Ran/TC4: a small nuclear GTP-binding protein that regulates DNA synthesis.

Ran/TC4, first identified as a well-conserved gene distantly related to H-RAS, encodes a protein which has recently been shown in yeast and mammalian systems to interact with RCC1, a protein whose function is required for the normal coupling of the completion of DNA synthesis and the initiation of mitosis. Here, we present data indicating that the nuclear localization of Ran/TC4 requires the presence of RCC1. Transient expression of a Ran/TC4 protein with mutations expected to perturb GTP hydrolysis disrupts host cell DNA synthesis. These results suggest that Ran/TC4 and RCC1 are components of a GTPase switch that monitors the progress of DNA synthesis and couples the completion of DNA synthesis to the onset of mitosis.

Differential localization of Rho GTPases in live cells: regulation by hypervariable regions and RhoGDI binding.

Determinants of membrane targeting of Rho proteins were investigated in live cells with green fluorescent fusion proteins expressed with or without Rho-guanine nucleotide dissociation inhibitor (GDI)alpha. The hypervariable region determined to which membrane compartment each protein was targeted. Targeting was regulated by binding to RhoGDI alpha in the case of RhoA, Rac1, Rac2, and Cdc42hs but not RhoB or TC10. Although RhoB localized to the plasma membrane (PM), Golgi, and motile peri-Golgi vesicles, TC10 localized to PMs and endosomes. Inhibition of palmitoylation mislocalized H-Ras, RhoB, and TC10 to the endoplasmic reticulum. Although overexpressed Cdc42hs and Rac2 were observed predominantly on endomembrane, Rac1 was predominantly at the PM. RhoA was cytosolic even when expressed at levels in vast excess of RhoGDI alpha. Oncogenic Dbl stimulated translocation of green fluorescent protein (GFP)-Rac1, GFP-Cdc42hs, and GFP-RhoA to lamellipodia. RhoGDI binding to GFP-Cdc42hs was not affected by substituting farnesylation for geranylgeranylation. A palmitoylation site inserted into RhoA blocked RhoGDI alpha binding. Mutations that render RhoA, Cdc42hs, or Rac1, either constitutively active or dominant negative abrogated binding to RhoGDI alpha and redirected expression to both PMs and internal membranes. Thus, despite the common essential feature of the CAAX (prenylation, AAX tripeptide proteolysis, and carboxyl methylation) motif, the subcellular localizations of Rho GTPases, like their functions, are diverse and dynamic.

Burkholderia glumae and B. gladioli Cause Bacterial Panicle Blight in Rice in the Southern United States.

Bacterial panicle blight (BPB) is among the three most limiting rice diseases in Louisiana and the southern United States. The identity and characterization of pathogens associated with this disease was unclear. This research details studies carried out on the pathogens causing BPB on rice in Louisiana and other rice producing southern states. Bacterial strains were isolated from BPB-infected sheath, panicle, or grain samples collected from rice fields in Louisiana, Arkansas, Texas, and Mississippi. In greenhouse inoculation tests, 292 of 364 strains were pathogenic on rice seedlings or panicles. Identification of strains in the pathogen complex by growth on S-PG medium, carbon source utilization profile (Biolog), cellular fatty acid analysis, and polymerase chain reaction (PCR) methods revealed that 76 and 5% of the strains were Burkholderia glumae and B. gladioli, respectively. The other strains have not been conclusively identified. Although strains of both species produced similar symptoms on rice, B. glumae strains were generally more aggressive and caused more severe symptoms on rice than B. gladioli. Virulent strains of both species produced toxoflavin in culture. The two species had similar growth responses to temperature, and optima ranged from 38 to 40°C for B. glumae and 35 to 37°C for B. gladioli. PCR was the most sensitive and accurate method tested for identifying the bacterial pathogens to the species level. The 16S rDNA gene and 16S-23S rDNA internal transcribed spacer (ITS) region sequences of the B. glumae and B. gladioli strains from rice showed more than 99% sequence homology with published sequences. A real-time PCR system was developed to detect and quantify this pathogen from infected seed lots. Our results clearly indicate that B. glumae and B. gladioli were the major pathogens causing BPB in the southern United States.

Characterization of four novel ras-like genes expressed in a human teratocarcinoma cell line.

A mixed-oligonucleotide probe was used to identify four ras-like coding sequences in a human teratocarcinoma cDNA library. Two of these sequences resembled the rho genes, one was closely related to H-, K-, and N-ras, and one shared only the four sequence domains that define the ras gene superfamily. Homologs of the four genes were found in genomic DNA from a variety of mammals and from chicken. The genes were transcriptionally active in a range of human cell types.

Effects of mutant Ran/TC4 proteins on cell cycle progression.

Ran/TC4, a member of the RAS gene superfamily, encodes an abundant nuclear protein that binds and hydrolyzes GTP. Transient expression of a Ran/TC4 mutant protein deficient in GTP hydrolysis blocked DNA replication, suggesting a role for Ran/TC4 in the regulation of cell cycle progression. To test this possibility, we exploited an efficient transfection system, involving the introduction of cDNAs in the pMT2 vector into 293/Tag cells, to analyze phenotypes associated with mutant and wild-type Ran/TC4 expression. Expression of a Ran/TC4 mutant protein deficient in GTP hydrolysis inhibited proliferation of transfected cells by arresting them predominantly in the G2, but also in the G1, phase of the cell cycle. Deletion of an acidic carboxy-terminal hexapeptide from the Ran/TC4 mutant did not alter its nuclear localization but did block its inhibitory effect on cell cycle progression. These data suggest that normal progression of the cell cycle is coupled to the operation of a Ran/TC4 GTPase cycle. Mediators of this coupling are likely to include the nuclear regulator of chromosome condensation 1 protein and the mitosis-promoting factor complex.

Aberrant function of the Ras-related protein TC21/R-Ras2 triggers malignant transformation.

Although the human Ras proteins are members of a large superfamily of Ras-related proteins, to date, only the proteins encoded by the three mammalian ras genes have been found to possess oncogenic potential. Among the known Ras-related proteins, TC21/R-Ras2 exhibits the most significant amino acid identity (55%) to Ras proteins. We have generated mutant forms of TC21 that possess amino acid substitutions analogous to those that activate Ras oncogenic potential [designated TC21(22V) and TC21(71L)] and compared the biological properties of TC21 with those of Ras proteins in NIH 3T3 and Rat-1 transformation assays. Whereas wild-type TC21 did not show any transforming potential in vitro, both TC21(22V) and TC21(71L) displayed surprisingly potent transforming activities that were comparable to the strong transforming activity of oncogenic Ras proteins. Like Ras-transformed cells, NIH 3T3 cells expressing mutant TC21 proteins formed foci of morphologically transformed cells in monolayer cultures, proliferated in low serum, formed colonies in soft agar, and developed progressive tumors in nude mice. Thus, TC21 is the first Ras-related protein to exhibit potent transforming activity equivalent to that of Ras. Furthermore, mutant TC21 proteins also stimulated constitutive activation of mitogen-activated protein kinases as well as transcriptional activation from Ras-responsive promoter elements (Ets/AP-1 and NF-kappa B). We conclude that aberrant TC21 function may trigger cellular transformation via a signal transduction pathway similar to that of oncogenic Ras and suggest that deregulated TC21 activity may contribute significantly to human oncogenesis.

Separate domains of the Ran GTPase interact with different factors to regulate nuclear protein import and RNA processing.

The small Ras-related GTP binding and hydrolyzing protein Ran has been implicated in a variety of processes, including cell cycle progression, DNA synthesis, RNA processing, and nuclear-cytosolic trafficking of both RNA and proteins. Like other small GTPases, Ran appears to function as a switch: Ran-GTP and Ran-GDP levels are regulated both by guanine nucleotide exchange factors and GTPase activating proteins, and Ran-GTP and Ran-GDP interact differentially with one or more effectors. One such putative effector, Ran-binding protein 1 (RanBP1), interacts selectively with Ran-GTP. Ran proteins contain a diagnostic short, acidic, carboxyl-terminal domain, DEDDDL, which, at least in the case of human Ran, is required for its role in cell cycle regulation. We show here that this domain is required for the interaction between Ran and RanBP1 but not for the interaction between Ran and a Ran guanine nucleotide exchange factor or between Ran and a Ran GTPase activating protein. In addition, Ran lacking this carboxyl-terminal domain functions normally in an in vitro nuclear protein import assay. We also show that RanBP1 interacts with the mammalian homolog of yeast protein RNA1, a protein involved in RNA transport and processing. These results are consistent with the hypothesis that Ran functions directly in at least two pathways, one, dependent on RanBP1, that affects cell cycle progression and RNA export, and another, independent of RanBP1, that affects nuclear protein import.

Isolated mammalian and Schizosaccharomyces pombe ran-binding domains rescue S. pombe sbp1 (RanBP1) genomic mutants.

Mammalian Ran-binding protein-1 (RanBP1) and its fission yeast homologue, sbp1p, are cytosolic proteins that interact with the GTP-charged form of Ran GTPase through a conserved Ran-binding domain (RBD). In vitro, this interaction can accelerate the Ran GTPase-activating protein-mediated hydrolysis of GTP on Ran and the turnover of nuclear import and export complexes. To analyze RanBP1 function in vivo, we expressed exogenous RanBP1, sbp1p, and the RBD of each in mammalian cells, in wild-type fission yeast, and in yeast whose endogenous sbp1 gene was disrupted. Mammalian cells and wild-type yeast expressing moderate levels of each protein were viable and displayed normal nuclear protein import. sbp1(-) yeast were inviable but could be rescued by all four exogenous proteins. Two RBDs of the mammalian nucleoporin RanBP2 also rescued sbp1(-) yeast. In mammalian cells, wild-type yeast, and rescued mutant yeast, exogenous full-length RanBP1 and sbp1p localized predominantly to the cytosol, whereas exogenous RBDs localized predominantly to the cell nucleus. These results suggest that only the RBD of sbp1p is required for its function in fission yeast, and that this function may not require confinement of the RBD to the cytosol. The results also indicate that the polar amino-terminal portion of sbp1p mediates cytosolic localization of the protein in both yeast and mammalian cells.

A T42A Ran mutation: differential interactions with effectors and regulators, and defect in nuclear protein import.

Ran, the small, predominantly nuclear GTPase, has been implicated in the regulation of a variety of cellular processes including cell cycle progression, nuclear-cytoplasmic trafficking of RNA and protein, nuclear structure, and DNA synthesis. It is not known whether Ran functions directly in each process or whether many of its roles may be secondary to a direct role in only one, for example, nuclear protein import. To identify biochemical links between Ran and its functional target(s), we have generated and examined the properties of a putative Ran effector mutation, T42A-Ran. T42A-Ran binds guanine nucleotides as well as wild-type Ran and responds as well as wild-type Ran to GTP or GDP exchange stimulated by the Ran-specific guanine nucleotide exchange factor, RCC1. T42A-Ran.GDP also retains the ability to bind p10/NTF2, a component of the nuclear import pathway. In contrast to wild-type Ran, T42A-Ran.GTP binds very weakly or not detectably to three proposed Ran effectors, Ran-binding protein 1 (RanBP1), Ran-binding protein 2 (RanBP2, a nucleoporin), and karyopherin beta (a component of the nuclear protein import pathway), and is not stimulated to hydrolyze bound GTP by Ran GTPase-activating protein, RanGAP1. Also in contrast to wild-type Ran, T42A-Ran does not stimulate nuclear protein import in a digitonin permeabilized cell assay and also inhibits wild-type Ran function in this system. However, the T42A mutation does not block the docking of karyophilic substrates at the nuclear pore. These properties of T42A-Ran are consistent with its classification as an effector mutant and define the exposed region of Ran containing the mutation as a probable effector loop.

Association of Burkholderia glumae and B. gladioli with Panicle Blight Symptoms on Rice in Panama.

Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5'ACACGG AACACCTGGGTA3' and BGR 5'TCGCTCTCCCGAAGAGAT3') gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5'CGAGCT AATACCGCGAAA3' and BLR 5'AGACTCGA GTCAACTGA3') identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5'AGAGTTTGATCCTGGCTCAG3' and 16SR5'GGCTACCTTGTTACGACTT3') and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.

Identification and characterization of a human homolog of the Schizosaccharomyces pombe ras-like gene YPT-3.

The Polymerase Chain Reaction was used to amplify ras and ras-like sequences from two human cDNA libraries. Members corresponding to each of the three major ras-subfamilies (ras, rho, and rab/YPT) were identified. The one homologous to rab/YPT, referred to here as YL8, appears to be the human homolog of the recently reported Schizosaccharomyces pombe YPT3 gene. The YL8 gene could encode a guanine nucleotide binding protein of 216 amino acids with about 70% amino acid sequence identity to S. pombe YPT3, and is transcriptionally active in a variety of human cell lines.

Cellular functions of TC10, a Rho family GTPase: regulation of morphology, signal transduction and cell growth.

The small Ras-related GTPase, TC10, has been classified on the basis of sequence homology to be a member of the Rho family. This family, which includes the Rho, Rac and CDC42 subfamilies, has been shown to regulate a variety of apparently diverse cellular processes such as actin cytoskeletal organization, mitogen-activated protein kinase (MAPK) cascades, cell cycle progression and transformation. In order to begin a study of TC10 biological function, we expressed wild type and various mutant forms of this protein in mammalian cells and investigated both the intracellular localization of the expressed proteins and their abilities to stimulate known Rho family-associated processes. Wild type TC10 was located predominantly in the cell membrane (apparently in the same regions as actin filaments), GTPase defective (75L) and GTP-binding defective (31N) mutants were located predominantly in cytoplasmic perinuclear regions, and a deletion mutant lacking the carboxyl terminal residues required for post-translational prenylation was located predominantly in the nucleus. The GTPase defective (constitutively active) TC10 mutant: (1) stimulated the formation of long filopodia; (2) activated c-Jun amino terminal kinase (JNK); (3) activated serum response factor (SRF)-dependent transcription; (4) activated NF-kappaB-dependent transcription; and (5) synergized with an activated Raf-kinase (Raf-CAAX) to transform NIH3T3 cells. In addition, wild type TC10 function is required for full H-Ras transforming potential. We demonstrate that an intact effector domain and carboxyl terminal prenylation signal are required for proper TC10 function and that TC10 signals to at least two separable downstream target pathways. In addition, TC10 interacted with the actin-binding and filament-forming protein, profilin, in both a two-hybrid cDNA library screen, and an in vitro binding assay. Taken together, these data support a classification of TC10 as a member of the Rho family, and in particular, suggest that TC10 functions to regulate cellular signaling to the actin cytoskeleton and processes associated with cell growth.

Preparation of radioiodinated simian virus 40 DNA for use in DNA - DNA reassociation kinetics experiments.

A method is described for the preparation of 125I-labelled SV40 DNA. Using this method, SV40 DNA can be routinely labelled to 15 - 10(6) dpm per mug; much higher specific activities are easily obtained by minor modifications of the method. Once incorporated, the radioactive label dissociates from DNA exceedingly slowly at 4 degrees C or at 68 degrees C. Iodinated SV40 DNA is shown to be useful in the quantitation of viral nucleic acid sequences in SV40-transformed 3T3 cells by DNA - DNA reassociation kinetics.

The KpnI family of long interspersed nucleotide sequences is present on discrete sizes of circular DNA in monkey (BSC-1) cells.

Discretely sized molecules of small circular DNAs in African green monkey kidney (BSC-1) cells contain nucleotide sequences homologous to the KpnI family of long interspersed repetitive nucleotide sequences. The size distribution of these KpnI family-containing circular DNAs differs markedly from those of BSC-1 cell circular DNAs containing either the Alu family of short interspersed nucleotide sequences or the alpha-satellite family of tandemly repeated sequences. The structures of several cloned, apparently whole, KpnI family-related circular DNAs of varying sizes were analyzed and compared with a compilation of chromosomal KpnI sequences. In general, it was found that the cloned DNAs all contained only KpnI sequences, and that the recombination events given rise to them did not involve any noticeable gain of nucleotides.

Some extrachromosomal circular DNAs containing the Alu family of dispersed repetitive sequences may be reverse transcripts.

A 300 base-pair (bp) size class of small polydisperse circular DNA (spcDNA) isolated from the BSC-1 line of African Green monkey kidney cells was cleaved with the restriction endonuclease Sau3A, and the resulting fragments (100 to 200 bp) were cloned in bacteriophage M13 mp7. The nucleotide sequence of each of 24 clones containing DNA sequences homologous to the Alu family of mobile, dispersed, repetitive elements was then determined. Analysis of these sequences revealed that many, and perhaps all, of the 300 bp Alu-containing spcDNAs had regions in which the 5' and 3' ends of the normal Alu element were juxtaposed and covalently joined. Although more than one model can explain the generation of such circular molecules, the most attractive one at this time involves their generation from reverse transcripts of Alu-specific RNAs.

Cloned extrachromosomal circular DNA copies of the human transposable element THE-1 are related predominantly to a single type of family member.

The 2300 base-pair transposon-like human element, THE-1, has been identified in the extrachromosomal circular DNA of the established human cell line HeLa as a relatively homogeneous population of covalently closed 1900 base-pair molecules. THE-1, which has been classified tentatively as a retroviral-like transposable element (a retrotransposon), is present in the extrachromosomal circular DNA of African green monkey (BSC-1) and human lymphoblastoid (Jurkat) cell lines. The 1900 base-pair extrachromosomal elements isolated and cloned from HeLa cells (1) appear to contain only THE-1-specific nucleotide sequences, (2) are circularized versions of the linear chromosomal sequence, and (3) are related predominantly to a single, or single type of, family member.

Structure of extrachromosomal circular DNAs containing both the Alu family of dispersed repetitive sequences and other regions of chromosomal DNA.

Small polydisperse circular DNA (spcDNA) isolated from the BSC-1 line of African Green monkey kidney cells was digested with the restriction endonuclease BamHI and cloned in bacteriophage lambda. The resulting library of 25,000 phage was then screened for the presence of the Alu family of short interspersed nucleotide sequences, and four of the 100 Alu-positive clones were characterized. In summary: (1) all four clones contained regions other than Alu that were homologous to the BSC-1 chromosome. Two contained Alu plus unique chromosomal DNA, one contained Alu plus an uncharacterized repetitive chromosomal DNA, and one contained Alu plus both unique and a specific tandemly repeated chromosomal DNA (alpha-satellite); (2) all four clones were derived from extrachromosomal circular DNAs and not from the accidental cloning of a very small amount of contaminating chromosomal material assumed to be present in spcDNA preparations; and (3) one clone represented an intact circular DNA with a restriction endonuclease cleavage map that was a circularly permuted version of its chromosomal homologue.

Massive Muscular Infection by a Sarcocystis Species in a South American Rattlesnake (Crotalus durissus terrificus).

Massive numbers of sarcocysts of a previously undescribed species of Sarcocystis were observed in the skeletal muscles throughout the body of an adult, female South American rattlesnake (Crotalus durissus terrificus). Examination of tissue sections by light microscopy demonstrated that sarcocysts were present in 20 to 40% of muscle fibers from 5 sampled locations. Sarcocysts were not present in cardiac muscle, smooth muscle, or other organs. Sarcocysts were 0.05-0.15 mm wide, had variable length depending on the viewed orientation and size of the muscle fiber, and had a sarcocyst wall less than 1-µm thick. Sarcocysts were subdivided by septa and had central degeneration in older sarcocysts. Host induced secondary encapsulation or an inflammatory response was not present. By transmission electron microscopy (TEM), the sarcocyst wall was Type I, with a parasitophorous membrane of approximately 100 nanometers in width arranged in an undulating pattern and intermittently folded inward in a branching pattern. The sarcocysts contained metrocytes in different stages of development and mature bradyzoites. The nucleic acid sequence from a section of the 18S small subunit rRNA gene was most closely related to S. mucosa that uses marsupials as intermediate hosts and has an unknown definitive host. This is apparently the third report of muscular Sarcocystis infection in snakes and is the first to describe the ultrastructure of the sarcocysts and use sequencing methods to aid in identification.

Opposing effects of retinoic acid and dexamethasone on cellular retinol-binding protein ribonucleic acid levels in the rat.

Cellular retinol-binding protein (CRBP) is a potential mediator of vitamin A action. To determine whether retinoic acid and dexamethasone administration, alone and in combination, influence CRBP gene expression, adult female vitamin A-sufficient Sprague-Dawley rats randomly received 1) all-trans retinoic acid (100 micrograms) by intragastric intubation, 2) dexamethasone (2 micrograms/g BW) by ip injection, or 3) both all-trans retinoic acid and dexamethasone in the same doses. Control animals received either cottonseed oil by intragastric intubation or saline by ip injection. Six hours after treatment, lung and liver tissue were collected for Northern blot analysis with the radiolabeled cDNA specific for rat CRBP. Retinoic acid administration increased the amount of lung CRBP mRNA only, whereas dexamethasone decreased both lung and liver CRBP mRNA abundance. In animals treated with both retinoic acid and dexamethasone, CRBP mRNA abundance was also reduced. We conclude that CRBP gene expression can be modulated by both retinoic acid and dexamethasone in the vitamin A-sufficient animal. In the whole animal, our findings indicate that dexamethasone not only represses CRBP gene expression, but also opposes the effect of retinoic acid.

Isolated gonadotropin-releasing hormone neurons harvested from adult male rats secrete biologically active neuropeptide in a regular repetitive manner.

Immunochemical treatments for the recovery of viable GnRH neurons from adult male rats have previously been described by this laboratory. In the present report, efforts were made to limit cellular adhesion, as well as the proteolytic and mechanical damage which occurred during isolation of the neurons, in order to determine if such damage may account for failure of the isolated cells to exhibit spontaneous neuropeptide release. These modifications prevented the loss of assayable GnRH during the isolation process, and neurons recovered from individual rats in this study contained 10.7 +/- 2.5 ng GnRH. Further, all isolated neuronal preparations exhibited spontaneous peptide release which continued in a regular repetitive manner. When maintained in closed chambers, these preparations released 105 +/- 42 pg/ml biologically active GnRH at 18.9 +/- 0.4-min intervals. In contrast, GnRH release from heterologous preparations was characterized by erratic low level pulses. The results from this work suggest that independent neuroendocrine properties of GnRH neurons may be responsible for tonic gonadotropin secretion in castrated adult male rats and that the erratic patterns of gonadotropin release in gonadally intact males may be related, in part, to coupling between GnRH neurons and unidentified neuronal factors.