Genetic preservation of SLC22A3 in the Admixed and Xhosa populations living in the Western Cape.

BACKGROUND: Amphiphilic solute facilitator organic cation transporters mediate the movement of various endogenous and exogenous organic cations, including crucial drugs like metformin, oxaliplatin, and lamivudine. These transporters are now seen as a potential explanation for inter-individual differences in drug effectiveness, contributing to 15-30% of such variability due to genetic factors.The aim of this study was to determine the baseline minor allele frequency distribution of 18 known coding SNPs in the SLC22A3 gene of 278 Cape Admixed (130) and Xhosa (148) individuals residing in Cape Town, South Africa. METHODS: A convenience sampling method was used for sample collection. DNA extraction and subsequent amplification of target sites was carried out according to standard established methodologies. All genotyping was performed using the SNaPshot™ mini-seuqencing platform. RESULTS: This study found no genetic polymorphisms in the coding region of the SLC22A3 gene of both the Xhosa and Cape Admixed individuals investigated. CONCLUSION: This study has shown that SLC22A3 coding SNPs observed in other populations are absent in the sample of both Cape Admixed and Xhosa individuals studied. The lack of protein sequence variation was consistent with other studies and may reflect the significant physiological role of human organic cation transporter 3 in maintaining cellular and organismal homeostasis.

Cross-sectional study of prevalence and determinants of uncontrolled hypertension among South African adult residents of Mkhondo municipality.

BACKGROUND: Achieving the blood pressure treatment target in individuals with hypertension is a serious global health challenge. Furthermore, the actual burden of uncontrolled hypertension is poorly understood, especially in the developing countries. Therefore, this study comprehensively examined the prevalence and factors associated with uncontrolled hypertension in individuals receiving care at the primary healthcare facilities in the rural areas of Mkhondo Municipality in the Mpumalanga Province, South Africa. METHODS: In this cross-sectional study, 329 individuals attending care for hypertension were recruited from January 2019 to June 2019 at three primary healthcare centres, namely, Piet Retief hospital, Mkhondo town clinic and Thandukukhanya community health centre. Uncontrolled hypertension was defined as systolic blood pressure ≥ 140 mmHg and/or diastolic blood pressure ≥ 90 mmHg in accordance with the South African Hypertension Society guideline (2014). Multiple logistic regression (Forward LR method) analysis was used to identify the significant determinants of uncontrolled hypertension. RESULTS: The majority of the participants were 55 years old and above (69.0%), Zulus (81.2%), non-smokers (84.19%) and had been diagnosed with hypertension for more than a year prior to the study (72.64%). The overall prevalence of uncontrolled hypertension was 56.83% (n = 187) with no significant difference between sexes, 57.38% male versus 56.88% female, respectively. In the multiple logistic regression model analysis after adjusting for confounding variables, obesity (AOR = 2.90; 95% CI 1.66-5.05), physical activity (AOR = 4.79; 95% CI 2.15-10.65) and HDL-C (AOR = 5.66; 95% CI 3.33-9.60) were the significant and independent determinants of uncontrolled hypertension in the cohort. CONCLUSION: The high prevalence of uncontrolled hypertension in the study setting can be largely attributed to obesity, physical activity and dyslipidaemia. Treatment will require the collaborative efforts of individuals, clinicians and health authorities. All these determinants should be addressed decisively so as to achieve the treatment blood pressure targets in the study population.

Glucose-Uptake Activity and Cytotoxicity of Diterpenes and Triterpenes Isolated from Lamiaceae Plant Species.

The prevalence of diabetes mellitus (DM), considered one of the most common metabolic disorders, has dramatically increased and resulted in higher rates of morbidity and mortality around the world in the past decade. It is well known that insulin resistance in target tissues and a deficiency in insulin secretion from pancreatic ß-cells are the main characteristics of type 2 diabetes. The aim of this study was the bio-evaluation of compounds isolated from three selected plant species: namely, Salvia africana-lutea, Leonotis ocymifolia, and Plectranthus madagascariensis, for their glucose-uptake ability. Methanolic extracts were produced from the aerial parts of each plant. Compounds were identified using different spectroscopic techniques. The glucose-uptake ability of each compound was then evaluated in mammalian cells using 2-deoxyglucose-6-phosphate. The cytotoxicity of each compound was established via the MTT assay. Chromatographic purification of the three plant species yielded sixteen pure terpenoids. Compounds 1 (p = 0.0031), 8 (p = 0.0053), and 6 (p = 0.0086) showed a marked increase in glucose uptake, respectively. Additionally, 1, 4, and 6 exhibited cytotoxicity toward mammalian tissue with a decrease in cell viability of ~70%, ~68%, and ~67%, respectively. The results suggested that several compounds demonstrated a marked increase in glucose uptake, while two of the compounds exhibited signs of cytotoxicity. It may, therefore, be suggested that these compounds be considered as potential candidates for novel plant-derived alternative therapies in the treatment of type 2 diabetes.

Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa.

Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0%, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5%, respectively.

Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1) in the Xhosa population of South Africa.

Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885), P341L (rs2282143), V519F (rs78899680), and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357), C88R (rs55918055), S189L (rs34104736), G220V (rs36103319), P283L (rs4646277), R287G (rs4646278), G401S (rs34130495), M440I (rs35956182), or G465R (rs34059508). In addition, no variant alleles were observed for A306T (COSM164365), A413V (rs144322387), M420V (rs142448543), I421F (rs139512541), C436F (rs139512541), V501E (rs143175763), or I542V (rs137928512) in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

Promoter haplotype structure of solute carrier 22 member 2 (SLC22A2) in the Xhosa population of South Africa and their differential effect on gene expression.

SLC22A2 is abundantly expressed in the kidney and facilitates the transport of endogenous and exogenous cationic compounds. It plays a pivotal role in the transport of pharmacologically important compounds such as metformin, cisplatin, lamivudine and cimetidine. Polymorphisms within SLC22A2 could potentially contribute to the inter-individual variable response to drugs. The SLC22A2 gene is known to show polymorphism variability amongst populations of different ethnicities. The present study was undertaken to characterize the promoter haplotype structure of the SLC22A2 gene in the Xhosa population of South Africa. In addition to this, we also investigate the effects of the observed promoter haplotypes on gene expression levels in vitro. We identified six known single nucleotide polymorphisms in the promoter region, namely rs60249401 (G424A), rs113150889 (G289A), rs55920607 (C246T), rs59695691 (A195G), rs572296424 (G156A), rs150063153 (A95C/G) and one novel SNP at location 6:160258967 (A209T). While these polymorphisms appeared in other African and non-African populations, their minor allele frequencies differed considerably from the non-African populations and could be considered to be African specific. A total of nine promoter haplotypes were characterized and the functional significance of each haplotype on promoter activity was determined using a luciferase reporter assay system. Amongst the nine observed haplotypes, three haplotypes (i.e. haplotypes 7, 8 and 9) displayed a significant decrease in expression level when compared to the wild-type with p -values of: 0.0317, <0.0001 and 0.0013 respectively. The data presented here shows African specific promoter haplotypes to cause a decrease in SLC22A2 gene expression levels, which in turn may have an impact on the pharmacokinetic profiles of cationic drugs.

Cross-sectional study of the association of 5 single nucleotide polymorphisms with enalapril treatment response among South African adults with hypertension.

ABSTRACT: This study investigates the association of 5 single nucleotide polymorphisms (SNPs) in selected genes (ABO, VEGFA, BDKRB2, NOS3, and ADRB2) with blood pressure (BP) response to enalapril. The study further assessed genetic interactions that exist within these genes and their implications in enalapril treatment response among South African adults with hypertension.A total of 284 participants belonging to the Nguni tribe of South Africa on continuous treatment for hypertension were recruited. Five SNPs in enalapril pharmacogenes were selected and genotyped using MassArray. Uncontrolled hypertension was defined as BP ≥140/90 mm Hg. The association between genotypes, alleles, and BP response to treatment was determined by fitting multivariate logistic regression model analysis, and genetic interactions between SNPs were assessed by multifactor dimensionality reduction.Majority of the study participants were female (75.00%), Xhosa (78.87%), and had uncontrolled hypertension (69.37%). All 5 SNPs were exclusively detected among Swati and Zulu participants. In the multivariate (adjusted) logistic model analysis, ADRB2 rs1042714 GC (adjusted odds ratio [AOR] = 2.31; 95% confidence interval [CI] 1.02-5.23; P = .044) and BDKRB2 rs1799722 CT (AOR = 2.74; 95% CI 1.19-6.28; P = .017) were independently associated with controlled hypertension in response to enalapril. While the C allele of VEGFA rs699947 (AOR = 0.37; 95% CI 0.15-0.94; P = .037) was significantly associated with uncontrolled hypertension. A significant interaction between rs699947, rs495828, and rs2070744 (cross-validation consistency = 10/10; P = .0005) in response to enalapril was observed.We confirmed the association of rs1042714 (ADRB2) and rs1799722 (BDKRB2) with controlled hypertension and established an interaction between rs699947 (VEGFA), rs495828 (ABO), and rs2070744 (NOS3) with BP response to enalapril. Our findings have provided substantial evidence for the use of SNPs as predictors for enalapril response among South Africans adults with hypertension.

Single Nucleotide Polymorphisms Associated with Metformin and Sulphonylureas' Glycaemic Response among South African Adults with Type 2 Diabetes Mellitus.

AIMS: To examine the association of polymorphisms belonging to SLC22A1, SP1, PRPF31, NBEA, SCNN1B, CPA6 and CAPN10 genes with glycaemic response to metformin and sulphonylureas (SU) combination therapy among South African adults with diabetes mellitus type 2 (T2DM). METHODS: A total of 128 individuals of Swati (n = 22) and Zulu (n = 106) origin attending chronic care for T2DM were recruited. Nine SNPs previously associated with metformin and SUs were selected and genotyped using MassArray. Uncontrolled T2DM was defined as HbA1c > 7%. The association between genotypes, alleles and glycaemic response to treatment was determined using multivariate logistic regression model analysis. RESULTS: About 85.93% (n = 110) of the study participants were female and 77.34% (n = 99) had uncontrolled T2DM (HbA1c > 7%). In the multivariate (adjusted) logistic regression model analysis, the CC genotype of rs2162145 (CPA6), GG and GA genotypes of rs889299 (SCNN1B) were significantly associated with uncontrolled T2DM. On the other hand, the C allele of rs254271 (PRPF31) and the GA genotype of rs3792269 (CAPN10) were associated with controlled T2DM. A significant interaction between rs2162145 and rs889299 in response to metformin and SU combination therapy was observed. CONCLUSIONS: In this study, we reported the association of rs2162145 (CC) and rs889299 (GG and GA) with uncontrolled T2DM. We also reported the association of rs254271 (C) and rs3792269 (GA) with controlled T2DM in response to metformin and SU combination therapy. Furthermore, an interaction between rs2162145 and rs889299 was established, where the genotype combination GA (rs889299) and TT (rs2162145) was associated with uncontrolled T2DM.

Factors associated with glycemic control among South African adult residents of Mkhondo municipality living with diabetes mellitus.

This study examines the rate and the influencing factors of glycemic control among adult residents living with DM in Mkhondo Municipality of South Africa.In this cross-sectional study, 157 individuals attending care for DM were recruited. Glycemic control status was categorized as poor if glycated hemoglobin (HbA1c) > 7% and very poor if HbA1c ≥ 9%. Multivariate regression analysis was used to identify the significant determinants of poor and very poor glycemic control.The majority of the study participants were females (84.71%) and above 45 years old (88.55%). The overall prevalence of poor glycemic control was 77.71% (n = 122), while very poor glycemic control occurred in 50.6% (n = 80) of the study cohort. In the multivariate logistic regression model analysis, African traditional [AOR = 0.15; 95% confidence interval (95% CI) 0.04-0.57], fast food consumption (AOR = 5.89; 95% CI 2.09-16.81), elevated total cholesterol (TC) [odds ratio (OR) = 2.33; 95% CI 1.50-5.17], elevated low-density lipoprotein cholesterol (LDL-C) (AOR = 5.28; 95% CI 1.89-14.69), and triglyceride (TG) (AOR = 4.39; 95% CI 1.48-13.00) were the independent and significant determinants of poor glycemic control. Age (AOR = 0.46; 95% CI 0.23-0.92) was the only independent and significant determinant of very poor glycemic control.We found a high rate of poor glycemic control (77.71%) possibly attributed to religious affiliation, fast food consumption, and dyslipidemia. On the contrary, about half of the study sample had very poor glycemic control (HbA1c ≥9%), which was predominant among younger cohort with diabetes mellitus. Interventions aimed at improving glycemic control in this population must also target religious practice, dietary patterns and dyslipidemia as well as tailored-approach for young people.

Genomic Association of Single Nucleotide Polymorphisms with Blood Pressure Response to Hydrochlorothiazide among South African Adults with Hypertension.

This study described single nucleotide polymorphisms (SNPs) in hydrochlorothiazide-associated genes and further assessed their correlation with blood pressure control among South African adults living with hypertension. A total of 291 participants belonging to the Nguni tribes of South Africa on treatment for hypertension were recruited. Nineteen SNPs in hydrochlorothiazide pharmacogenes were selected and genotyped using MassArray. Uncontrolled hypertension was defined as blood pressure ≥140/90 mmHg. The association between genotypes, alleles and blood pressure response to treatment was determined by conducting multivariate logistic regression model analysis. The majority of the study participants were female (73.19%), Xhosa (54.98%) and had blood pressure ≥140/90 mmHg (68.73%). Seventeen SNPs were observed among the Xhosa tribe, and two (rs2070744 and rs7297610) were detected among Swati and Zulu participants. Furthermore, alleles T of rs2107614 (AOR = 6.69; 95%CI 1.42-31.55; p = 0.016) and C of rs2776546 (AOR = 3.78; 95%CI 1.04-13.74; p = 0.043) were independently associated with uncontrolled hypertension, whilst rs2070744 TC (AOR = 38.76; 95%CI 5.54-270.76; p = 0.00023), CC (AOR = 10.44; 95%CI 2.16-50.29; p = 0.003) and allele T of rs7297610 (AOR = 1.86; 95%CI 1.09-3.14; p = 0.023) were significantly associated with uncontrolled hypertension among Zulu and Swati participants. We confirmed the presence of SNPs associated with hydrochlorothiazide, some of which were significantly associated with uncontrolled hypertension in the study sample. Findings open doors for further studies on personalized therapy for hypertension in the country.

Evaluation of the suitability of 19 pharmacogenomics biomarkers for individualized metformin therapy for type 2 diabetes patients.

Objectives Type 2 Diabetes mellitus is a progressive metabolic disease characterized by relative insulin insufficiency and insulin resistance resulting in hyperglycemia. Despite the widespread use of metformin, there is considerable variation in treatment response; with approximately one-third of patients failing to achieve adequate glycemic control. Studies have reported the involvement of single nucleotide polymorphisms and their interactions in genetic pathways i.e., pharmacodynamics and pharmacokinetics. This study aims to investigate the association between 19 pharmacogenetics biomarkers and response to metformin treatment. Methods MassARRAY panels were designed and optimized by Inqaba Biotechnical Industries, to genotype 19 biomarkers for 140 type 2 diabetic outpatients. Results The CT genotype of the rs12752688 polymorphism was significantly associated with increased response to metformin therapy after correction (OR=0.33, 95% CI [0.16-0.68], p-value=0.006). An association was also found between the GA genotype of SLC47A2 rs12943590 and a decreased response to metformin therapy after correction (OR=2.29, 95% CI [1.01-5.21], p-value=0.01). Conclusions This is the first study investigating the association between genetic variants and responsiveness to medication for diabetic patients from the indigenous Nguni population in South Africa. It is suggested that rs12752688 and rs12943590 be included in pharmacogenomics profiling systems to individualize metformin therapy for diabetic patients from African populations.

Socio-demographic and modifiable risk factors of diabetes and hypertension among resource constrained patients from rural areas in Mdantsane Township in South Africa.

BACKGROUND: Recently, developing countries have shown a dramatic increase in non-communicable diseases (NCDs). The burden of NCDs in South Africa has increased over the past years resulting in an estimated 37% of all- cause mortality and 16% of disability-adjusted life years. Currently, diabetes mellitus (DM) and hypertension (HTN) are the two most prevalent NCDs associated with the rapid increase in mortality. OBJECTIVE: To demonstrate the socio-demographic and modifiable risk factors of diabetes mellitus (DM) and hypertension (HTN) among South African adults. METHODS: A cross-sectional analytical study was conducted in the Cecilia Makiwane Hospital serving the residents of Mdantsane. Relevant socio-demographic data, anthropometric measurements, triplicate blood pressure, fasting blood glucose and lipogram analysis were obtained from 265 outpatients. RESULTS: Multivariate anlysis shows that; salt intake, smoking, elevated triglycerides and decreased high-density lipoprotein levels were significantly associated with DM with adjusted odds ratio of 0.18 (p=0.002), 0.26 (p=0.048), 2.19 (p=0.006) and 0.38 (p=0.001), respectively. Overweight and obesity were significantly associated with hypertension with odds ratio of 0.03 (p=0.01) and 0.06 (p=0.006), respectively. CONCLUSION: The burden of DM and HTN on society can be drastically reduced with simple lifestyle changes, development of preventative strategies, large-scale screening and better disease management in South Africa.

Evaluation of the suitability of 19 pharmacogenomics biomarkers for individualized metformin therapy for type 2 diabetes patients.

Objectives Type 2 Diabetes mellitus is a progressive metabolic disease characterized by relative insulin insufficiency and insulin resistance resulting in hyperglycemia. Despite the widespread use of metformin, there is considerable variation in treatment response; with approximately one-third of patients failing to achieve adequate glycemic control. Studies have reported the involvement of single nucleotide polymorphisms and their interactions in genetic pathways i.e., pharmacodynamics and pharmacokinetics. This study aims to investigate the association between 19 pharmacogenetics biomarkers and response to metformin treatment. Methods MassARRAY panels were designed and optimized by Inqaba Biotechnical Industries, to genotype 19 biomarkers for 140 type 2 diabetic outpatients. Results The CT genotype of the rs12752688 polymorphism was significantly associated with increased response to metformin therapy after correction (OR=0.33, 95% CI [0.16-0.68], p-value=0.006). An association was also found between the GA genotype of SLC47A2 rs12943590 and a decreased response to metformin therapy after correction (OR=2.29, 95% CI [1.01-5.21], p-value=0.01). Conclusions This is the first study investigating the association between genetic variants and responsiveness to medication for diabetic patients from the indigenous Nguni population in South Africa. It is suggested that rs12752688 and rs12943590 be included in pharmacogenomics profiling systems to individualize metformin therapy for diabetic patients from African populations.

Effect of the African-specific promoter polymorphisms on the SLC22A2 gene expression levels.

BACKGROUND: Single nucleotide polymorphisms in promoter regions have been shown to alter the transcription of genes. Thus, SNPs in SLC22A2 can result in inter-individual variable response to medication. METHODS: The objective of the study was to investigate the effect of the African-specific promoter polymorphisms on the SLC22A2 gene expression levels in vitro. These included rs572296424 and rs150063153, which have been previously identified in the Xhosa population of South Africa. The promoter region (300 bp) for the two haplotypes was cloned into the pGLOW promoterless GFP reporter vector. The GFP expression levels of each haplotype was determined in the HEK293 cells using a GlowMax Multi-Detection E7031 luminometer in the form of light emission. RESULTS: The relative promoter activity suggests that no significant variation exists between the expression levels of the WT and -95 haplotypes and the -95 and -156 haplotypes (p=0.498). However, the relative promoter activity of the WT haplotype in comparison to the -156 haplotype displayed a significant difference in expression level (p=0.016). CONCLUSIONS: The data presented here show that the African-specific promoter polymorphisms can cause a decrease in the SLC22A2 gene expression levels in vitro, which in turn, may influence the pharmacokinetic profiles of cationic drugs.

SLC22A2 - mapping genomic variations within South African indigenous and admixed populations.

BACKGROUND: The SLC22A2 gene is a polyspecific transporter that mediates the electrogenic transport of small organic cations with different molecular structures. Furthermore, single-nucleotide polymorphisms (SNPs) of SLC22A2 are clinically significant because they can alter the transport of substrate drugs and may, thus, influence the efficacy and toxicity thereof. Additionally, further studies have reported that SLC22A2 is responsible for 80% of the total metformin clearance. Therefore, loss-of-function variants of SLC22A2 could affect the pharmacokinetic and pharmacodynamic characteristics of metformin. Although it is widely accepted that African populations harbor a greater amount of genomic diversity compared to other populations, limited information is available regarding genetic polymorphisms in SLC genes among African populations, specifically those related to impaired functional activity of hOCT2. Therefore, the aim of this study was to map known impaired function variants in the SLC22A2 gene. METHODS: Development of multiplex SNaPshot™ genotyping assay for 20 previously reported SLC22A2 nonsynonymous SNPs and the assessment of baseline allele frequencies of these variants in 140 Cape Admixed, 148 Xhosa and 152 Zulu individuals residing in Cape Town, South Africa. RESULTS: We identified three nonsynonymous SNPs, namely, A270S, R400C and K432Q in the population studied at minor allele frequencies of 6.1%, 3.4% and 0.7%, respectively. The most frequently observed haplotypes across all three populations were CATAATGCGTACGCGCGACG (~85%), CATAATGATTACGCGCGACG (~7%) and CATAATGAGTACGCGCGACG (~4.5%). CONCLUSIONS: In addition to SNPs, the haplotypes identified in this study can in future also aid in identifying associations between causative genetic variants and drug response. This study contributes in filling the gap that exists with regards to genetic information about important variations in organic cation transporter genes for the indigenous populations of South Africa.

Lack of genomic diversity in the SLC47A1 gene within the indigenous Xhosa population.

BACKGROUND: Multidrug and toxin extrusion 1 (MATE1) is an organic cation/H+ exchanger, localized in the apical membrane of proximal renal tubules, which mediates the cellular elimination of organic cations into the renal lumen. These organic cations include clinically important drugs such as metformin, oxaliplatin and cimetidine. Moreover, genetic polymorphisms of SLC47A1, the pharmacogenetically relevant gene encoding human MATE1, have been implicated in reduced transport or accumulation to cytotoxic levels of these drugs in vitro. However, little or no information is available on the minor allele frequency distribution of known SLC47A1 coding SNPs in the sub-Saharan African populations. METHODS: Thus, the aim of this study was to determine the baseline minor allele frequency distribution of 20 known coding SNPs in the SLC47A1 gene of 148 Xhosa individuals residing in Cape Town, South Africa. RESULTS: This study did not identify any of these known SLC47A1 coding SNPs in the Xhosa individuals who participated in this study. CONCLUSIONS: It is anticipated that whole genome or exome sequencing may reveal novel SNPs in the Xhosa and other sub-Saharan African populations, which may have been missed with the current genotyping strategy.

Mapping SLCO1B1 Genetic Variation for Global Precision Medicine in Understudied Regions in Africa: A Focus on Zulu and Cape Admixed Populations.

The U.S. President Barack Obama has announced, in his State of the Union address on January 20, 2015, the Precision Medicine Initiative, a US$215-million program. For global precision medicine to become a reality, however, biological and environmental "variome" in previously understudied populations ought to be mapped and catalogued. Chief among the molecular targets that warrant global mapping is the organic anion-transporting polypeptide 1B1 (OATP1B1), encoded by solute carrier organic anion transporter family member 1B1 (SLCO1B1), a hepatic uptake transporter predominantly expressed in the basolateral side of hepatocytes. Human OATP1B1 plays a crucial role in the transport of a wide variety of substrates. This includes endogenous compounds such as bile salts as well as medicines, including benzylpenicillin, methotrexate, pravastatin, and rifampicin, and natural toxins microcystin and phalloidin. Genetic variations observed in the SLCO1B1 gene have been associated with altered in vitro and in vivo OATP1B1 transport activity, and consequently influencing patients' response to medicines, toxins, and susceptibility to common complex diseases. Well-characterized haplotypes, *5 (RS4149056C) and *15 (RS4149056T), have been associated with a strikingly reduced uptake of multiple OATP1B1 substrates, including estrone-3-sulfate, estradiol-17ß-d-glucuronide, atorvastatin, cerivastatin, pravastatin, and rifampicin. In particular, RS4149056C is observed in 60% of the Cape admixed (CA) population and is associated with increased plasma concentrations of many statins as well as fexofenadine and repaglinide. We designed and optimized a SNaPshot minisequencing panel to characterize the variants of relevance for precision medicine in the clinic. We report here the first study on allele and genotype frequencies for 10 nonsynonymous, 4 synonymous, and 6 intronic single-nucleotide polymorphisms of SLCO1B1 in the Zulu and CA populations of South Africa. These variants are further contextualized here, in relation to their potential clinical relevance. These observations collectively contribute to current efforts to advance global precision medicine in understudied populations and resource-limited regions of the world.

Single nucleotide polymorphisms of the SLC22A2 gene within the Xhosa population of South Africa.

Human organic cation transporter 2 (hOCT2) is thought to play a critical role in the uptake, pharmacological effects and/or adverse effects of many cationic clinical therapeutics and xenobiotics. Moreover, genetic variations in hOCT2 gene, SLC22A2, are increasingly being recognized as a possible mechanism that can explain individual variation in drug response. To screen for variations in this gene, SLC22A2 was directly sequenced in 96 healthy Xhosa individuals. A total of 27 variations, including three novel ones, were identified in SLC22A2: eight in exons, 15 in introns, and four in the 5'-untranslated region. The minor allele frequencies (MAF) of genetic variants observed in the Xhosa population were compared both to other African and other world populations. Seventeen of the variants observed in the SLC22A2 gene of the Xhosa population were specific to/or occurred at a higher frequency in African populations or populations with a recent connection to the African continent.

The effect of monovision contact lens wear on driving performance.

BACKGROUND: A number of studies have highlighted the problems with driving reported by wearers of monovision contact lens corrections. In this study, we wished to investigate this further, by determining whether driving performance as measured on the open road under daytime conditions is worse when drivers wear their monovision contact lenses compared to their habitual correction. METHODS: Thirteen subjects with healthy eyes and corrected visual acuity of 6/6 were selected. Each had worn monovision contact lenses for at least three months. All subjects had their driving performance assessed while driving their own vehicles on an open road course, with both monovision contact lenses and their other habitual correction (spectacles or unaided). RESULTS: No statistically significant differences were found in driving performance when subjects wore their monovision contact lenses compared to when they wore their habitual distance correction. CONCLUSIONS: The results indicate that monovision does not adversely affect driving performance in daylight hours for adapted wearers. However, limitations in the study design are acknowledged, including the relatively small sample size, lack of standardisation of the habitual correction and the use of adapted wearers. Future studies are recommended to investigate these issues further.