses. Positive samples were then analyzed with specific primers for GarV-A, GarV-C, and GarV-D (2), GarMbFV (1) and GarV-B named CPBS2 (5' GCAGAATAARCCCCCYTC 3') and CPBA1 (5' RAAGGGTTTATTCTGTTG 3') obtained in this work. Among the plants analyzed, 50 were positive for the Cpallexi-senso2/Cpallexi-anti1 primers but negative for all the specific primers tested, indicating the presence of a different allexivirus. These samples were then analyzed by RT-PCR for the presence of GarV-X, GarV-E, and ShVX and an amplicon of ~550 bp was obtained only with primers CPXS2 (5' GCCTTCTGAAAATGACTTAG 3') and CPXA1 (5' CTAGGATTTGCTGTTGGG 3') designed in this work to amplify a fragment of the capsid protein gene for GarV-X. Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (2), another set of primers, namely PIXS1 (GACGACGGYGCACTACTC) / PIXA1 (YGTGAATCGTGATGATCC) and PFXS2 (CRCTGAGACAATTYYGTGG) / PFXA2 (CAAAGCATCGGCCRTAGCG) derived from conserved regions of ORF4, ORF5 (CP), and ORF 6 sequences of allexiviruses available in the NCBI database, were used in RT-PCR to obtain the complete CP gene nucleotide sequence. A 1,071-nt sequence comprising 108 bp of ORF4 (partial), 732 bp of the CP, and 177 bp of ORF 6 was successfully amplified (GenBank Accession No. KF530328). The complete CP gene showed 98% nucleotide sequence identity with GarV-X from Australia (JQ807994.1). In summary, GarV-X was detected in the 50 samples collected from Minas Gerais, São Paulo, and Paraná, indicating widespread distribution in Brazil. To our knowledge, this is the first report of GarV-X in garlic in Brazil. References: (1) M. S. Fayad-Andre et al. Trop. Plant Pathol. 36:341, 2011. (2) P. A. Melo Filho et al. Pesq. Agropec. Bras. 39:735, 2004. (3) R. J. Nascimento et al. Summa Phytopathol. 34:267, 2008.

Amplifiability of mitochondrial, microsatellite and amelogenin DNA loci from fecal samples of red brocket deer Mazama americana (Cetartiodactyla, Cervidae).

We tried to amplify mitochondrial, microsatellite and amelogenin loci in DNA from fecal samples of a wild Mazama americana population. Fifty-two deer fecal samples were collected from a 600-ha seasonal semideciduous forest fragment in a subtropical region of Brazil (21°20'S, 47°17'W), with the help of a detection dog; then, stored in ethanol and georeferenced. Among these samples 16 were classified as "fresh" and 36 as "non-fresh". DNA was extracted using the QIAamp(®) DNA Stool Mini Kit. Mitochondrial loci were amplified in 49 of the 52 samples. Five microsatellite loci were amplified by PCR; success in amplification varied according to locus size and sample age. Successful amplifications were achieved in 10/16 of the fresh and in 13/36 of the non-fresh samples; a negative correlation (R = -0.82) was found between successful amplification and locus size. Amplification of the amelogenin locus was successful in 22 of the 52 samples. The difficulty of amplifying nuclear loci in DNA samples extracted from feces collected in the field was evident. Some methodological improvements, including collecting fresh samples, selecting primers for shorter loci and quantifying the extracted DNA by real-time PCR, are suggested to increase amplification success in future studies.

A Synopsis of Knowledge of the Rhopalosomatidae (Hymenoptera) in Brazil: an Annotated Checklist of the Family in the Country, with a Revised Key to the Brazilian Genera.

This study is focused on the cricket leeches, Rhopalosomatidae, a family that is only poorly represented in entomological collections in Brazil. We provided a revised and updated key to the genera occurring in Brazil with the major traits of genera illustrated through high-resolution photomicrography. Also, we provided a synopsis of genera, a list of the species currently recorded from Brazil, the first country records for Rhopalosoma minus Townes, 1977 and Rhopalosoma breelandi Townes, 1977, which increases the diversity of these wasps in the country. Additionally, we provided information and a brief discussion about collection methods, flotation, and abundance of specimens collected. Maps with the geographical distribution of the studied species based on the previous and new records are also provided.

The pollination ecology of a rare case of bee-pollinated Psittacanthus mistletoe.

The genus Psittacanthus (Loranthaceae) is widely distributed in the Neotropical region, where it is known for its large, colourful, scentless flowers. Until very recently, all Psittacanthus species were regarded as exclusively hummingbird-pollinated and the large species radiation in the genus attributed to the interactions with bird dispersers and pollinators. P. eucalyptifolius (Kunth) G.Don. is the only species reported as bee-pollinated. Here we describe the floral biology, floral visitors, and the reproductive system of P. eucalyptifolius in an Amazonian savanna, Brazil. We also compare the pollination success (reproductive performance) among different Psittacanthus species reported in previous studies. Psittacanthus eucalyptifolius produces sweet-scented flowers, and a small quantity of concentrated nectar. At least five species of scopate bees were recorded visiting and carrying pollen of P. eucalyptifolius. Xylocopa frontalis carried most pollen, visited more flowers, remained longer, and touched reproductive parts of flowers in >95% of the observed visits. Experiments indicate that P. eucalyptifolius is partially autocompatible (39% autonomous pollination) but depends on pollinators to achieve higher performance (~78% in control), indicating that bees can be as effective as birds in pollinating this group of mistletoes.

Transmission of Citrus leprosis virus C by Brevipalpus phoenicis (Geijskes) to Alternative Host Plants Found in Citrus Orchards.

The equivalent of US$75 million is spent each year in Brazil to control Brevipalpus phoenicis, a mite vector of Citrus leprosis virus C (CiLV-C). In this study, we investigated the possibility that hedgerows and windbreaks normally found in citrus orchards could host CiLV-C. Mites confined by an adhesive barrier were reared on sweet orange fruit with leprosis symptoms then were transferred to leaves of Hibiscus rosa-sinensis, Malvaviscus arboreus, Grevilea robusta, Bixa orellana, and Citrus sinensis. Ninety days post infestation, the descendant mites were transferred to Pera sweet orange plants to verify the transmissibility of the virus back to citrus. Nonviruliferous mites which had no feeding access to diseased tissue were used as controls. Local chlorotic or necrotic spots and ringspots, symptoms of leprosis disease, appeared in most plants tested. Results generated by reversetranscription polymerase chain reaction with primers specific for CiLV-C and by electron microscope analyses confirmed the susceptibility of these plants to CiLV-C.

Unravelling the role of 17ß-estradiol on advancing uterine luteolytic cascade in cattle.

In cattle, 17ß-estradiol (E2) stimulates prostaglandin F2α (PGF2α) synthesis, which causes luteolysis. Except for the well-established upregulation of oxytocin receptor gene (OXTR), molecular mechanisms of E2-induced PGF2α release in vivo remain unknown. We hypothesized that E2-induced PGF2α release requires de novo transcription of components of the PGF2α synthesis machinery. Beef cows (n = 52) were assigned to remain untreated (Control; n = 10), to receive 50% ethanol infusion intravenously (Placebo; n = 21), or 3 mg E2 in 50% ethanol infusion intravenously (Estradiol; n = 21) on day 15 (D15) after estrus. We collected a single endometrial biopsy per animal at the time of the treatment (0h; Control B0h group), 4 hours (4h; Placebo B4h group and Estradiol B4h group), or 7 hours (7h; Placebo B7h group and Estradiol B7h group) post-treatment. Compared to the Placebo group, the Estradiol group presented significantly greater 13,14-dihydro-15-keto-PGF2α concentrations between 4h and 7h and underwent earlier luteolysis. At 4h, the qPCR analysis showed a lower abundance of ESR1, ESR2 and aldo-keto reductase family 1 member B1 (AKR1B1) genes in the Estradiol B4h group, and a greater abundance of OXTR compared to the Placebo B4h group. Similarly, the E2 treatment significantly reduced the abundance of AKR1B1, and AKR1C4 in the Estradiol B7h group, compared to the placebo group. Overall, E2-induced PGF2α release and luteolysis involved an unexpected and transient downregulation of components of the PGF2α-synthesis cascade, except for OXTR, which was upregulated. Collectively, our data suggest that E2 connects newly-synthesized OXTR to pre-existing cellular machinery to synthesize PGF2α and cause luteal regression.

Efficacy of several digital radiographic imaging systems for laboratory determination of endodontic file length.

AIM: To compare the efficacy of different digital radiographic imaging systems for determining the length of endodontic files. METHODOLOGY: K-type endodontic files were introduced into the canals of 40 extracted human permanent single-rooted teeth and fixed in place at random lengths. The teeth were radiographed using Digora Optime, CygnusRay MPS and CDR Wireless digital imaging systems. Six observers measured every file length in all the images and repeated this procedure in 50% of the image samples, and assigned a score to the level of difficulty found. Analysis of variance for differences between digital systems and Tukey's test were performed. The level of intraobserver agreement was measured by intraclass correlation. The assigned scores were evaluated by Kruskal-Wallis and Dunn's tests. RESULTS: The CDR Wireless values did not differ significantly from the actual lengths and the CygnusRay MPS values. The Digora Optime system was significantly different from the others and overestimated the values (P ≤ 0.05). The Digora Optime was significantly easier to use for taking measurements and the CygnusRay MPS the most difficult (P ≤ 0.05). All digital radiographic imaging systems showed excellent agreement with the Intraclass Correlation Coefficient >0.95. CONCLUSIONS: The three digital radiographic imaging systems were precise. The CDR Wireless system was significantly more accurate in determining endodontic file lengths, and similarly to Digora Optime, was considered the least difficult to use when assessing endodontic file lengths.

A New Species of Tetragona Lepeletier & Serville, 1828 from the "truncata group" and New Distribution Records of T. truncata Moure, 1971 (Hymenoptera: Apidae).

Tetragona Lepeletier & Serville is a genus of stingless bees with 14 recognized species occurring from Mexico to Argentina. The genus is characterized by velvety genal area, mesotibial spur present, and propodeal triangle glabrous. Within the genus, the truncata species group (T. truncata Moure and T. atahualpa sp. nov.) is characterized by worker metabasitarsus with posterior angle rounded and the mandible with two short teeth of similar length. Tetragona truncata is reported with new records for Ecuador (Napo and Orellana), Peru (Huánuco, Loreto, and San Martín), and Brazil (Acre [Rio Branco] and Tocantins [Itacá, Lizarda and Palmas]). In addition, T. atahualpa sp. nov. is described as a new species from regions of altitudes above 1,800 m in Colombia (Boyacá), Ecuador (Napo, Zamora-Chinchipe), and Peru (Pasco). We illustrate and discuss the identification of these two species.

Lung injury caused by occupational exposure to particles from the industrial combustion of cashew nut shells: a mice model.

Cashew nut shells (CNS) is already used in the energy matrix of some industries. However, it is necessary to know the harmful health effects generated by exposure to pollutants of its combustion, especially in the workers exposed to industrial pollutants. In addition, it is known that the incidence of asthma grows among workers in industries, and due to its previously reported biological effects of anethole, these will also be objects of the present study. We used 64 Balb/C mice, randomly divided into eight groups. Groups were sensitized and challenged with saline or ovalbumin, then subjected to intranasal instillation of 30 µg PM4.0 (occupational exposure) from the combustion of CNS or saline, and then were subsequently treated with oral anethole 300 mg/kg or 0.1% Tween 80. Our results serve as a starting point for the development of public policies for the prevention of diseases in workers that are exposed to the pollutants coming from industries.

PRL3 enhances T-cell acute lymphoblastic leukemia growth through suppressing T-cell signaling pathways and apoptosis.

T-cell acute lymphoblastic leukemia (T-ALL) is an aggressive malignancy of thymocytes and is largely driven by the NOTCH/MYC pathway. Yet, additional oncogenic drivers are required for transformation. Here, we identify protein tyrosine phosphatase type 4 A3 (PRL3) as a collaborating oncogenic driver in T-ALL. PRL3 is expressed in a large fraction of primary human T-ALLs and is commonly co-amplified with MYC. PRL3 also synergized with MYC to initiate early-onset ALL in transgenic zebrafish and was required for human T-ALL growth and maintenance. Mass-spectrometry phosphoproteomic analysis and mechanistic studies uncovered that PRL3 suppresses downstream T-cell phosphorylation signaling pathways, including those modulated by VAV1, and subsequently suppresses apoptosis in leukemia cells. Taken together, our studies have identified new roles for PRL3 as a collaborating oncogenic driver in human T-ALL and suggest that therapeutic targeting of the PRL3 phosphatase will likely be a useful treatment strategy for T-ALL.

Review of Leucospilomutilla Ashmead and Description of the New Genus Atlantilla (Hymenoptera: Mutillidae).

The new genus Atlantilla Williams & Bartholomay, gen. nov. (type species Mutilla auriculata Gerstaecker, 1874), is proposed based on the combination of previously undescribed males from the Atlantic Forest and females of Traumatomutilla auriculata (Gerstaecker, Arch Naturgesch 40:41-77, 1874). This genus is similar to Leucospilomutilla Ashmead, 1903, which is also reviewed here. The previously unknown male of L. staurogastra Suárez, 1973 is described. Keys and illustrations are provided for each of the three known Leucospilomutilla species.

Conversion of MDF wastes into a char with remarkable potential to remove Food Red 17 dye from aqueous effluents.

Medium density fiberboard (MDF) wastes were converted into an efficient char able to uptake Food Red 17 dye (FR17) from colored effluents. The yield of the pyrolysis process, in terms of char, was 29%. The produced char presented micro and mesoporous, with surface area of 218.8 m2 g-1 and total pore volume of 0.122 cm3 g-1. Regarding to the FR17 adsorption, removal percentages of 90% were found at pH 2 and using 0.5 g L-1 of char. Pseudo-first and pseudo-second order models were adequate to represent the adsorption kinetic profile, being the equilibrium reached within 20 min. Freundlich model was selected to represent the equilibrium data. The maximum adsorption capacity was 210 mg g-1. The adsorption of FR17 on the char was endothermic and physical in nature. The char was efficient for 8 adsorption-desorption cycles, maintaining the same adsorption capacity. In brief, this work demonstrated a useful practice in terms of cleaner production. It was possible add value to MDF wastes, generating an efficient and reusable adsorbent to treat colored effluents containing FR 17 dye.

Characterization of Santa Catarina (Brazil) coal with respect to human health and environmental concerns.

The current paper presents the concentration, distribution, and modes of occurrence of trace elements of 13 coals from south Brazil. The samples were collected in the state of Santa Catarina. Chemical analyses and the high ash yields indicate that all studied coals are rich in mineral matter, with SiO(2) and Al(2)O(3) dominating as determined by inductively coupled plasma-atomic emission spectrometry (ICP-AES). Quartz is the main mineral species and is associated with minor levels of feldspars, kaolinite, hematite, and iron-rich carbonates. The contents of trace elements, including As, Pb, Cd, Ni, Cr, Mn, Be, V, U, Zn, Li, Cu, Tl, and Ni, in coals were determined. A comparison of ranges and means of elemental concentrations in Santa Catarina, Brazil, and world coals shows that the ranges of most elements in Santa Catarina coal are very close to the usual worldwide concentration ranges in coal.