Dispersal history of SARS-CoV-2 in Galicia, Spain.

The dynamics of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) transmission are influenced by a variety of factors, including social restrictions and the emergence of distinct variants. In this study, we delve into the origins and dissemination of the Alpha, Delta, and Omicron-BA.1 variants of concern in Galicia, northwest Spain. For this, we leveraged genomic data collected by the EPICOVIGAL Consortium and from the GISAID database, along with mobility information from other Spanish regions and foreign countries. Our analysis indicates that initial introductions during the Alpha phase were predominantly from other Spanish regions and France. However, as the pandemic progressed, introductions from Portugal and the United States became increasingly significant. The number of detected introductions varied from 96 and 101 for Alpha and Delta to 39 for Omicron-BA.1. Most of these introductions left a low number of descendants (<10), suggesting a limited impact on the evolution of the pandemic in Galicia. Notably, Galicia's major coastal cities emerged as critical hubs for viral transmission, highlighting their role in sustaining and spreading the virus. This research emphasizes the critical role of regional connectivity in the spread of SARS-CoV-2 and offers essential insights for enhancing public health strategies and surveillance measures.

A new and efficient enrichment method for metagenomic sequencing of Monkeypox virus.

BACKGROUND: The methodology described in previous literature for Monkeypox virus (MPXV) sequencing shows low efficiency when using metagenomic approaches. The aim of the present study was to evaluate a new fine-tuned method for extraction and enrichment of genomic MPXV DNA using clinical samples and to compare it to a non-enrichment metagenomic approach. RESULTS: A new procedure that allows sample enrichment in MPXV DNA, avoiding wasting the sequencing capacity in human DNA, was designed. This procedure consisted of host DNA depletion using a saponin/NaCl combination treatment and DNase, together with high g-force centrifugations. After typical quality control, samples using the enrichment method contained around 96% of reads not classified as human DNA, while the non-enrichment protocol showed around 5-10%. When reads not belonging to Orthopoxvirus were removed, enriched samples kept about 50% of the original read counts, while non-enriched ones kept only 2-7%. CONCLUSIONS: Results showed a very significant improvement in sequencing efficiency, increasing the number of reads belonging to MPXV, the depth of coverage and the trustworthiness of the consensus sequences. This, in turn, allows for more samples to be included in a single cartridge, reducing costs and time to diagnosis, which can be very important factors when dealing with a contagious disease.

Kpi, a chaperone-usher pili system associated with the worldwide-disseminated high-risk clone Klebsiella pneumoniae ST-15.

Control of infections caused by carbapenem-resistant Klebsiella pneumoniae continues to be challenging. The success of this pathogen is favored by its ability to acquire antimicrobial resistance and to spread and persist in both the environment and in humans. The emergence of clinically important clones, such as sequence types 11, 15, 101, and 258, has been reported worldwide. However, the mechanisms promoting the dissemination of such high-risk clones are unknown. Unraveling the factors that play a role in the pathobiology and epidemicity of K. pneumoniae is therefore important for managing infections. To address this issue, we studied a carbapenem-resistant ST-15 K. pneumoniae isolate (Kp3380) that displayed a remarkable adherent phenotype with abundant pilus-like structures. Genome sequencing enabled us to identify a chaperone-usher pili system (Kpi) in Kp3380. Analysis of a large K. pneumoniae population from 32 European countries showed that the Kpi system is associated with the ST-15 clone. Phylogenetic analysis of the operon revealed that Kpi belongs to the little-characterized γ2-fimbrial clade. We demonstrate that Kpi contributes positively to the ability of K. pneumoniae to form biofilms and adhere to different host tissues. Moreover, the in vivo intestinal colonizing capacity of the Kpi-defective mutant was significantly reduced, as was its ability to infect Galleria mellonella The findings provide information about the pathobiology and epidemicity of Kpi+K. pneumoniae and indicate that the presence of Kpi may explain the success of the ST-15 clone. Disrupting bacterial adherence to the intestinal surface could potentially target gastrointestinal colonization.

Microbiome in Immune-Mediated Uveitis.

In the last decades, personalized medicine has been increasing its presence in different fields of medicine, including ophthalmology. A new factor that can help us direct medicine towards the challenge of personalized treatments is the microbiome. The gut microbiome plays an important role in controlling immune response, and dysbiosis has been associated with immune-mediated diseases such as non-infectious uveitis (NIU). In this review, we gather the published evidence, both in the pre-clinical and clinical studies, that support the possible role of intestinal dysbiosis in the pathogenesis of NIU, as well as the modulation of the gut microbiota as a new possible therapeutic target. We describe the different mechanisms that have been proposed to involve dysbiosis in the causality of NIU, as well as the potential pharmacological tools that could be used to modify the microbiome (dietary supplementation, antibiotics, fecal microbiota transplantation, immunomodulators, or biologic drugs) and, consequently, in the control of the NIU. Furthermore, there is increasing scientific evidence suggesting that the treatment with anti-TNF not only restores the composition of the gut microbiota but also that the study of the composition of the gut microbiome will help predict the response of each patient to anti-TNF treatment.

Global Transcriptomic Analysis During Murine Pneumonia Infection Reveals New Virulence Factors in Acinetobacter baumannii.

BACKGROUND: Infections caused by multidrug-resistant pathogens such as Acinetobacter baumannii constitute a major health problem worldwide. In this study we present a global in vivo transcriptomic analysis of A. baumannii isolated from the lungs of mice with pneumonia infection. METHODS: Mice were infected with A. baumannii ATCC 17978 and AbH12O-A2 strains and the total bacterial RNA were analyzed by RNA sequencing. Lists of differentially expressed genes were obtained and 14 of them were selected for gene deletion and further analysis. RESULTS: Transcriptomic analysis revealed a specific gene expression profile in A. baumannii during lung infection with upregulation of genes involved in iron acquisition and host invasion. Mutant strains lacking feoA, mtnN, yfgC, basB, hisF, oatA, and bfnL showed a significant loss of virulence in murine pneumonia. A decrease in biofilm formation, adherence to human epithelial cells, and growth rate was observed in selected mutants. CONCLUSIONS: This study provides an insight into A. baumannii gene expression profile during murine pneumonia infection. Data revealed that 7 in vivo upregulated genes were involved in virulence and could be considered new therapeutic targets.

Antisense inhibition of lpxB gene expression in Acinetobacter baumannii by peptide-PNA conjugates and synergy with colistin.

BACKGROUND: LpxB is an enzyme involved in the biosynthesis pathway of lipid A, a component of LPS. OBJECTIVES: To evaluate the lpxB gene in Acinetobacter baumannii as a potential therapeutic target and to propose antisense agents such as peptide nucleic acids (PNAs) as a tool to combat bacterial infection, either alone or in combination with known antimicrobial therapies. METHODS: RNA-seq analysis of the A. baumannii ATCC 17978 strain in a murine pneumonia model was performed to study the in vivo expression of lpxB. Protein expression was studied in the presence or absence of anti-lpxB (KFF)3K-PNA (pPNA). Time-kill curve analyses and protection assays of infected A549 cells were performed. The chequerboard technique was used to test for synergy between pPNA and colistin. A Galleria mellonella infection model was used to test the in vivo efficacy of pPNA. RESULTS: The lpxB gene was overexpressed during pneumonia. Treatment with a specific pPNA inhibited LpxB expression in vitro, decreased survival of the ATCC 17978 strain and increased the survival rate of infected A549 cells. Synergy was observed between pPNA and colistin in colistin-susceptible strains. In vivo assays confirmed that a combination treatment of anti-lpxB pPNA and colistin was more effective than colistin in monotherapy. CONCLUSIONS: The lpxB gene is essential for A. baumannii survival. Anti-lpxB pPNA inhibits LpxB expression, causing bacterial death. This pPNA showed synergy with colistin and increased the survival rate in G. mellonella. The data suggest that antisense pPNA molecules blocking the lpxB gene could be used as antibacterial agents.

Therapeutic Efficacy of LN-1-255 in Combination with Imipenem in Severe Infection Caused by Carbapenem-Resistant Acinetobacter baumannii.

The carbapenem-hydrolyzing class D ß-lactamases (CHDLs) are the main mechanism of carbapenem resistance in Acinetobacter baumannii CHDLs are not effectively inactivated by clinically available ß-lactam-type inhibitors. We have previously described the in vitro efficacy of the inhibitor LN-1-255 in combination with carbapenems. The aim of this study was to compare the efficacy of LN-1-255 with that of imipenem in murine pneumonia using A. baumannii strains carrying their most extended carbapenemases, OXA-23 and OXA-24/40. The blaOXA-23 and blaOXA-24/40 genes were cloned into the carbapenem-susceptible A. baumannii ATCC 17978 strain. Clinical isolates Ab1 and JC12/04, producing the enzymes OXA-23 and OXA-24/40, respectively, were used in the study. Pharmacokinetic (PK) parameters were determined. An experimental pneumonia model was used to evaluate the efficacy of the combined imipenem-LN-1-255 therapy. MICs of imipenem decreased between 32- and 128-fold in the presence of LN-1-255. Intramuscular treatment with imipenem-LN-1-255 (30/50 mg/kg) decreased the bacterial burden by (i) 4 and 1.7 log10 CFU/g lung in the infection with the ATCC 17978-OXA-23 and Ab1 strains, respectively, and by (ii) 2.5 and 4.5 log10 CFU/g lung in the infection produced by the ATCC 17978-OXA-24/40 and the JC12/04 strains, respectively. In all assays, combined therapy offered higher protection against pneumonia than that provided by monotherapy. No toxicity was observed in treated mice. Imipenem treatment combined with LN-1-255 treatment significantly reduced the severity of infection by carbapenem-resistant A. baumannii strains carrying CHDLs. Preclinical assays demonstrated the potential of LN-1-255 and imipenem therapy as a new antibacterial treatment.

Activity of the ß-Lactamase Inhibitor LN-1-255 against Carbapenem-Hydrolyzing Class D ß-Lactamases from Acinetobacter baumannii.

The number of infections caused by Gram-negative pathogens carrying carbapenemases is increasing, and the group of carbapenem-hydrolyzing class D ß-lactamases (CHDLs) is especially problematic. Several clinically important CHDLs have been identified in Acinetobacter baumannii, including OXA-23, OXA-24/40, OXA-58, OXA-143, OXA-235, and the chromosomally encoded OXA-51. The selection and dissemination of carbapenem-resistant A. baumannii strains constitutes a serious global threat. Carbapenems have been successfully utilized as last-resort antibiotics for the treatment of multidrug-resistant A. baumannii infections. However, the spread of OXA carbapenemases is compromising the continued use of these antimicrobials. In response to this clinical issue, it is necessary and urgent to design and develop new specific inhibitors with efficacy against these enzymes. The aim of this work was to characterize the inhibitory activity of LN-1-255 (a 6-alkylidene-2-substituted penicillin sulfone) and compare it to that of two established inhibitors (avibactam and tazobactam) against the most relevant enzymes of each group of class D carbapenemases in A. baumannii The ß-lactamase inhibitor LN-1-255 demonstrated excellent microbiological synergy and inhibition kinetics parameters against all tested CHDLs and a significantly higher activity than tazobactam and avibactam. A combination of carbapenems and LN-1-255 was effective against A. baumannii class D carbapenemases. Docking assays confirmed the affinity of LN-1-255 for the active site of these enzymes. LN-1-255 represents a potential new ß-lactamase inhibitor that may have a significant role in eradicating infections caused by A. baumannii isolates carrying CHDLs.

Synergy between Colistin and the Signal Peptidase Inhibitor MD3 Is Dependent on the Mechanism of Colistin Resistance in Acinetobacter baumannii.

Synergy between colistin and the signal peptidase inhibitor MD3 was tested against isogenic mutants and clinical pairs of Acinetobacter baumannii isolates. Checkerboard assays and growth curves showed synergy against both colistin-susceptible strains (fractional inhibitory concentration index [FICindex] = 0.13 to 0.24) and colistin-resistant strains with mutations in pmrB and phosphoethanolamine modification of lipid A (FICindex = 0.14 to 0.25) but not against colistin-resistant Δlpx strains with loss of lipopolysaccharide (FICindex = 0.75 to 1). A colistin/MD3 combination would need to be targeted to strains with specific colistin resistance mechanisms.

LN-1-255, a penicillanic acid sulfone able to inhibit the class D carbapenemase OXA-48.

OBJECTIVES: Carbapenemases are the most important mechanism responsible for carbapenem resistance in Enterobacteriaceae. Among carbapenemases, OXA-48 presents unique challenges as it is resistant to ß-lactam inhibitors. Here, we test the capacity of the compound LN-1-255, a 6-alkylidene-2'-substituted penicillanic acid sulfone, to inhibit the activity of the carbapenemase OXA-48. METHODS: The OXA-48 gene was cloned and expressed in Klebsiella pneumoniae and Escherichia coli in order to obtain MICs in the presence of inhibitors (clavulanic acid, tazobactam and sulbactam) and LN-1-255. OXA-48 was purified and steady-state kinetics was performed with LN-1-255 and tazobactam. The covalent binding mode of LN-1-255 with OXA-48 was studied by docking assays. RESULTS: Both OXA-48-producing clinical and transformant strains displayed increased susceptibility to carbapenem antibiotics in the presence of 4 mg/L LN-1-255 (2-32-fold increased susceptibility) and 16 mg/L LN-1-255 (4-64-fold increased susceptibility). Kinetic assays demonstrated that LN-1-255 is able to inhibit OXA-48 with an acylation efficiency (k2/K) of 10 ±â€Š1 × 10(4) M(-1) s(-1) and a slow deacylation rate (koff) of 7 ±â€Š1 × 10(-4) s(-1). IC50 was 3 nM for LN-1-255 and 1.5 µM for tazobactam. Lastly, kcat/kinact was 500-fold lower for LN-1-255 than for tazobactam. CONCLUSIONS: In these studies, carbapenem antibiotics used in combination with LN-1-255 are effective against the carbapenemase OXA-48, an important emerging mechanism of antibiotic resistance. This provides an incentive for further investigations to maximize the efficacy of penicillin sulfone inhibition of class D plasmid-carried Enterobacteriaceae carbapenemases.

Quantitative proteomic analysis of host--pathogen interactions: a study of Acinetobacter baumannii responses to host airways.

BACKGROUND: Acinetobacter baumannii is a major health problem. The most common infection caused by A. baumannii is hospital acquired pneumonia, and the associated mortality rate is approximately 50%. Neither in vivo nor ex vivo expression profiling has been performed at the proteomic or transcriptomic level for pneumonia caused by A. baumannii. In this study, we characterized the proteome of A. baumannii under conditions that simulate those found in the airways, to gain some insight into how A. baumannii adapts to the host and to improve knowledge about the pathogenesis and virulence of this bacterium. A clinical strain of A. baumannii was grown under different conditions: in the presence of bronchoalveolar lavage fluid from infected rats, of RAW 264.7 cells to simulate conditions in the respiratory tract and in control conditions. We used iTRAQ labelling and LC-MALDI-TOF/TOF to investigate how A. baumannii responds on exposure to macrophages/BALF. RESULTS: 179 proteins showed differential expression. In both models, proteins involved in the following processes were over-expressed: (i) pathogenesis and virulence (OmpA, YjjK); (ii) cell wall/membrane/envelope biogenesis (MurC); (iii) energy production and conversion (acetyl-CoA hydrolase); and (iv) translation (50S ribosomal protein L9). Proteins involved in the following were under-expressed: (i) lipid metabolism (short-chain dehydrogenase); (ii) amino acid metabolism and transport (aspartate aminotransferase); (iii) unknown function (DNA-binding protein); and (iv) inorganic ion transport and metabolism (hydroperoxidase). CONCLUSIONS: We observed alterations in cell wall synthesis and identified 2 upregulated virulence-associated proteins with >15 peptides/protein in both ex vivo models (OmpA and YjjK), suggesting that these proteins are fundamental for pathogenesis and virulence in the airways. This study is the first comprehensive overview of the ex vivo proteome of A. baumannii and is an important step towards identification of diagnostic biomarkers, novel drug targets and potential vaccine candidates in the fight against pneumonia caused by A. baumannii.

Emergence of Carbapenemase Genes in Gram-Negative Bacteria Isolated from the Wastewater Treatment Plant in A Coruña, Spain.

Wastewater treatment plants (WWTPs) are recognized as important niches of antibiotic-resistant bacteria that can be easily spread to the environment. In this study, we collected wastewater samples from the WWTP of A Coruña (NW Spain) from April 2020 to February 2022 to evaluate the presence of Gram-negative bacteria harboring carbapenemase genes. Bacteria isolated from wastewater were classified and their antimicrobial profiles were determined. In total, 252 Gram-negative bacteria carrying various carbapenemase genes were described. Whole-genome sequencing was conducted on 55 selected carbapenemase producing isolates using Oxford Nanopore technology. This study revealed the presence of a significant population of bacteria carrying carbapenemase genes in WWTP, which constitutes a public health problem due to their risk of dissemination to the environment. This emphasizes the usefulness of WWTP monitoring for combating antibiotic resistance. Data revealed the presence of different types of sequences harboring carbapenemase genes, such as blaKPC-2, blaGES-5, blaGES-6, blaIMP-11, blaIMP-28, blaOXA-24, blaOXA-48, blaOXA-58, blaOXA-217, and blaVIM-2. Importantly, the presence of the blaKPC-2 gene in wastewater, several months before any clinical case was detected in University Hospital of A Coruña, suggests that wastewater-based epidemiology can be used as an early warning system for the surveillance of antibiotic-resistant bacteria.

Native and non-native freshwater bivalves in the bioremediation of bacterial pollution caused by the disposal of sewage.

Treated sewage contains a large diversity of pathogens that can be transmitted to the environment and, directly or indirectly, infect humans through water use (i.e., consumption, bathing, or irrigation). In urban environments, wastewater normally flows into wastewater treatment plants (WWTPs), where it is subjected to different processes in order to eliminate the greatest amount of waste. However, there are inequalities among European countries concerning wastewater management. In this context, we evaluate the potential of freshwater mussels to improve water quality (i.e., reduce bacterial abundance) in rivers receiving primary, secondary, or tertiary sewage-treated effluents. Additionally, because freshwater mussels are declining at a global scale and empty niches are progressively occupied by non-native counterparts, we evaluate if depauperate communities and the Asian clams, Corbicula genus, can provide equivalent ecosystem services (i.e., water quality improvement by biofiltration) formerly provided by diverse native communities. For this, an analysis of the bacterial biodiversity of the samples filtered by the different bivalve communities was carried out. The experimental approach was performed by metabarcoding the 16S rRNA gene using Illumina technologies. According to the results obtained, secondary treatment processes were effective in reducing the bacterial diversity. Furthermore, the waters filtered by the bivalves presented a lower bacterial abundance for certain genera. Biofiltration differs, however, among species, with Corbicula reducing a large number of taxa much more efficiently than native freshwater mussels in both diverse and depauperated communities. These results are likely related to Corbicula being a generalist species in front of native mussels, which may be more selective. Considering it is not possible to eradicate Corbicula from European rivers, its filtering capacity should be considered when managing freshwater ecosystems.

The multispecies microbial cluster of Fusobacterium, Parvimonas, Bacteroides and Faecalibacterium as a precision biomarker for colorectal cancer diagnosis.

The incidence of colorectal cancer (CRC) has increased worldwide, and early diagnosis is crucial to reduce mortality rates. Therefore, new noninvasive biomarkers for CRC are required. Recent studies have revealed an imbalance in the oral and gut microbiomes of patients with CRC, as well as impaired gut vascular barrier function. In the present study, the microbiomes of saliva, crevicular fluid, feces, and non-neoplastic and tumor intestinal tissue samples of 93 CRC patients and 30 healthy individuals without digestive disorders (non-CRC) were analyzed by 16S rRNA metabarcoding procedures. The data revealed that Parvimonas, Fusobacterium, and Bacteroides fragilis were significantly over-represented in stool samples of CRC patients, whereas Faecalibacterium and Blautia were significantly over-abundant in the non-CRC group. Moreover, the tumor samples were enriched in well-known periodontal anaerobes, including Fusobacterium, Parvimonas, Peptostreptococcus, Porphyromonas, and Prevotella. Co-occurrence patterns of these oral microorganisms were observed in the subgingival pocket and in the tumor tissues of CRC patients, where they also correlated with other gut microbes, such as Hungatella. This study provides new evidence that oral pathobionts, normally located in subgingival pockets, can migrate to the colon and probably aggregate with aerobic bacteria, forming synergistic consortia. Furthermore, we suggest that the group composed of Fusobacterium, Parvimonas, Bacteroides, and Faecalibacterium could be used to design an excellent noninvasive fecal test for the early diagnosis of CRC. The combination of these four genera would significantly improve the reliability of a discriminatory test with respect to others that use a single species as a unique CRC biomarker.

Dispersal history of SARS-CoV-2 in Galicia, Spain.

The dynamics of SARS-CoV-2 transmission are influenced by a variety of factors, including social restrictions and the emergence of distinct variants. In this study, we delve into the origins and dissemination of the Alpha, Delta, and Omicron variants of concern in Galicia, northwest Spain. For this, we leveraged genomic data collected by the EPICOVIGAL Consortium and from the GISAID database, along with mobility information from other Spanish regions and foreign countries. Our analysis indicates that initial introductions during the Alpha phase were predominantly from other Spanish regions and France. However, as the pandemic progressed, introductions from Portugal and the USA became increasingly significant. Notably, Galicia's major coastal cities emerged as critical hubs for viral transmission, highlighting their role in sustaining and spreading the virus. This research emphasizes the critical role of regional connectivity in the spread of SARS-CoV-2 and offers essential insights for enhancing public health strategies and surveillance measures.

Identification of a DNA-damage-inducible regulon in Acinetobacter baumannii.

The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.

Parvimonas micra can translocate from the subgingival sulcus of the human oral cavity to colorectal adenocarcinoma.

Oral and intestinal samples from a cohort of 93 colorectal cancer (CRC) patients and 30 healthy controls (non-CRC) were collected for microbiome analysis. Saliva (28 non-CRC and 94 CRC), feces (30 non-CRC and 97 CRC), subgingival fluid (20 CRC), and tumor tissue samples (20 CRC) were used for 16S metabarcoding and/or RNA sequencing (RNAseq) approaches. A differential analysis of the abundance, performed with the ANCOM-BC package, adjusting the P-values by the Holm-Bonferroni method, revealed that Parvimonas was significantly over-represented in feces from CRC patients (P-value < 0.001) compared to healthy controls. A total of 11 Parvimonas micra isolates were obtained from the oral cavity and adenocarcinoma of CRC patients. Genome analysis identified a pair of isolates from the same patient that shared 99.2% identity, demonstrating that P. micra can translocate from the subgingival cavity to the gut. The data suggest that P. micra could migrate in a synergistic consortium with other periodontal bacteria. Metatranscriptomics confirmed that oral bacteria were more active in tumor than in non-neoplastic tissues. We suggest that P. micra could be considered as a CRC biomarker detected in non-invasive samples such as feces.

Wastewater early warning system for SARS-CoV-2 outbreaks and variants in a Coruña, Spain.

Wastewater-based epidemiology has been widely used as a cost-effective method for tracking the COVID-19 pandemic at the community level. Here we describe COVIDBENS, a wastewater surveillance program running from June 2020 to March 2022 in the wastewater treatment plant of Bens in A Coruña (Spain). The main goal of this work was to provide an effective early warning tool based in wastewater epidemiology to help in decision-making at both the social and public health levels. RT-qPCR procedures and Illumina sequencing were used to weekly monitor the viral load and to detect SARS-CoV-2 mutations in wastewater, respectively. In addition, own statistical models were applied to estimate the real number of infected people and the frequency of each emerging variant circulating in the community, which considerable improved the surveillance strategy. Our analysis detected 6 viral load waves in A Coruña with concentrations between 103 and 106 SARS-CoV-2 RNA copies/L. Our system was able to anticipate community outbreaks during the pandemic with 8-36 days in advance with respect to clinical reports and, to detect the emergence of new SARS-CoV-2 variants in A Coruña such as Alpha (B.1.1.7), Delta (B.1.617.2), and Omicron (B.1.1.529 and BA.2) in wastewater with 42, 30, and 27 days, respectively, before the health system did. Data generated here helped local authorities and health managers to give a faster and more efficient response to the pandemic situation, and also allowed important industrial companies to adapt their production to each situation. The wastewater-based epidemiology program developed in our metropolitan area of A Coruña (Spain) during the SARS-CoV-2 pandemic served as a powerful early warning system combining statistical models with mutations and viral load monitoring in wastewater over time.

Effect of transcriptional activators SoxS, RobA, and RamA on expression of multidrug efflux pump AcrAB-TolC in Enterobacter cloacae.

Control of membrane permeability is a key step in regulating the intracellular concentration of antibiotics. Efflux pumps confer innate resistance to a wide range of toxic compounds such as antibiotics, dyes, detergents, and disinfectants in members of the Enterobacteriaceae. The AcrAB-TolC efflux pump is involved in multidrug resistance in Enterobacter cloacae. However, the underlying mechanism that regulates the system in this microorganism remains unknown. In Escherichia coli, the transcription of acrAB is upregulated under global stress conditions by proteins such as MarA, SoxS, and Rob. In the present study, two clinical isolates of E. cloacae, EcDC64 (a multidrug-resistant strain overexpressing the AcrAB-TolC efflux pump) and Jc194 (a strain with a basal AcrAB-TolC expression level), were used to determine whether similar global stress responses operate in E. cloacae and also to establish the molecular mechanisms underlying this response. A decrease in susceptibility to erythromycin, tetracycline, telithromycin, ciprofloxacin, and chloramphenicol was observed in clinical isolate Jc194 and, to a lesser extent in EcDC64, in the presence of salicylate, decanoate, tetracycline, and paraquat. Increased expression of the acrAB promoter in the presence of the above-described conditions was observed by flow cytometry and reverse transcription-PCR, by using a reporter fusion protein (green fluorescent protein). The expression level of the AcrAB promoter decreased in E. cloacae EcDC64 derivates deficient in SoxS, RobA, and RamA. Accordingly, the expression level of the AcrAB promoter was higher in E. cloacae Jc194 strains overproducing SoxS, RobA, and RamA. Overall, the data showed that SoxS, RobA, and RamA regulators were associated with the upregulation of acrAB, thus conferring antimicrobial resistance as well as a stress response in E. cloacae. In summary, the regulatory proteins SoxS, RobA, and RamA were cloned and sequenced for the first time in this species. The involvement of these proteins in conferring antimicrobial resistance through upregulation of acrAB was demonstrated in E. cloacae.

Involvement of the AcrAB-TolC efflux pump in the resistance, fitness, and virulence of Enterobacter cloacae.

Multidrug efflux pumps have emerged as important mechanisms of antimicrobial resistance in bacterial pathogens. In order to cause infection, pathogenic bacteria require mechanisms to avoid the effects of host-produced compounds, and express efflux pumps may accomplish this task. In this study, we evaluated the effect of the inactivation of AcrAB-TolC on antimicrobial resistance, fitness, and virulence in Enterobacter cloacae, an opportunistic pathogen usually involved in nosocomial infections. Two different clinical isolates of E. cloacae were used, EcDC64 (multidrug resistance overexpressing the AcrAB-TolC efflux pump) and Jc194 (basal AcrAB-TolC expression). The acrA and tolC genes were deleted in strains EcDC64 and Jc194 to produce, respectively, EcΔacrA and EcΔtolC and JcΔacrA and JcΔtolC knockout (KO) derivatives. Antibiotic susceptibility testing was performed with all isolates, and we discovered that these mechanisms are involved in the resistance of E. cloacae to several antibiotics. Competition experiments were also performed with wild-type and isogenic KO strains. The competition index (CI), defined as the mutant/wild-type ratio, revealed that the acrA and tolC genes both affect the fitness of E. cloacae, as fitness was clearly reduced in the acrA and tolC KO strains. The median CI values obtained in vitro and in vivo were, respectively, 0.42 and 0.3 for EcDC64/EcΔacrA, 0.24 and 0.38 for EcDC64/EcΔtolC, 0.15 and 0.11 for Jc194/JcΔacrA, and 0.38 and 0.39 for Jc194/JcΔtolC. Use of an intraperitoneal mouse model of systemic infection revealed reduced virulence in both E. cloacae clinical strains when either the acrA or tolC gene was inactivated. In conclusion, the structural components of the AcrAB-TolC efflux pump appear to play a role in antibiotic resistance as well as environmental adaptation and host virulence in clinical isolates of E. cloacae.